Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP034253 Escherichia coli strain IVRI Kol CP4 chromosome, complete genome 10 crisprs DEDDh,cas3,RT,csa3,PD-DExK,cas5,cas6e,cas1,cas2,c2c9_V-U4,DinG 0 12 9 0
NZ_CP034256 Escherichia coli strain IVRI Kol CP4 plasmid pESBL-EA11pO83_CORR 0 crisprs RT 0 0 0 0
NZ_CP034255 Escherichia coli strain IVRI Kol CP4 plasmid pESBL-EA11 0 crisprs NA 0 0 0 0
NZ_CP034254 Escherichia coli strain IVRI Kol CP4 plasmid p1ESCUMpO83_CORR 0 crisprs RT 0 0 0 0

Results visualization

1. NZ_CP034253
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034253_1 467895-468048 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034253_2 658060-658175 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034253_3 2127018-2127157 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034253_4 2171915-2172032 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034253_5 2545345-2545861 Orphan I-E
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034253_6 2568245-2568883 Unclear I-E
10 spacers
cas2,cas1,cas6e,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034253_7 3084233-3084350 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034253_8 3673952-3674075 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034253_9 4328216-4328307 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034253_10 4643573-4643717 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP034253_9 9.1|4328242|40|NZ_CP034253|CRISPRCasFinder 4328242-4328281 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP034253_8 8.1|3673995|38|NZ_CP034253|CRISPRCasFinder 3673995-3674032 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP034253_1 1.1|467948|48|NZ_CP034253|CRISPRCasFinder 467948-467995 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4089-4136 3 0.938
NZ_CP034253_1 1.1|467948|48|NZ_CP034253|CRISPRCasFinder 467948-467995 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4088-4135 3 0.938
NZ_CP034253_1 1.1|467948|48|NZ_CP034253|CRISPRCasFinder 467948-467995 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4088-4135 3 0.938
NZ_CP034253_1 1.1|467948|48|NZ_CP034253|CRISPRCasFinder 467948-467995 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4088-4135 3 0.938
NZ_CP034253_3 3.1|2127067|42|NZ_CP034253|CRISPRCasFinder 2127067-2127108 42 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30214-30255 7 0.833
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51276-51307 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45716-45747 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51276-51307 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45716-45747 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51276-51307 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51276-51307 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51276-51307 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29015-29046 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78292-78323 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39594 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51933 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18560-18591 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49240-49271 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81434-81465 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28916-28947 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36182-36213 7 0.781
NZ_CP034253_5 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545740-2545771 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32230-32261 7 0.781
NZ_CP034253_3 3.1|2127067|42|NZ_CP034253|CRISPRCasFinder 2127067-2127108 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24899-24940 8 0.81
NZ_CP034253_5 5.6|2545679|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545679-2545710 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1417960-1417991 8 0.75
NZ_CP034253_6 6.1|2568274|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568274-2568305 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 62682-62713 8 0.75
NZ_CP034253_6 6.1|2568274|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568274-2568305 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1222106-1222137 8 0.75
NZ_CP034253_6 6.1|2568274|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568274-2568305 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2467671-2467702 8 0.75
NZ_CP034253_6 6.1|2568274|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568274-2568305 32 NC_008759 Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence 12670-12701 8 0.75
NZ_CP034253_6 6.5|2568518|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568518-2568549 32 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 17977-18008 8 0.75
NZ_CP034253_6 6.5|2568518|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568518-2568549 32 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 97497-97528 8 0.75
NZ_CP034253_6 6.8|2568701|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568701-2568732 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 148991-149022 8 0.75
NZ_CP034253_6 6.8|2568701|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568701-2568732 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 530640-530671 8 0.75
NZ_CP034253_6 6.9|2568762|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568762-2568793 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 532343-532374 8 0.75
NZ_CP034253_3 3.1|2127067|42|NZ_CP034253|CRISPRCasFinder 2127067-2127108 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24786-24827 9 0.786
NZ_CP034253_6 6.5|2568518|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568518-2568549 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 405875-405906 9 0.719
NZ_CP034253_6 6.8|2568701|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568701-2568732 32 NZ_CP036297 Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence 14953-14984 9 0.719
NZ_CP034253_6 6.8|2568701|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568701-2568732 32 NZ_CP036288 Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence 14983-15014 9 0.719
NZ_CP034253_6 6.8|2568701|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568701-2568732 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 3454-3485 9 0.719
NZ_CP034253_6 6.9|2568762|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568762-2568793 32 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35740-35771 9 0.719
NZ_CP034253_5 5.1|2545374|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2545374-2545405 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 51062-51093 10 0.688
NZ_CP034253_6 6.1|2568274|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568274-2568305 32 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 86181-86212 10 0.688
NZ_CP034253_6 6.2|2568335|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568335-2568366 32 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 244686-244717 10 0.688
NZ_CP034253_6 6.2|2568335|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568335-2568366 32 GU075905 Prochlorococcus phage P-HM2, complete genome 78536-78567 10 0.688
NZ_CP034253_6 6.5|2568518|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT 2568518-2568549 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2248362-2248393 10 0.688

1. spacer 9.1|4328242|40|NZ_CP034253|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 8.1|3673995|38|NZ_CP034253|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 1.1|467948|48|NZ_CP034253|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

4. spacer 1.1|467948|48|NZ_CP034253|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

5. spacer 1.1|467948|48|NZ_CP034253|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

6. spacer 1.1|467948|48|NZ_CP034253|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

7. spacer 3.1|2127067|42|NZ_CP034253|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.833

acagcagtcggatgcggcgtaaacaccttatctgacctacgt	CRISPR spacer
acaaatgccggatgcggcgtaaacgccttatctggcctacgc	Protospacer
***.  *.****************.*********.******.

8. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

9. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

10. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

11. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

12. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

13. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

14. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

15. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

16. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

17. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

18. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

19. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

20. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

21. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

22. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

23. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

24. spacer 5.7|2545740|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

25. spacer 3.1|2127067|42|NZ_CP034253|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 8, identity: 0.81

acagcagtcggatgcggcgtaaacaccttatctgacctacgt	CRISPR spacer
attgatgtcggatgcggcgtaaacgccttatccgacctacaa	Protospacer
*. *  ******************.*******.*******. 

26. spacer 5.6|2545679|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcaacgcgctcagacgttgcgtgagtgaacca	CRISPR spacer
acaacgcggtcggacgttgcgtgattaccccg	Protospacer
 ******* **.************ *.  **.

27. spacer 6.1|2568274|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
tccctatcgcaatgccggcagcatccgcaatc	Protospacer
*. *.  ****** **** ************.

28. spacer 6.1|2568274|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatca	Protospacer
**** ************ ***** *  ** . 

29. spacer 6.1|2568274|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatca	Protospacer
**** ************ ***** *  ** . 

30. spacer 6.1|2568274|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NC_008759 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcg-----caattccgggagcatccgcaatt	CRISPR spacer
-----cgtgaaactcatttccgggagcatccgcattt	Protospacer
     **.*     ** ***************** **

31. spacer 6.5|2568518|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
agcgtcaccgacgcgcagggccgctaccaact	Protospacer
  **************** * *******.   

32. spacer 6.5|2568518|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
gacgtcaccgacgcgcagtcgcgcttcttcaa	Protospacer
  ***************** ***** *. ..*

33. spacer 6.8|2568701|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
gggtacggctggcgaaggaggcggctgcggaa	Protospacer
  * ************* ***.*****  * *

34. spacer 6.8|2568701|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
ccgaacaggtggcgaagcaggtgatgggccag	Protospacer
******.* **************.. ***  .

35. spacer 6.9|2568762|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75

gtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
catcatcctcccgcagatgcgctggccgatcc	Protospacer
  *.*.* .******** ******** *****

36. spacer 3.1|2127067|42|NZ_CP034253|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.786

acagcagtcggatgcggcgtaaacaccttatctgacctacgt	CRISPR spacer
gttgatgtcggatgcggcgtaaacgccttatccgacctacaa	Protospacer
.. *  ******************.*******.*******. 

37. spacer 6.5|2568518|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
gacgtcactgacgcgcagtcgcgcttcttcaa	Protospacer
  ******.********** ***** *. ..*

38. spacer 6.8|2568701|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036297 (Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgtg	Protospacer
   ..*.******** ********** ****.

39. spacer 6.8|2568701|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036288 (Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgtg	Protospacer
   ..*.******** ********** ****.

40. spacer 6.8|2568701|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
ttgcgcagctggcgcagcaggtggctgccgag	Protospacer
..* .*.******* ************ ** .

41. spacer 6.9|2568762|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

gtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
cgagaccgcctcgccgaggcgctggcagcgac	Protospacer
    ******.*** *************   *

42. spacer 5.1|2545374|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 10, identity: 0.688

tccacgctgtaacggccatcattaagtttagt	CRISPR spacer
ccgctgctgtgacgcccatcattaagttactc	Protospacer
.*  .*****.*** *************   .

43. spacer 6.1|2568274|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 10, identity: 0.688

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
gctaccgcgcaattcgaggagcatccgctggg	Protospacer
 .  *********** .*********** .  

44. spacer 6.2|2568335|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

acggacaaaatatatattgatttgcgaattat	CRISPR spacer
tgaggcaaaatatagattgatttccgaaaata	Protospacer
  .*.********* ******** ****    

45. spacer 6.2|2568335|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 10, identity: 0.688

acggacaaaatatatattgatttgcgaattat	CRISPR spacer
acggaaaaattatatattgattttacttctgg	Protospacer
***** *** *************     .*. 

46. spacer 6.5|2568518|32|NZ_CP034253|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
gacatcaccgacgcccagtggcgcgacgtccc	Protospacer
  *.********** ********* **  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 844356 : 850914 7 uncultured_Caudovirales_phage(16.67%) transposase NA
DBSCAN-SWA_2 1764430 : 1802404 30 Bacillus_phage(44.44%) integrase,transposase attL 1752884:1752898|attR 1776909:1776923
DBSCAN-SWA_3 2576306 : 2589489 12 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_4 2678417 : 2689549 13 Enterobacteria_phage(45.45%) tail NA
DBSCAN-SWA_5 3212538 : 3221980 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_6 3775522 : 3788399 11 Escherichia_phage(30.0%) tail NA
DBSCAN-SWA_7 4190475 : 4201252 11 Enterobacteria_phage(40.0%) integrase attL 4188450:4188473|attR 4199955:4199978
DBSCAN-SWA_8 4471121 : 4535332 59 Salmonella_phage(38.46%) integrase,portal,protease attL 4481900:4481914|attR 4536008:4536022
DBSCAN-SWA_9 4617461 : 4642090 40 Enterobacteria_phage(48.48%) integrase,lysis,tail attL 4616807:4616821|attR 4642163:4642177
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage