Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP049202 Escherichia coli strain PapRG-04-4 plasmid pIncFIB, complete sequence 1 crisprs NA 0 1 2 0
NZ_CP049203 Escherichia coli strain PapRG-04-4 plasmid pcolRNA2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP049201 Escherichia coli strain PapRG-04-4 chromosome, complete genome 8 crisprs RT,csa3,PD-DExK,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,c2c9_V-U4,DinG 0 5 10 0

Results visualization

1. NZ_CP049202
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049202_1 28621-28702 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP049202 Escherichia coli strain PapRG-04-4 plasmid pIncFIB, complete sequence 28648-28675 0 1.0
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 12326-12353 3 0.893
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP026833 Shigella dysenteriae strain ATCC 49346 plasmid unnamed, complete sequence 142584-142611 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP045785 Shigella dysenteriae strain CFSAN029786 plasmid p1CFSAN029786, complete sequence 149504-149531 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP026841 Shigella dysenteriae strain ATCC 9753 plasmid unnamed, complete sequence 178767-178794 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP026835 Shigella dysenteriae strain ATCC 49347 plasmid unnamed, complete sequence 1803-1830 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP015140 Escherichia coli strain Ecol_732 plasmid pEC732_2, complete sequence 45954-45981 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP021177 Escherichia coli strain 5CRE51 plasmid p5CRE51-NDM-9 sequence 38380-38407 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP047668 Klebsiella aerogenes strain HNHF1 plasmid pHNHF1_NDM-9, complete sequence 168428-168455 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 28524-28551 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 28524-28551 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_KY689635 Escherichia coli strain Mbl536 plasmid pMbl536, complete sequence 56161-56188 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_KY565558 Escherichia coli strain Mbl488 plasmid pMbl488, complete sequence 56997-57024 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_017627 Escherichia coli 042 plasmid pAA, complete sequence 49782-49809 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_008460 Escherichia coli plasmid pO86A1, complete sequence 98553-98580 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP047574 Escherichia coli strain 2EC1 plasmid p2EC1-3, complete sequence 61806-61833 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 KY463220 Escherichia coli plasmid pNDM5-IBAC, complete sequence 8525-8552 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP019954 Escherichia coli M8 plasmid unnamed1, complete sequence 157015-157042 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_KM085449 Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence 34170-34197 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP009105 Escherichia coli strain RM9387 plasmid pO104_H7, complete sequence 34169-34196 4 0.857
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP010142 Escherichia coli strain D3 plasmid B, complete sequence 58817-58844 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP026812 Shigella flexneri strain 64-5500 plasmid unnamed, complete sequence 139329-139356 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_MK396099 Escherichia coli strain Ec20-Lar plasmid unnamed, complete sequence 67015-67042 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025860 Escherichia coli strain 504239 plasmid p504239_101, complete sequence 4947-4974 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_014232 Escherichia coli ETEC 1392/75 plasmid p1081, complete sequence 86890-86917 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025904 Escherichia coli strain 300709 plasmid p300709_97, complete sequence 91944-91971 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP013191 Escherichia coli strain FORC_031 plasmid pFORC31.1, complete sequence 27731-27758 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_009786 Escherichia coli O139:H28 str. E24377A plasmid pETEC_80, complete sequence 4106-4133 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP022914 Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed2, complete sequence 27437-27464 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP022914 Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed2, complete sequence 64461-64488 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP047578 Escherichia coli strain 94EC plasmid p94EC-2, complete sequence 83775-83802 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP029980 Escherichia coli strain 99-3165 plasmid unnamed2, complete sequence 116461-116488 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP029980 Escherichia coli strain 99-3165 plasmid unnamed2, complete sequence 28988-29015 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 CP025977 Escherichia coli strain 10754 a-1 plasmid p10754a1_92, complete sequence 46812-46839 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP017848 Escherichia coli strain FMU073332 plasmid pEcoFMU07332d sequence 52098-52125 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024277 Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed2, complete sequence 41694-41721 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024279 Escherichia coli strain ATCC 43896 plasmid unnamed1 18261-18288 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024238 Escherichia coli O15:H11 strain 90-9272 plasmid unnamed 42701-42728 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024237 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed5, complete sequence 135666-135693 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024237 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed5, complete sequence 73009-73036 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP034390 Escherichia coli strain RS571 plasmid pRS571-MCR-1.1, complete sequence 62753-62780 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_LR740760 Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid pbAPEC5202 9170-9197 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_LR740760 Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid pbAPEC5202 83325-83352 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024262 Escherichia coli strain F5656C1 plasmid unnamed2, complete sequence 63863-63890 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024262 Escherichia coli strain F5656C1 plasmid unnamed2, complete sequence 11965-11992 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP027106 Escherichia coli strain RM14721 plasmid pRM14721, complete sequence 86908-86935 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 CP025971 Escherichia coli strain 11573 a-1 plasmid p11573a1_92, complete sequence 78237-78264 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 CP025974 Escherichia coli strain 10802 a plasmid p10802a_92, complete sequence 86889-86916 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_017724 Escherichia coli ETEC H10407 plasmid p948, complete sequence 8441-8468 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025884 Escherichia coli strain 503440 plasmid p503440_78, complete sequence 59216-59243 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024272 Escherichia coli strain F8111-1SC3 plasmid unnamed3, complete sequence 57363-57390 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025872 Escherichia coli strain 503829 plasmid p503829_77, complete sequence 21655-21682 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025914 Escherichia coli strain 203740 plasmid p203740_80, complete sequence 77029-77056 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024274 Escherichia coli strain F9792 plasmid unnamed, complete sequence 9400-9427 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 37110-37137 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024231 Escherichia coli O25:NM strain 2014EL-1343-2 plasmid unnamed3, complete sequence 2234-2261 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024265 Escherichia coli O169:H41 strain F6326-C1 plasmid unnamed2, complete sequence 96279-96306 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 CP025899 Escherichia coli strain 500465 plasmid p500465_77, complete sequence 74372-74399 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 LN908839 Escherichia coli plasmid pCss_E1189 23551-23578 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_007635 Escherichia coli plasmid pCoo, complete sequence 41826-41853 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_MK461931 Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence 200961-200988 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_MH422552 Escherichia coli strain L-I1 plasmid pIncFIB, complete sequence 87581-87608 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025893 Escherichia coli strain 503025 plasmid p503025_105, complete sequence 19406-19433 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025893 Escherichia coli strain 503025 plasmid p503025_105, complete sequence 99499-99526 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025866 Escherichia coli strain 504211 plasmid p504211_78, complete sequence 7205-7232 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024227 Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed4, complete sequence 120940-120967 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024718 Escherichia coli strain LS4 plasmid p1LS4, complete sequence 3969-3996 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024721 Escherichia coli isolate NQ3 plasmid p1NQ3, complete sequence 92563-92590 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP013832 Escherichia coli strain CD306 plasmid pCD306, complete sequence 99757-99784 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 AP014654 Escherichia coli O169:H41 plasmid pEntYN10 DNA, complete sequence 84593-84620 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP006002 Escherichia coli B7A plasmid pEB4, complete sequence 14676-14703 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 LN908840 Escherichia coli plasmid pCss_E1373 47443-47470 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_MG904998 Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence 59858-59885 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP013194 Escherichia coli strain FORC_031 plasmid pFORC31.4, complete sequence 8444-8471 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024276 Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed1 29820-29847 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_009790 Escherichia coli O139:H28 str. E24377A plasmid pETEC_74, complete sequence 53625-53652 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 MK295823 Escherichia coli O25b:H4-ST131 strain 461 plasmid p461, complete sequence 44699-44726 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 MK295831 Escherichia coli O25b:H4-ST131 strain 396 plasmid p396, complete sequence 45153-45180 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 MK295833 Escherichia coli O25b:H4-ST131 strain 418 plasmid p418, complete sequence 44484-44511 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_MK461928 Escherichia coli strain F2_14D plasmid pF2_14D_F, complete sequence 84380-84407 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025845 Escherichia coli strain 720632 plasmid p720632_72, complete sequence 13214-13241 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP036244 Escherichia coli strain S65EC plasmid pS65EC, complete sequence 81055-81082 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP023352 Escherichia coli strain ETEC-2264 plasmid unnamed3, complete sequence 20020-20047 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 CP049613 Escherichia coli O157:H7 strain K1516 plasmid pK1516-1 30799-30826 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 LT174529 Escherichia coli plasmid E873p3, strain E873 41530-41557 5 0.821
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP026812 Shigella flexneri strain 64-5500 plasmid unnamed, complete sequence 35363-35390 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025848 Escherichia coli strain 602354 plasmid p602354_148, complete sequence 49928-49955 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 CP025968 Escherichia coli strain 2407 a plasmid p2407a_135, complete sequence 70428-70455 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_008460 Escherichia coli plasmid pO86A1, complete sequence 25063-25090 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP027385 Escherichia coli strain 2013C-3250 plasmid unnamed5, complete sequence 118154-118181 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP028121 Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence 106632-106659 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 LC520282 Escherichia coli I0082 plasmid pI0082 DNA, complete sequence 8757-8784 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP007135 Escherichia coli O145:H28 str. RM12761 plasmid pO145-12761, complete sequence 35672-35699 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP006263 Escherichia coli O145:H28 str. RM13516 plasmid pO145-13516, complete sequence 35671-35698 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP026936 Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence 172081-172108 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_KR559888 Klebsiella pneumoniae strain Kpn642 plasmid pKP-Gr642, complete sequence 154323-154350 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 33547-33574 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP024975 Escherichia coli strain CV839-15 plasmid pCV839-15-p1, complete sequence 74455-74482 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 MN848327 Escherichia coli strain T16RC plasmid pT16RC-1, complete sequence 81501-81528 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 CP053385 Escherichia coli strain SCU-107 plasmid pSCU-107-1, complete sequence 28455-28482 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_MH287085 Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence 200216-200243 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 CP054315 Escherichia coli strain SCU-483 plasmid pSCU-483-2 53771-53798 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP046718 Escherichia coli strain T16R plasmid pT16R-2, complete sequence 10879-10906 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP018969 Escherichia coli strain Ecol_542 plasmid pEC542_1, complete sequence 14650-14677 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_012944 Escherichia coli Vir68 plasmid pVir68, complete sequence 95767-95794 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_049924 Stx2-converting phage Stx2a_F451 proviral DNA, complete genome 2951-2978 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 LC487996 Stx2-converting phage Stx2a 981509 genes for Shiga toxin 2 production region, complete sequence 2927-2954 6 0.786
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025848 Escherichia coli strain 602354 plasmid p602354_148, complete sequence 34168-34195 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 CP025968 Escherichia coli strain 2407 a plasmid p2407a_135, complete sequence 49020-49047 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025921 Escherichia coli strain 103605 plasmid p103605_146, complete sequence 7396-7423 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025921 Escherichia coli strain 103605 plasmid p103605_146, complete sequence 136747-136774 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025911 Escherichia coli strain 204446 plasmid p204446_146, complete sequence 89318-89345 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025911 Escherichia coli strain 204446 plasmid p204446_146, complete sequence 106362-106389 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP023347 Escherichia coli strain ETEC-2265 plasmid unnamed1, complete sequence 54840-54867 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP023347 Escherichia coli strain ETEC-2265 plasmid unnamed1, complete sequence 70571-70598 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_022333 Escherichia coli plasmid pCss165Kan DNA, complete genome, strain: 4266 delta cssB::Km 84031-84058 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 CP025908 Escherichia coli strain 204576 plasmid p204576_146, complete sequence 17946-17973 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 CP025908 Escherichia coli strain 204576 plasmid p204576_146, complete sequence 34990-35017 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP042885 Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_01, complete sequence 44450-44477 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP042885 Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_01, complete sequence 60310-60337 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_007635 Escherichia coli plasmid pCoo, complete sequence 53675-53702 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025917 Escherichia coli strain 120899 plasmid p120899_146, complete sequence 57199-57226 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025917 Escherichia coli strain 120899 plasmid p120899_146, complete sequence 74243-74270 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025863 Escherichia coli strain 504237 plasmid p504237_142, complete sequence 54740-54767 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025863 Escherichia coli strain 504237 plasmid p504237_142, complete sequence 70471-70498 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP011019 Escherichia coli strain CI5 plasmid unnamed, complete sequence 69430-69457 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP010181 Escherichia coli strain M1 plasmid A, complete sequence 107300-107327 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP010184 Escherichia coli strain M3 plasmid A, complete sequence 106299-106326 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP010192 Escherichia coli strain M8 plasmid A, complete genome 82770-82797 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_013655 Escherichia coli SE15 plasmid pECSF1, complete sequence 49229-49256 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_018666 Escherichia coli O104:H4 str. 2011C-3493 plasmid pAA-EA11, complete sequence 60018-60045 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_018662 Escherichia coli O104:H4 str. 2009EL-2071 plasmid pAA-09EL71, complete sequence 32264-32291 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 251162-251189 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP022087 Escherichia coli O104:H4 strain FDAARGOS_348 plasmid unnamed2, complete sequence 13751-13778 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_022743 Escherichia coli plasmid pHUSEC2011-2, complete sequence 27681-27708 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP031904 Escherichia coli O104:H4 strain FWSEC0009 plasmid unnamed19, complete sequence 9859-9886 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP015246 Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence 91694-91721 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP031907 Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence 71503-71530 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 CP042949 Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence 4073-4100 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP045280 Escherichia coli strain LAU-OXA plasmid pLAU-OXA3, complete sequence 2666-2693 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 MK181559 Escherichia coli plasmid p199, complete sequence 95559-95586 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NC_018654 Escherichia coli O104:H4 str. 2009EL-2050 plasmid pAA-09EL50, complete sequence 42836-42863 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP023530 Escherichia coli strain FDAARGOS_401 plasmid unnamed, complete sequence 32780-32807 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP041001 Escherichia coli strain FDAARGOS_772 plasmid unnamed1, complete sequence 14203-14230 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP023533 Escherichia coli strain FDAARGOS_403 plasmid unnamed2, complete sequence 50653-50680 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP027392 Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence 30807-30834 7 0.75
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP045756 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid p2CFSAN000752, complete sequence 59131-59158 8 0.714
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP025239 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE2-1928, complete sequence 11438-11465 8 0.714
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP039490 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid pCFSAN000752, complete sequence 41815-41842 8 0.714
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP013027 Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence 6078-6105 8 0.714
NZ_CP049202_1 1.1|28648|28|NZ_CP049202|CRISPRCasFinder 28648-28675 28 NZ_CP013027 Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence 167264-167291 8 0.714

1. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP049202 (Escherichia coli strain PapRG-04-4 plasmid pIncFIB, complete sequence) position: , mismatch: 0, identity: 1.0

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaacgtagta	Protospacer
****************************

2. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.893

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaacataaaa	Protospacer
**********************.**. *

3. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP026833 (Shigella dysenteriae strain ATCC 49346 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaacgtgaag	Protospacer
************************.. .

4. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP045785 (Shigella dysenteriae strain CFSAN029786 plasmid p1CFSAN029786, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaacgtgaag	Protospacer
************************.. .

5. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP026841 (Shigella dysenteriae strain ATCC 9753 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaacgtgaag	Protospacer
************************.. .

6. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP026835 (Shigella dysenteriae strain ATCC 49347 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaacgtgaag	Protospacer
************************.. .

7. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP015140 (Escherichia coli strain Ecol_732 plasmid pEC732_2, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaacggcaga	Protospacer
***********************  . *

8. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP021177 (Escherichia coli strain 5CRE51 plasmid p5CRE51-NDM-9 sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaatgtatgt	Protospacer
*********************.***   

9. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP047668 (Klebsiella aerogenes strain HNHF1 plasmid pHNHF1_NDM-9, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaatgtatgt	Protospacer
*********************.***   

10. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaagaaatt	Protospacer
********************* * *.* 

11. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaagaaatt	Protospacer
********************* * *.* 

12. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_KY689635 (Escherichia coli strain Mbl536 plasmid pMbl536, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta-	CRISPR spacer
tgctccgttgacgcttacgaa-atggcat	Protospacer
********************* .*.*.* 

13. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_KY565558 (Escherichia coli strain Mbl488 plasmid pMbl488, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta-	CRISPR spacer
tgctccgttgacgcttacgaa-atggcat	Protospacer
********************* .*.*.* 

14. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_017627 (Escherichia coli 042 plasmid pAA, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaatggtgga	Protospacer
*********************.*  * *

15. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_008460 (Escherichia coli plasmid pO86A1, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta--	CRISPR spacer
tgctccgttgacgcttacaaa--taatacc	Protospacer
******************.**  **.**  

16. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP047574 (Escherichia coli strain 2EC1 plasmid p2EC1-3, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaagaaatt	Protospacer
********************* * *.* 

17. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to KY463220 (Escherichia coli plasmid pNDM5-IBAC, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatagtctta	Protospacer
********************  **  **

18. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP019954 (Escherichia coli M8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgagataagta	Protospacer
********************.   ****

19. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_KM085449 (Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta-	CRISPR spacer
tgctccgttgacgcttacg-atattgtac	Protospacer
******************* *..* *** 

20. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP009105 (Escherichia coli strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 4, identity: 0.857

tgctccgttgacgcttacgaacgtagta-	CRISPR spacer
tgctccgttgacgcttacg-atattgtac	Protospacer
******************* *..* *** 

21. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP010142 (Escherichia coli strain D3 plasmid B, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaatgtccag	Protospacer
*********************.**   .

22. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP026812 (Shigella flexneri strain 64-5500 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaacatcagg	Protospacer
**********************.* . .

23. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_MK396099 (Escherichia coli strain Ec20-Lar plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaacaatctg	Protospacer
**********************.   *.

24. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025860 (Escherichia coli strain 504239 plasmid p504239_101, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

25. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_014232 (Escherichia coli ETEC 1392/75 plasmid p1081, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

26. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025904 (Escherichia coli strain 300709 plasmid p300709_97, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

27. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP013191 (Escherichia coli strain FORC_031 plasmid pFORC31.1, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

28. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_009786 (Escherichia coli O139:H28 str. E24377A plasmid pETEC_80, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

29. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP022914 (Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

30. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP022914 (Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaagaacaa	Protospacer
******************.** * *  *

31. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP047578 (Escherichia coli strain 94EC plasmid p94EC-2, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaagaaacaa	Protospacer
********************* . *  *

32. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP029980 (Escherichia coli strain 99-3165 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

33. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP029980 (Escherichia coli strain 99-3165 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaagaacaa	Protospacer
******************.** * *  *

34. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to CP025977 (Escherichia coli strain 10754 a-1 plasmid p10754a1_92, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

35. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP017848 (Escherichia coli strain FMU073332 plasmid pEcoFMU07332d sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

36. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024277 (Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

37. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024279 (Escherichia coli strain ATCC 43896 plasmid unnamed1) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

38. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024238 (Escherichia coli O15:H11 strain 90-9272 plasmid unnamed) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

39. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024237 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

40. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024237 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaagaacaa	Protospacer
******************.** * *  *

41. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP034390 (Escherichia coli strain RS571 plasmid pRS571-MCR-1.1, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaagtcatca	Protospacer
*********************  .* .*

42. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_LR740760 (Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid pbAPEC5202) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaattaactg	Protospacer
*********************.  * *.

43. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_LR740760 (Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid pbAPEC5202) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaattaactg	Protospacer
*********************.  * *.

44. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024262 (Escherichia coli strain F5656C1 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

45. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024262 (Escherichia coli strain F5656C1 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaagaacaa	Protospacer
******************.** * *  *

46. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP027106 (Escherichia coli strain RM14721 plasmid pRM14721, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaataacgtg	Protospacer
*********************..  **.

47. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to CP025971 (Escherichia coli strain 11573 a-1 plasmid p11573a1_92, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

48. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to CP025974 (Escherichia coli strain 10802 a plasmid p10802a_92, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

49. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_017724 (Escherichia coli ETEC H10407 plasmid p948, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaatggac	Protospacer
********************* .*.*  

50. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025884 (Escherichia coli strain 503440 plasmid p503440_78, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacccacgttctg	Protospacer
******************  ****  *.

51. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024272 (Escherichia coli strain F8111-1SC3 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgagtgttttt	Protospacer
********************..**  * 

52. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025872 (Escherichia coli strain 503829 plasmid p503829_77, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacccacgttctg	Protospacer
******************  ****  *.

53. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025914 (Escherichia coli strain 203740 plasmid p203740_80, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacccacgttctg	Protospacer
******************  ****  *.

54. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024274 (Escherichia coli strain F9792 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgagtgttttt	Protospacer
********************..**  * 

55. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgagcatcttc	Protospacer
********************.*.*  * 

56. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024231 (Escherichia coli O25:NM strain 2014EL-1343-2 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacccacgttctt	Protospacer
******************  ****  * 

57. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024265 (Escherichia coli O169:H41 strain F6326-C1 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgagtgttttt	Protospacer
********************..**  * 

58. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to CP025899 (Escherichia coli strain 500465 plasmid p500465_77, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacccacgttctg	Protospacer
******************  ****  *.

59. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to LN908839 (Escherichia coli plasmid pCss_E1189) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacccacgttctg	Protospacer
******************  ****  *.

60. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_007635 (Escherichia coli plasmid pCoo, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaagaacaa	Protospacer
******************.** * *  *

61. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_MK461931 (Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgtttgtc	Protospacer
********************   * ** 

62. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_MH422552 (Escherichia coli strain L-I1 plasmid pIncFIB, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgcactaacga	Protospacer
******************* **  *  *

63. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025893 (Escherichia coli strain 503025 plasmid p503025_105, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacccacgttctg	Protospacer
******************  ****  *.

64. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025893 (Escherichia coli strain 503025 plasmid p503025_105, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacccacgttctg	Protospacer
******************  ****  *.

65. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025866 (Escherichia coli strain 504211 plasmid p504211_78, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacccacgttctg	Protospacer
******************  ****  *.

66. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024227 (Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgagtgttttt	Protospacer
********************..**  * 

67. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024718 (Escherichia coli strain LS4 plasmid p1LS4, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaccattcca	Protospacer
******************** *.*  .*

68. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024721 (Escherichia coli isolate NQ3 plasmid p1NQ3, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaccattcca	Protospacer
******************** *.*  .*

69. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP013832 (Escherichia coli strain CD306 plasmid pCD306, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacggatgttcca	Protospacer
*******************.*.**  .*

70. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to AP014654 (Escherichia coli O169:H41 plasmid pEntYN10 DNA, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgagtgttttt	Protospacer
********************..**  * 

71. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP006002 (Escherichia coli B7A plasmid pEB4, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacccacgttctg	Protospacer
******************  ****  *.

72. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to LN908840 (Escherichia coli plasmid pCss_E1373) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgagtgttttt	Protospacer
********************..**  * 

73. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_MG904998 (Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgagcatcttc	Protospacer
********************.*.*  * 

74. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP013194 (Escherichia coli strain FORC_031 plasmid pFORC31.4, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaagaacaa	Protospacer
******************.** * *  *

75. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024276 (Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed1) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaagaacaa	Protospacer
******************.** * *  *

76. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_009790 (Escherichia coli O139:H28 str. E24377A plasmid pETEC_74, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaagaacaa	Protospacer
******************.** * *  *

77. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to MK295823 (Escherichia coli O25b:H4-ST131 strain 461 plasmid p461, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaaaaagtc	Protospacer
******************.** . *** 

78. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to MK295831 (Escherichia coli O25b:H4-ST131 strain 396 plasmid p396, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaaaaagtc	Protospacer
******************.** . *** 

79. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to MK295833 (Escherichia coli O25b:H4-ST131 strain 418 plasmid p418, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaaaaagtc	Protospacer
******************.** . *** 

80. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_MK461928 (Escherichia coli strain F2_14D plasmid pF2_14D_F, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaagatgca	Protospacer
******************.** *  *.*

81. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025845 (Escherichia coli strain 720632 plasmid p720632_72, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttac-gaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaacatcat-	Protospacer
****************** .***.* .* 

82. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP036244 (Escherichia coli strain S65EC plasmid pS65EC, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttactaagattgca	Protospacer
****************** ** .* *.*

83. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP023352 (Escherichia coli strain ETEC-2264 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaa-cgtagta	CRISPR spacer
tgctccgttgacgcttacaaattatagc-	Protospacer
******************.** ..***. 

84. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to CP049613 (Escherichia coli O157:H7 strain K1516 plasmid pK1516-1) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaa-cgtagta	CRISPR spacer
tgctccgttgacgcttacaaattatagc-	Protospacer
******************.** ..***. 

85. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to LT174529 (Escherichia coli plasmid E873p3, strain E873) position: , mismatch: 5, identity: 0.821

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaagaacaa	Protospacer
******************.** * *  *

86. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP026812 (Shigella flexneri strain 64-5500 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttactaatattgct	Protospacer
****************** **..* *. 

87. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025848 (Escherichia coli strain 602354 plasmid p602354_148, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaaagctt	Protospacer
********************* . . * 

88. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to CP025968 (Escherichia coli strain 2407 a plasmid p2407a_135, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaaaaagctt	Protospacer
********************* . . * 

89. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_008460 (Escherichia coli plasmid pO86A1, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgaatgcctgt	Protospacer
*********************.*.    

90. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP027385 (Escherichia coli strain 2013C-3250 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacggccgtttcc	Protospacer
*******************. ***  . 

91. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP028121 (Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgactgtt	Protospacer
********************  .. ** 

92. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to LC520282 (Escherichia coli I0082 plasmid pI0082 DNA, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaactgcatg	Protospacer
****************** ***   .*.

93. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP007135 (Escherichia coli O145:H28 str. RM12761 plasmid pO145-12761, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgacggttcag	Protospacer
********************  **   .

94. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP006263 (Escherichia coli O145:H28 str. RM13516 plasmid pO145-13516, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgacggttcag	Protospacer
********************  **   .

95. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP026936 (Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatttacgtc	Protospacer
******************** .   ** 

96. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_KR559888 (Klebsiella pneumoniae strain Kpn642 plasmid pKP-Gr642, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaatattctt	Protospacer
****************** **..*  * 

97. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaaaaactt	Protospacer
******************.** . * * 

98. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP024975 (Escherichia coli strain CV839-15 plasmid pCV839-15-p1, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaaggcctg	Protospacer
******************.** *   *.

99. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to MN848327 (Escherichia coli strain T16RC plasmid pT16RC-1, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacacacgatttt	Protospacer
******************. ***   * 

100. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to CP053385 (Escherichia coli strain SCU-107 plasmid pSCU-107-1, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaatggacgc	Protospacer
******************.**.* *   

101. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_MH287085 (Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttactaccgatggg	Protospacer
****************** * **  * .

102. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to CP054315 (Escherichia coli strain SCU-483 plasmid pSCU-483-2) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaatggacgc	Protospacer
******************.**.* *   

103. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP046718 (Escherichia coli strain T16R plasmid pT16R-2, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacacacgatttt	Protospacer
******************. ***   * 

104. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP018969 (Escherichia coli strain Ecol_542 plasmid pEC542_1, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta-	CRISPR spacer
tgctccgttgacgcttactaa-atgacag	Protospacer
****************** ** .*...* 

105. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_012944 (Escherichia coli Vir68 plasmid pVir68, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaac-gtagta	CRISPR spacer
cgctccgttgacgcttaccaactatgat-	Protospacer
.***************** *** .*..* 

106. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_049924 (Stx2-converting phage Stx2a_F451 proviral DNA, complete genome) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaagggaacg	Protospacer
****************** ** * *...

107. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to LC487996 (Stx2-converting phage Stx2a 981509 genes for Shiga toxin 2 production region, complete sequence) position: , mismatch: 6, identity: 0.786

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaagggaacg	Protospacer
****************** ** * *...

108. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025848 (Escherichia coli strain 602354 plasmid p602354_148, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgatctgg	Protospacer
********************  .*   .

109. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to CP025968 (Escherichia coli strain 2407 a plasmid p2407a_135, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgatctgg	Protospacer
********************  .*   .

110. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025921 (Escherichia coli strain 103605 plasmid p103605_146, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgatctgg	Protospacer
********************  .*   .

111. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025921 (Escherichia coli strain 103605 plasmid p103605_146, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgatctgg	Protospacer
********************  .*   .

112. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025911 (Escherichia coli strain 204446 plasmid p204446_146, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgatctgg	Protospacer
********************  .*   .

113. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025911 (Escherichia coli strain 204446 plasmid p204446_146, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgatctgg	Protospacer
********************  .*   .

114. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP023347 (Escherichia coli strain ETEC-2265 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgatctgg	Protospacer
********************  .*   .

115. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP023347 (Escherichia coli strain ETEC-2265 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgatctgg	Protospacer
********************  .*   .

116. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_022333 (Escherichia coli plasmid pCss165Kan DNA, complete genome, strain: 4266 delta cssB::Km) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgatctgg	Protospacer
********************  .*   .

117. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to CP025908 (Escherichia coli strain 204576 plasmid p204576_146, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgatctgg	Protospacer
********************  .*   .

118. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to CP025908 (Escherichia coli strain 204576 plasmid p204576_146, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgatctgg	Protospacer
********************  .*   .

119. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP042885 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_01, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgattatttat	Protospacer
******************** ..*    

120. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP042885 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_01, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacttacgatcgg	Protospacer
******************  ***    .

121. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_007635 (Escherichia coli plasmid pCoo, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgagacagctt	Protospacer
********************.   . * 

122. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025917 (Escherichia coli strain 120899 plasmid p120899_146, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgatctgg	Protospacer
********************  .*   .

123. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025917 (Escherichia coli strain 120899 plasmid p120899_146, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgatctgg	Protospacer
********************  .*   .

124. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025863 (Escherichia coli strain 504237 plasmid p504237_142, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgatctgg	Protospacer
********************  .*   .

125. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025863 (Escherichia coli strain 504237 plasmid p504237_142, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatgatctgg	Protospacer
********************  .*   .

126. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP011019 (Escherichia coli strain CI5 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatttcatgc	Protospacer
******************** . .*   

127. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP010181 (Escherichia coli strain M1 plasmid A, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatttcatgc	Protospacer
******************** . .*   

128. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP010184 (Escherichia coli strain M3 plasmid A, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatttcatgc	Protospacer
******************** . .*   

129. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP010192 (Escherichia coli strain M8 plasmid A, complete genome) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacgatttcatgc	Protospacer
******************** . .*   

130. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_013655 (Escherichia coli SE15 plasmid pECSF1, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaatcaacgg	Protospacer
******************.**.  *  .

131. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_018666 (Escherichia coli O104:H4 str. 2011C-3493 plasmid pAA-EA11, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaaaaaaccg	Protospacer
****************** ** . * ..

132. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_018662 (Escherichia coli O104:H4 str. 2009EL-2071 plasmid pAA-09EL71, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaaaaaaccg	Protospacer
****************** ** . * ..

133. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaataatctg	Protospacer
******************.**..   *.

134. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP022087 (Escherichia coli O104:H4 strain FDAARGOS_348 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaaaaaaccg	Protospacer
****************** ** . * ..

135. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_022743 (Escherichia coli plasmid pHUSEC2011-2, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaaaaaaccg	Protospacer
****************** ** . * ..

136. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP031904 (Escherichia coli O104:H4 strain FWSEC0009 plasmid unnamed19, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaaaaaaccg	Protospacer
****************** ** . * ..

137. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP015246 (Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaaaatgcc	Protospacer
******************.** .  *. 

138. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP031907 (Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaaaatgcc	Protospacer
******************.** .  *. 

139. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to CP042949 (Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaaaatgcc	Protospacer
******************.** .  *. 

140. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP045280 (Escherichia coli strain LAU-OXA plasmid pLAU-OXA3, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaaaaatttg	Protospacer
****************** ** .   *.

141. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to MK181559 (Escherichia coli plasmid p199, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaccgggtct	Protospacer
****************** * ** . . 

142. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NC_018654 (Escherichia coli O104:H4 str. 2009EL-2050 plasmid pAA-09EL50, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaaaaaaccg	Protospacer
****************** ** . * ..

143. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP023530 (Escherichia coli strain FDAARGOS_401 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaaaaaaccg	Protospacer
****************** ** . * ..

144. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP041001 (Escherichia coli strain FDAARGOS_772 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaaaaaaccg	Protospacer
****************** ** . * ..

145. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP023533 (Escherichia coli strain FDAARGOS_403 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaaaaaaccg	Protospacer
****************** ** . * ..

146. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP027392 (Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttaccaaaaaaccg	Protospacer
****************** ** . * ..

147. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP045756 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid p2CFSAN000752, complete sequence) position: , mismatch: 8, identity: 0.714

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttactaaaaatcct	Protospacer
****************** ** .   . 

148. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP025239 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE2-1928, complete sequence) position: , mismatch: 8, identity: 0.714

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttactaaaaatcct	Protospacer
****************** ** .   . 

149. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP039490 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid pCFSAN000752, complete sequence) position: , mismatch: 8, identity: 0.714

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttactaaaaatcct	Protospacer
****************** ** .   . 

150. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP013027 (Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.714

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaaagccgg	Protospacer
******************.** .    .

151. spacer 1.1|28648|28|NZ_CP049202|CRISPRCasFinder matches to NZ_CP013027 (Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.714

tgctccgttgacgcttacgaacgtagta	CRISPR spacer
tgctccgttgacgcttacaaaaagccgg	Protospacer
******************.** .    .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1256 : 76575 63 Enterobacteria_phage(30.0%) transposase,integrase NA
DBSCAN-SWA_2 153002 : 160805 11 Cronobacter_phage(25.0%) integrase attL 151072:151084|attR 161042:161054
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP049201
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049201_1 1140305-1140577 Unclear I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049201_2 1166267-1166478 TypeI-E I-E
3 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049201_3 1233108-1233250 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049201_4 1735822-1735927 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049201_5 2364024-2364147 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049201_6 3228054-3228145 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049201_7 4198029-4198178 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049201_8 5368836-5368984 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP049201_6 6.1|3228080|40|NZ_CP049201|CRISPRCasFinder 3228080-3228119 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP049201_5 5.1|2364067|38|NZ_CP049201|CRISPRCasFinder 2364067-2364104 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP049201_2 2.3|1166418|32|NZ_CP049201|CRT 1166418-1166449 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
NZ_CP049201_2 2.3|1166418|32|NZ_CP049201|CRT 1166418-1166449 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
NZ_CP049201_1 1.3|1140456|32|NZ_CP049201|PILER-CR,CRT 1140456-1140487 32 NZ_CP014853 Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence 46209-46240 8 0.75
NZ_CP049201_2 2.3|1166418|32|NZ_CP049201|CRT 1166418-1166449 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 MT230402 Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence 262-315 8 0.852
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12103-12156 8 0.852
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 41406-41459 8 0.852
NZ_CP049201_2 2.3|1166418|32|NZ_CP049201|CRT 1166418-1166449 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229441-229494 10 0.815
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239935-239988 10 0.815
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7383-7436 10 0.815
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84207-84260 10 0.815
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87127-87180 10 0.815
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230847-230900 10 0.815
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211817-211870 10 0.815
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4105-4158 11 0.796
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3363-3416 11 0.796
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4104-4157 11 0.796
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3362-3415 11 0.796
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4104-4157 11 0.796
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3362-3415 11 0.796
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4104-4157 11 0.796
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3362-3415 11 0.796
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31242-31295 11 0.796
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 34-87 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4004-4057 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229239-229292 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229340-229393 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 33-86 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4003-4056 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239733-239786 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239834-239887 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 33-86 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4003-4056 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230645-230698 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230746-230799 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 33-86 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4003-4056 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211615-211668 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211716-211769 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15008-15061 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18340-18393 12 0.778
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30167-30220 13 0.759
NZ_CP049201_4 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder 1735848-1735901 54 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 160-213 14 0.741

1. spacer 6.1|3228080|40|NZ_CP049201|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 5.1|2364067|38|NZ_CP049201|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 2.3|1166418|32|NZ_CP049201|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

ggcgcactggatgcgatgatggatatcactta	CRISPR spacer
gacgcactggatgcgatgatggacatcacttg	Protospacer
*.*********************.*******.

4. spacer 2.3|1166418|32|NZ_CP049201|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcgcactggatgcgatgatggat-atcactta	CRISPR spacer
ggcgcactggctgcgatgaaggacgatcaacc-	Protospacer
********** ******** ***. **** .. 

5. spacer 1.3|1140456|32|NZ_CP049201|PILER-CR,CRT matches to NZ_CP014853 (Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence) position: , mismatch: 8, identity: 0.75

cctactctcctattgcagcaattgctgcgtca	CRISPR spacer
gcggcgctgctattgcagctattgctgcgtat	Protospacer
 * .* ** ********** **********  

6. spacer 2.3|1166418|32|NZ_CP049201|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcactggatgcgatgatggata---tcactta	CRISPR spacer
ggcgcactggaagcggtgatggaggggcgcac---	Protospacer
*********** ***.******* .    ***   

7. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to MT230402 (Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence) position: , mismatch: 8, identity: 0.852

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catccggcaatcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaaa	Protospacer
**. * *** .* .***************** **********************

8. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 8, identity: 0.852

cacgccg-catcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-gctccgacgttcggtgcctgatgcgacgctggcgcgtcttatcaggcctacgag	Protospacer
 .* *** *.*.* **************************************.*.

9. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 8, identity: 0.852

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-aggcaccgtgctgatgtctgatgcgacgctggcgcgtcttatcagacctacaaa	Protospacer
 * **  *.* *** **.****************************.********

10. spacer 2.3|1166418|32|NZ_CP049201|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

ggcgcactggatgcgatgatggatatcactta	CRISPR spacer
ggcgcactggaaccgatgatggatgcgatgag	Protospacer
***********  ***********.. *.  .

11. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

12. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

13. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 10, identity: 0.815

cacgcc-gcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-gcgctggtgccggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
 .***. *...*  .****************************** *********

14. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 10, identity: 0.815

cacgcc-gcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-gcgctggtgccggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
 .***. *...*  .****************************** *********

15. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cattcggtgcacgatgcctgatgcgacgctgccgcgtcttatcaggcctacaaa	Protospacer
**. * *... * .***************** **********************

16. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

17. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.815

cacgccgcatcctg-tgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
-cagtcgtgtgcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
   *.**..* * * ****************..**********************

18. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

19. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

20. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

21. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

22. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

23. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

24. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttatgcgcag------atgcctgatgcgacgctggcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************************** *********

25. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.796

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagttgtacgcag------gtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
      .**** *      ******************************* ******.*.

26. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 11, identity: 0.796

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catccggtaatcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacagc	Protospacer
**. * *.* .* .***************** ********************. 

27. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

28. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

29. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

30. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

31. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

32. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

33. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

34. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

35. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

36. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

37. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

38. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

39. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

40. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
taattgtgcgcag------atgcctgatgcgacgctagcgcgtcttatcatgcctacaaa	Protospacer
      ..*** *      .****************.************* *********

41. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

42. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
cagtcgtgcgcag------atgcctgatgcgacgctaacgcgtcttatcaggcctacaaa	Protospacer
      ..*** *      .****************..**********************

43. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 12, identity: 0.778

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
caacaattaccaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgag	Protospacer
**     .*.*  ******************************* ******.*.

44. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 12, identity: 0.778

------cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgcgctg------atgcctgatgcgacgctgacgcgtcttatcatgcctacaaa	Protospacer
      ..***.*      .*****************.************ *********

45. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 13, identity: 0.759

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
catttgtgctctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaat	Protospacer
**. .    **. .*****************.************ ******** 

46. spacer 4.1|1735848|54|NZ_CP049201|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 14, identity: 0.741

cacgccgcatcctgtgcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
tctccggcaattgaagcctgatgcgacgctgacgcgtcttatcaggcctacnag	Protospacer
. . * *** .. . ****************.******************* *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 808241 : 868844 52 Stx2-converting_phage(27.27%) plate,transposase NA
DBSCAN-SWA_2 1603261 : 1649033 56 Enterobacteria_phage(84.09%) head,portal,integrase,capsid,plate,tRNA,holin,tail,terminase attL 1609194:1609213|attR 1646009:1646028
DBSCAN-SWA_3 1856028 : 1865473 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_4 2077586 : 2111205 35 Enterobacteria_phage(69.23%) tail,transposase NA
DBSCAN-SWA_5 2438986 : 2501309 69 Enterobacteria_phage(41.3%) portal,lysis,integrase,protease,tail,terminase attL 2438465:2438480|attR 2472085:2472100
DBSCAN-SWA_6 2701884 : 2754026 70 Escherichia_phage(78.12%) integrase,plate,tRNA,holin,tail,terminase attL 2699532:2699546|attR 2748676:2748690
DBSCAN-SWA_7 2828913 : 2896103 91 Enterobacteria_phage(27.78%) head,portal,integrase,holin,capsid,plate,protease,tail,terminase attL 2859147:2859163|attR 2878703:2878719
DBSCAN-SWA_8 4612798 : 4700726 100 Shigella_phage(46.88%) head,transposase,portal,lysis,integrase,capsid,protease,plate,holin,tail,terminase attL 4699725:4699741|attR 4702005:4702021
DBSCAN-SWA_9 4979612 : 5035261 60 Shigella_phage(37.5%) transposase,integrase,tRNA,protease,tail attL 5014196:5014242|attR 5035685:5035731
DBSCAN-SWA_10 5365995 : 5406087 33 Moraxella_phage(20.0%) protease,integrase,transposase attL 5352998:5353011|attR 5377375:5377388
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage