Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP049102 Escherichia coli strain EC28 plasmid p2, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP049101 Escherichia coli strain EC28 chromosome, complete genome 4 crisprs WYL,RT,csa3,cas3,DEDDh,PD-DExK,c2c9_V-U4,DinG 0 4 10 0
NZ_CP049105 Escherichia coli strain EC28 plasmid p5, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP049106 Escherichia coli strain EC28 plasmid p6, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP049104 Escherichia coli strain EC28 plasmid p4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP049103 Escherichia coli strain EC28 plasmid pCTX-M-15, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP049101
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049101_1 2419474-2419597 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049101_2 3073888-3073979 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049101_3 3195617-3195699 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP049101_4 4085346-4085478 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP049101_2 2.1|3073914|40|NZ_CP049101|CRISPRCasFinder 3073914-3073953 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
NZ_CP049101_4 4.1|4085363|42|NZ_CP049101|PILER-CR 4085363-4085404 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 1 0.976
NZ_CP049101_4 4.2|4085422|40|NZ_CP049101|PILER-CR 4085422-4085461 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 1 0.975
NZ_CP049101_1 1.1|2419517|38|NZ_CP049101|CRISPRCasFinder 2419517-2419554 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP049101_4 4.2|4085422|40|NZ_CP049101|PILER-CR 4085422-4085461 40 NZ_CP034685 Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence 143235-143274 11 0.725

1. spacer 2.1|3073914|40|NZ_CP049101|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975

gcgctgcgggtcatttttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
***************.************************

2. spacer 4.1|4085363|42|NZ_CP049101|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.976

tgtcacacgcagataaatccaactttcaatattgttaagctc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
***************************************.**

3. spacer 4.2|4085422|40|NZ_CP049101|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.975

catggcgtagaaaaaagaaattttcaatattgttttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********************************.*******

4. spacer 1.1|2419517|38|NZ_CP049101|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

5. spacer 4.2|4085422|40|NZ_CP049101|PILER-CR matches to NZ_CP034685 (Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence) position: , mismatch: 11, identity: 0.725

catggcgtagaaaaaagaaattttcaatattgttttatgg-	CRISPR spacer
aacacaatagaaaaaagaaattttcaaccttg-tttatact	Protospacer
 *..  .********************. *** *****.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 76643 : 95484 23 Morganella_phage(30.77%) integrase attL 80805:80821|attR 100951:100967
DBSCAN-SWA_2 1171624 : 1180374 7 Escherichia_phage(71.43%) NA NA
DBSCAN-SWA_3 1520197 : 1574874 65 Enterobacteria_phage(54.69%) lysis,terminase,capsid,integrase,portal,holin,tail,head attL 1532026:1532047|attR 1573785:1573806
DBSCAN-SWA_4 1812886 : 1822329 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_5 2140210 : 2225622 98 Escherichia_phage(28.21%) tRNA,terminase,capsid,integrase,plate,holin,tail attL 2137757:2137772|attR 2210308:2210323
DBSCAN-SWA_6 2644490 : 2690314 53 Enterobacteria_phage(55.26%) lysis,capsid,terminase,integrase,tail,head attL 2642414:2642429|attR 2688342:2688357
DBSCAN-SWA_7 2697041 : 2715338 21 Escherichia_phage(64.71%) tRNA,integrase attL 2698378:2698391|attR 2712761:2712774
DBSCAN-SWA_8 2908238 : 2953137 72 Enterobacteria_phage(36.51%) protease,tRNA,lysis,capsid,terminase,integrase,portal,plate,tail,head attL 2906357:2906372|attR 2960488:2960503
DBSCAN-SWA_9 3520295 : 3572669 68 Enterobacteria_phage(41.82%) protease,tRNA,lysis,capsid,terminase,integrase,portal,holin,tail,head attL 3548931:3548946|attR 3577465:3577480
DBSCAN-SWA_10 4133228 : 4212261 92 Enterobacteria_phage(36.67%) tRNA,capsid,terminase,integrase,portal,holin,tail,head attL 4154084:4154099|attR 4219556:4219571
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP049102
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1262 : 80455 52 Enterobacteria_phage(22.73%) transposase,integrase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage