Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048879 Oceanospirillales bacterium S2-4-1H plasmid pA, complete sequence 0 crisprs NA 0 0 6 0
NZ_CP048880 Oceanospirillales bacterium S2-4-1H plasmid pB, complete sequence 1 crisprs NA 0 2 2 0
NZ_CP048881 Oceanospirillales bacterium S2-4-1H plasmid pC, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP048878 Oceanospirillales bacterium S2-4-1H chromosome, complete genome 2 crisprs Cas9_archaeal,RT,cas3,csa3,PD-DExK,DEDDh,DinG,WYL,TnsE_C 3 3 23 0

Results visualization

1. NZ_CP048879
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 24597 17 Macacine_betaherpesvirus(20.0%) NA NA
DBSCAN-SWA_2 30957 : 47733 25 Acinetobacter_phage(12.5%) protease,transposase,terminase NA
DBSCAN-SWA_3 52502 : 53486 1 Listeria_phage(100.0%) NA NA
DBSCAN-SWA_4 77847 : 84601 7 Ralstonia_phage(33.33%) NA NA
DBSCAN-SWA_5 89535 : 91906 4 Lactococcus_phage(33.33%) transposase NA
DBSCAN-SWA_6 95161 : 140450 47 Escherichia_phage(61.9%) tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP048880
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048880_1 77654-77766 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048880_1 1.1|77675|26|NZ_CP048880|PILER-CR 77675-77700 26 NZ_CP048880 Oceanospirillales bacterium S2-4-1H plasmid pB, complete sequence 77675-77700 0 1.0
NZ_CP048880_1 1.2|77722|24|NZ_CP048880|PILER-CR 77722-77745 24 NZ_CP048880 Oceanospirillales bacterium S2-4-1H plasmid pB, complete sequence 77722-77745 0 1.0
NZ_CP048880_1 1.1|77675|26|NZ_CP048880|PILER-CR 77675-77700 26 NZ_CP018746 Borreliella garinii strain CIP 103362 isolate 20047 plasmid unnamed1 25737-25762 6 0.769
NZ_CP048880_1 1.1|77675|26|NZ_CP048880|PILER-CR 77675-77700 26 NC_017239 Borreliella afzelii PKo plasmid lp28-2, complete sequence 21696-21721 6 0.769
NZ_CP048880_1 1.1|77675|26|NZ_CP048880|PILER-CR 77675-77700 26 NZ_CP009063 Borreliella afzelii K78 plasmid lp28-2, complete sequence 4928-4953 6 0.769
NZ_CP048880_1 1.1|77675|26|NZ_CP048880|PILER-CR 77675-77700 26 NZ_CP028865 Borreliella garinii strain 20047 plasmid lp36, complete sequence 11266-11291 6 0.769

1. spacer 1.1|77675|26|NZ_CP048880|PILER-CR matches to NZ_CP048880 (Oceanospirillales bacterium S2-4-1H plasmid pB, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtctaatattaaaaaacacacgtc	CRISPR spacer
ctgtctaatattaaaaaacacacgtc	Protospacer
**************************

2. spacer 1.2|77722|24|NZ_CP048880|PILER-CR matches to NZ_CP048880 (Oceanospirillales bacterium S2-4-1H plasmid pB, complete sequence) position: , mismatch: 0, identity: 1.0

tagcaaatacacttagtgtgacac	CRISPR spacer
tagcaaatacacttagtgtgacac	Protospacer
************************

3. spacer 1.1|77675|26|NZ_CP048880|PILER-CR matches to NZ_CP018746 (Borreliella garinii strain CIP 103362 isolate 20047 plasmid unnamed1) position: , mismatch: 6, identity: 0.769

ctgtctaatattaaaaaacacacgtc	CRISPR spacer
atttctaatattaaaaaacacaatgt	Protospacer
 * *******************   .

4. spacer 1.1|77675|26|NZ_CP048880|PILER-CR matches to NC_017239 (Borreliella afzelii PKo plasmid lp28-2, complete sequence) position: , mismatch: 6, identity: 0.769

ctgtctaatattaaaaaacacacgtc	CRISPR spacer
atttctaatattaaaaaacacaatgt	Protospacer
 * *******************   .

5. spacer 1.1|77675|26|NZ_CP048880|PILER-CR matches to NZ_CP009063 (Borreliella afzelii K78 plasmid lp28-2, complete sequence) position: , mismatch: 6, identity: 0.769

ctgtctaatattaaaaaacacacgtc	CRISPR spacer
atttctaatattaaaaaacacaatgt	Protospacer
 * *******************   .

6. spacer 1.1|77675|26|NZ_CP048880|PILER-CR matches to NZ_CP028865 (Borreliella garinii strain 20047 plasmid lp36, complete sequence) position: , mismatch: 6, identity: 0.769

ctgtctaatattaaaaaacacacgtc	CRISPR spacer
atttctaatattaaaaaacacaatgt	Protospacer
 * *******************   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 35956 : 46952 15 uncultured_Caudovirales_phage(20.0%) NA NA
DBSCAN-SWA_2 53816 : 100604 57 Pseudomonas_phage(29.03%) capsid,coat,transposase,terminase,integrase attL 93362:93377|attR 100374:100389
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP048881
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10905 : 53838 58 Aeromonas_phage(26.32%) capsid,portal,transposase,plate,terminase,tail,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP048878
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048878_1 3442877-3443020 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048878_2 4635957-4636166 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP048878_2 2.1|4635975|30|NZ_CP048878|CRT 4635975-4636004 30 NZ_CP048878.1 3233650-3233679 0 1.0
NZ_CP048878_2 2.1|4635975|30|NZ_CP048878|CRT 4635975-4636004 30 NZ_CP048878.1 3233722-3233751 0 1.0
NZ_CP048878_2 2.1|4635975|30|NZ_CP048878|CRT 4635975-4636004 30 NZ_CP048878.1 3233770-3233799 0 1.0
NZ_CP048878_2 2.1|4635975|30|NZ_CP048878|CRT 4635975-4636004 30 NZ_CP048878.1 3233794-3233823 0 1.0
NZ_CP048878_2 2.1|4635975|30|NZ_CP048878|CRT 4635975-4636004 30 NZ_CP048878.1 3233818-3233847 0 1.0
NZ_CP048878_2 2.2|4636023|30|NZ_CP048878|CRT 4636023-4636052 30 NZ_CP048878.1 3233650-3233679 0 1.0
NZ_CP048878_2 2.2|4636023|30|NZ_CP048878|CRT 4636023-4636052 30 NZ_CP048878.1 3233722-3233751 0 1.0
NZ_CP048878_2 2.2|4636023|30|NZ_CP048878|CRT 4636023-4636052 30 NZ_CP048878.1 3233770-3233799 0 1.0
NZ_CP048878_2 2.2|4636023|30|NZ_CP048878|CRT 4636023-4636052 30 NZ_CP048878.1 3233794-3233823 0 1.0
NZ_CP048878_2 2.2|4636023|30|NZ_CP048878|CRT 4636023-4636052 30 NZ_CP048878.1 3233818-3233847 0 1.0
NZ_CP048878_2 2.3|4636071|18|NZ_CP048878|CRT 4636071-4636088 18 NZ_CP048878.1 3233638-3233655 0 1.0
NZ_CP048878_2 2.3|4636071|18|NZ_CP048878|CRT 4636071-4636088 18 NZ_CP048878.1 3233710-3233727 0 1.0
NZ_CP048878_2 2.1|4635975|30|NZ_CP048878|CRT 4635975-4636004 30 NZ_CP048878.1 3233602-3233631 1 0.967
NZ_CP048878_2 2.1|4635975|30|NZ_CP048878|CRT 4635975-4636004 30 NZ_CP048878.1 3233674-3233703 1 0.967
NZ_CP048878_2 2.1|4635975|30|NZ_CP048878|CRT 4635975-4636004 30 NZ_CP048878.1 3233746-3233775 1 0.967
NZ_CP048878_2 2.1|4635975|30|NZ_CP048878|CRT 4635975-4636004 30 NZ_CP048878.1 4635951-4635980 1 0.967
NZ_CP048878_2 2.2|4636023|30|NZ_CP048878|CRT 4636023-4636052 30 NZ_CP048878.1 3233602-3233631 1 0.967
NZ_CP048878_2 2.2|4636023|30|NZ_CP048878|CRT 4636023-4636052 30 NZ_CP048878.1 3233674-3233703 1 0.967
NZ_CP048878_2 2.2|4636023|30|NZ_CP048878|CRT 4636023-4636052 30 NZ_CP048878.1 3233746-3233775 1 0.967
NZ_CP048878_2 2.2|4636023|30|NZ_CP048878|CRT 4636023-4636052 30 NZ_CP048878.1 4635951-4635980 1 0.967
NZ_CP048878_2 2.3|4636071|18|NZ_CP048878|CRT 4636071-4636088 18 NZ_CP048878.1 3233614-3233631 1 0.944
NZ_CP048878_2 2.3|4636071|18|NZ_CP048878|CRT 4636071-4636088 18 NZ_CP048878.1 3233662-3233679 1 0.944
NZ_CP048878_2 2.3|4636071|18|NZ_CP048878|CRT 4636071-4636088 18 NZ_CP048878.1 3233686-3233703 1 0.944
NZ_CP048878_2 2.3|4636071|18|NZ_CP048878|CRT 4636071-4636088 18 NZ_CP048878.1 3233734-3233751 1 0.944
NZ_CP048878_2 2.3|4636071|18|NZ_CP048878|CRT 4636071-4636088 18 NZ_CP048878.1 3233758-3233775 1 0.944
NZ_CP048878_2 2.3|4636071|18|NZ_CP048878|CRT 4636071-4636088 18 NZ_CP048878.1 3233782-3233799 1 0.944
NZ_CP048878_2 2.3|4636071|18|NZ_CP048878|CRT 4636071-4636088 18 NZ_CP048878.1 3233806-3233823 1 0.944
NZ_CP048878_2 2.3|4636071|18|NZ_CP048878|CRT 4636071-4636088 18 NZ_CP048878.1 3233830-3233847 1 0.944
NZ_CP048878_2 2.1|4635975|30|NZ_CP048878|CRT 4635975-4636004 30 NZ_CP048878.1 3233626-3233655 2 0.933
NZ_CP048878_2 2.1|4635975|30|NZ_CP048878|CRT 4635975-4636004 30 NZ_CP048878.1 3233698-3233727 2 0.933
NZ_CP048878_2 2.2|4636023|30|NZ_CP048878|CRT 4636023-4636052 30 NZ_CP048878.1 3233626-3233655 2 0.933
NZ_CP048878_2 2.2|4636023|30|NZ_CP048878|CRT 4636023-4636052 30 NZ_CP048878.1 3233698-3233727 2 0.933

1. spacer 2.1|4635975|30|NZ_CP048878|CRT matches to position: 3233650-3233679, mismatch: 0, identity: 1.0

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttaggatcgggttt	Protospacer
******************************

2. spacer 2.1|4635975|30|NZ_CP048878|CRT matches to position: 3233722-3233751, mismatch: 0, identity: 1.0

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttaggatcgggttt	Protospacer
******************************

3. spacer 2.1|4635975|30|NZ_CP048878|CRT matches to position: 3233770-3233799, mismatch: 0, identity: 1.0

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttaggatcgggttt	Protospacer
******************************

4. spacer 2.1|4635975|30|NZ_CP048878|CRT matches to position: 3233794-3233823, mismatch: 0, identity: 1.0

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttaggatcgggttt	Protospacer
******************************

5. spacer 2.1|4635975|30|NZ_CP048878|CRT matches to position: 3233818-3233847, mismatch: 0, identity: 1.0

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttaggatcgggttt	Protospacer
******************************

6. spacer 2.2|4636023|30|NZ_CP048878|CRT matches to position: 3233650-3233679, mismatch: 0, identity: 1.0

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttaggatcgggttt	Protospacer
******************************

7. spacer 2.2|4636023|30|NZ_CP048878|CRT matches to position: 3233722-3233751, mismatch: 0, identity: 1.0

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttaggatcgggttt	Protospacer
******************************

8. spacer 2.2|4636023|30|NZ_CP048878|CRT matches to position: 3233770-3233799, mismatch: 0, identity: 1.0

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttaggatcgggttt	Protospacer
******************************

9. spacer 2.2|4636023|30|NZ_CP048878|CRT matches to position: 3233794-3233823, mismatch: 0, identity: 1.0

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttaggatcgggttt	Protospacer
******************************

10. spacer 2.2|4636023|30|NZ_CP048878|CRT matches to position: 3233818-3233847, mismatch: 0, identity: 1.0

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttaggatcgggttt	Protospacer
******************************

11. spacer 2.3|4636071|18|NZ_CP048878|CRT matches to position: 3233638-3233655, mismatch: 0, identity: 1.0

gggttttgggtccggctt	CRISPR spacer
gggttttgggtccggctt	Protospacer
******************

12. spacer 2.3|4636071|18|NZ_CP048878|CRT matches to position: 3233710-3233727, mismatch: 0, identity: 1.0

gggttttgggtccggctt	CRISPR spacer
gggttttgggtccggctt	Protospacer
******************

13. spacer 2.1|4635975|30|NZ_CP048878|CRT matches to position: 3233602-3233631, mismatch: 1, identity: 0.967

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttgggatcgggttt	Protospacer
******************.***********

14. spacer 2.1|4635975|30|NZ_CP048878|CRT matches to position: 3233674-3233703, mismatch: 1, identity: 0.967

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttgggatcgggttt	Protospacer
******************.***********

15. spacer 2.1|4635975|30|NZ_CP048878|CRT matches to position: 3233746-3233775, mismatch: 1, identity: 0.967

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttgggatcgggttt	Protospacer
******************.***********

16. spacer 2.1|4635975|30|NZ_CP048878|CRT matches to position: 4635951-4635980, mismatch: 1, identity: 0.967

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatctggcttaggatcgggttt	Protospacer
************.*****************

17. spacer 2.2|4636023|30|NZ_CP048878|CRT matches to position: 3233602-3233631, mismatch: 1, identity: 0.967

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttgggatcgggttt	Protospacer
******************.***********

18. spacer 2.2|4636023|30|NZ_CP048878|CRT matches to position: 3233674-3233703, mismatch: 1, identity: 0.967

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttgggatcgggttt	Protospacer
******************.***********

19. spacer 2.2|4636023|30|NZ_CP048878|CRT matches to position: 3233746-3233775, mismatch: 1, identity: 0.967

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatccggcttgggatcgggttt	Protospacer
******************.***********

20. spacer 2.2|4636023|30|NZ_CP048878|CRT matches to position: 4635951-4635980, mismatch: 1, identity: 0.967

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttggatctggcttaggatcgggttt	Protospacer
************.*****************

21. spacer 2.3|4636071|18|NZ_CP048878|CRT matches to position: 3233614-3233631, mismatch: 1, identity: 0.944

gggttttgggtccggctt	CRISPR spacer
gggttttggatccggctt	Protospacer
*********.********

22. spacer 2.3|4636071|18|NZ_CP048878|CRT matches to position: 3233662-3233679, mismatch: 1, identity: 0.944

gggttttgggtccggctt	CRISPR spacer
gggttttggatccggctt	Protospacer
*********.********

23. spacer 2.3|4636071|18|NZ_CP048878|CRT matches to position: 3233686-3233703, mismatch: 1, identity: 0.944

gggttttgggtccggctt	CRISPR spacer
gggttttggatccggctt	Protospacer
*********.********

24. spacer 2.3|4636071|18|NZ_CP048878|CRT matches to position: 3233734-3233751, mismatch: 1, identity: 0.944

gggttttgggtccggctt	CRISPR spacer
gggttttggatccggctt	Protospacer
*********.********

25. spacer 2.3|4636071|18|NZ_CP048878|CRT matches to position: 3233758-3233775, mismatch: 1, identity: 0.944

gggttttgggtccggctt	CRISPR spacer
gggttttggatccggctt	Protospacer
*********.********

26. spacer 2.3|4636071|18|NZ_CP048878|CRT matches to position: 3233782-3233799, mismatch: 1, identity: 0.944

gggttttgggtccggctt	CRISPR spacer
gggttttggatccggctt	Protospacer
*********.********

27. spacer 2.3|4636071|18|NZ_CP048878|CRT matches to position: 3233806-3233823, mismatch: 1, identity: 0.944

gggttttgggtccggctt	CRISPR spacer
gggttttggatccggctt	Protospacer
*********.********

28. spacer 2.3|4636071|18|NZ_CP048878|CRT matches to position: 3233830-3233847, mismatch: 1, identity: 0.944

gggttttgggtccggctt	CRISPR spacer
gggttttggatccggctt	Protospacer
*********.********

29. spacer 2.1|4635975|30|NZ_CP048878|CRT matches to position: 3233626-3233655, mismatch: 2, identity: 0.933

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttgggtccggcttgggatcgggttt	Protospacer
*********.********.***********

30. spacer 2.1|4635975|30|NZ_CP048878|CRT matches to position: 3233698-3233727, mismatch: 2, identity: 0.933

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttgggtccggcttgggatcgggttt	Protospacer
*********.********.***********

31. spacer 2.2|4636023|30|NZ_CP048878|CRT matches to position: 3233626-3233655, mismatch: 2, identity: 0.933

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttgggtccggcttgggatcgggttt	Protospacer
*********.********.***********

32. spacer 2.2|4636023|30|NZ_CP048878|CRT matches to position: 3233698-3233727, mismatch: 2, identity: 0.933

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gggttttgggtccggcttgggatcgggttt	Protospacer
*********.********.***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048878_2 2.1|4635975|30|NZ_CP048878|CRT 4635975-4636004 30 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 130506-130535 6 0.8
NZ_CP048878_2 2.1|4635975|30|NZ_CP048878|CRT 4635975-4636004 30 NZ_CP028965 Burkholderia sp. IDO3 plasmid p1, complete sequence 416330-416359 6 0.8
NZ_CP048878_2 2.2|4636023|30|NZ_CP048878|CRT 4636023-4636052 30 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 130506-130535 6 0.8
NZ_CP048878_2 2.2|4636023|30|NZ_CP048878|CRT 4636023-4636052 30 NZ_CP028965 Burkholderia sp. IDO3 plasmid p1, complete sequence 416330-416359 6 0.8
NZ_CP048878_1 1.2|3442966|32|NZ_CP048878|PILER-CR 3442966-3442997 32 AP013428 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C57A-MedDCM-OCT-S39-C32 15102-15133 7 0.781
NZ_CP048878_2 2.1|4635975|30|NZ_CP048878|CRT 4635975-4636004 30 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 684668-684697 7 0.767
NZ_CP048878_2 2.2|4636023|30|NZ_CP048878|CRT 4636023-4636052 30 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 684668-684697 7 0.767
NZ_CP048878_1 1.2|3442966|32|NZ_CP048878|PILER-CR 3442966-3442997 32 AJ629075 Cyanophage S-RSM88 partial x gene, ORF178, y gene, psbA gene and partial psbD gene 2370-2401 9 0.719
NZ_CP048878_1 1.2|3442966|32|NZ_CP048878|PILER-CR 3442966-3442997 32 AJ630128 Bacteriophage S-PM2 complete genome 136676-136707 9 0.719
NZ_CP048878_1 1.2|3442966|32|NZ_CP048878|PILER-CR 3442966-3442997 32 NC_006820 Synechococcus phage S-PM2, complete genome 136676-136707 9 0.719
NZ_CP048878_1 1.2|3442966|32|NZ_CP048878|PILER-CR 3442966-3442997 32 LN828717 Synechococcus phage S-PM2 spontaneous deletion mutant, complete genome 127132-127163 9 0.719
NZ_CP048878_1 1.2|3442966|32|NZ_CP048878|PILER-CR 3442966-3442997 32 AY329638 Bacteriophage S-PM2 PsbA (psbA), endonucelase VII (g49), hypothetical protein, and PsbD (psbD) genes, complete cds 1499-1530 9 0.719
NZ_CP048878_1 1.2|3442966|32|NZ_CP048878|PILER-CR 3442966-3442997 32 NZ_KX426229 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.1, complete sequence 81207-81238 10 0.688
NZ_CP048878_1 1.2|3442966|32|NZ_CP048878|PILER-CR 3442966-3442997 32 CP019144 Acinetobacter lwoffii strain ZS207 plasmid pmZS, complete sequence 111618-111649 10 0.688
NZ_CP048878_1 1.2|3442966|32|NZ_CP048878|PILER-CR 3442966-3442997 32 NZ_CP046295 Acinetobacter lwoffii strain FDAARGOS_552 plasmid unnamed1, complete sequence 41410-41441 10 0.688
NZ_CP048878_1 1.2|3442966|32|NZ_CP048878|PILER-CR 3442966-3442997 32 NZ_CP026426 Acinetobacter sp. ACNIH1 plasmid pACI-df08, complete sequence 43482-43513 10 0.688
NZ_CP048878_1 1.2|3442966|32|NZ_CP048878|PILER-CR 3442966-3442997 32 NZ_CP032290 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.6, complete sequence 138582-138613 10 0.688

1. spacer 2.1|4635975|30|NZ_CP048878|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 6, identity: 0.8

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gcgatcgggatccggcaaaggatcgggttt	Protospacer
* * *. *********  ************

2. spacer 2.1|4635975|30|NZ_CP048878|CRT matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gcgatcgggatccggcaaaggatcgggttt	Protospacer
* * *. *********  ************

3. spacer 2.2|4636023|30|NZ_CP048878|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 6, identity: 0.8

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gcgatcgggatccggcaaaggatcgggttt	Protospacer
* * *. *********  ************

4. spacer 2.2|4636023|30|NZ_CP048878|CRT matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8

gggttttggatccggcttaggatcgggttt	CRISPR spacer
gcgatcgggatccggcaaaggatcgggttt	Protospacer
* * *. *********  ************

5. spacer 1.2|3442966|32|NZ_CP048878|PILER-CR matches to AP013428 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C57A-MedDCM-OCT-S39-C32) position: , mismatch: 7, identity: 0.781

caaagataatgactaaaaaatac--tctgattca	CRISPR spacer
caaaggtaatgacaaaaaaatacaagttgttt--	Protospacer
*****.******* *********   .** **  

6. spacer 2.1|4635975|30|NZ_CP048878|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 7, identity: 0.767

gggttttggatccggcttaggatcgggttt	CRISPR spacer
tgtctttggatccggcttcggatcgaggat	Protospacer
 * .************** ******.*  *

7. spacer 2.2|4636023|30|NZ_CP048878|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 7, identity: 0.767

gggttttggatccggcttaggatcgggttt	CRISPR spacer
tgtctttggatccggcttcggatcgaggat	Protospacer
 * .************** ******.*  *

8. spacer 1.2|3442966|32|NZ_CP048878|PILER-CR matches to AJ629075 (Cyanophage S-RSM88 partial x gene, ORF178, y gene, psbA gene and partial psbD gene) position: , mismatch: 9, identity: 0.719

caaagataatgactaaaaaatactctgattca	CRISPR spacer
aaacacgaatgactaaactatactctgatttg	Protospacer
 ** .  **********  ***********..

9. spacer 1.2|3442966|32|NZ_CP048878|PILER-CR matches to AJ630128 (Bacteriophage S-PM2 complete genome) position: , mismatch: 9, identity: 0.719

caaagataatgactaaaaaatactctgattca	CRISPR spacer
aaacacgaatgactaaactatactctgatttg	Protospacer
 ** .  **********  ***********..

10. spacer 1.2|3442966|32|NZ_CP048878|PILER-CR matches to NC_006820 (Synechococcus phage S-PM2, complete genome) position: , mismatch: 9, identity: 0.719

caaagataatgactaaaaaatactctgattca	CRISPR spacer
aaacacgaatgactaaactatactctgatttg	Protospacer
 ** .  **********  ***********..

11. spacer 1.2|3442966|32|NZ_CP048878|PILER-CR matches to LN828717 (Synechococcus phage S-PM2 spontaneous deletion mutant, complete genome) position: , mismatch: 9, identity: 0.719

caaagataatgactaaaaaatactctgattca	CRISPR spacer
aaacacgaatgactaaactatactctgatttg	Protospacer
 ** .  **********  ***********..

12. spacer 1.2|3442966|32|NZ_CP048878|PILER-CR matches to AY329638 (Bacteriophage S-PM2 PsbA (psbA), endonucelase VII (g49), hypothetical protein, and PsbD (psbD) genes, complete cds) position: , mismatch: 9, identity: 0.719

caaagataatgactaaaaaatactctgattca	CRISPR spacer
aaacacgaatgactaaactatactctgatttg	Protospacer
 ** .  **********  ***********..

13. spacer 1.2|3442966|32|NZ_CP048878|PILER-CR matches to NZ_KX426229 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.1, complete sequence) position: , mismatch: 10, identity: 0.688

caaagataatgactaaaaaatactctgattca	CRISPR spacer
agattttaatgacaaaaaaataccctgatggt	Protospacer
 .*   ******* *********.*****   

14. spacer 1.2|3442966|32|NZ_CP048878|PILER-CR matches to CP019144 (Acinetobacter lwoffii strain ZS207 plasmid pmZS, complete sequence) position: , mismatch: 10, identity: 0.688

caaagataatgactaaaaaatactctgattca	CRISPR spacer
agattttaatgacaaaaaaataccctgatggt	Protospacer
 .*   ******* *********.*****   

15. spacer 1.2|3442966|32|NZ_CP048878|PILER-CR matches to NZ_CP046295 (Acinetobacter lwoffii strain FDAARGOS_552 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

caaagataatgactaaaaaatactctgattca	CRISPR spacer
agattttaatgacaaaaaaataccctgatggt	Protospacer
 .*   ******* *********.*****   

16. spacer 1.2|3442966|32|NZ_CP048878|PILER-CR matches to NZ_CP026426 (Acinetobacter sp. ACNIH1 plasmid pACI-df08, complete sequence) position: , mismatch: 10, identity: 0.688

caaagataatgactaaaaaatactctgattca	CRISPR spacer
agattttaatgacaaaaaaataccctgatggt	Protospacer
 .*   ******* *********.*****   

17. spacer 1.2|3442966|32|NZ_CP048878|PILER-CR matches to NZ_CP032290 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.6, complete sequence) position: , mismatch: 10, identity: 0.688

caaagataatgactaaaaaatactctgattca	CRISPR spacer
agattttaatgacaaaaaaataccctgatggt	Protospacer
 .*   ******* *********.*****   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 68672 : 134902 80 Vibrio_phage(11.43%) tRNA,integrase,capsid,tail,head,terminase,transposase,plate,protease,portal attL 70595:70613|attR 133938:133956
DBSCAN-SWA_2 395384 : 428497 35 Morganella_phage(33.33%) transposase,integrase,protease attL 410018:410077|attR 428663:428730
DBSCAN-SWA_3 901002 : 1010503 113 Pseudomonas_phage(43.33%) integrase,capsid,tail,head,terminase,transposase,plate,protease,portal attL 900925:900984|attR 1002684:1003716
DBSCAN-SWA_4 1038762 : 1113090 54 Diachasmimorpha_longicaudata_entomopoxvirus(20.0%) tRNA,integrase,protease,transposase attL 1046613:1046628|attR 1120093:1120108
DBSCAN-SWA_5 1129636 : 1144167 22 Ralstonia_phage(40.0%) tail NA
DBSCAN-SWA_6 1213313 : 1239698 28 Synechococcus_phage(50.0%) transposase,tail NA
DBSCAN-SWA_7 1244348 : 1329070 106 Vibrio_phage(15.38%) integrase,capsid,tail,head,terminase,transposase,plate,portal attL 1258736:1258759|attR 1329272:1329295
DBSCAN-SWA_8 1333113 : 1368304 44 Pseudomonas_phage(48.0%) integrase,capsid,tail,head,terminase,portal attL 1329674:1329687|attR 1369521:1369534
DBSCAN-SWA_9 1377853 : 1426751 56 Vibrio_phage(14.29%) capsid,tail,head,terminase,plate,protease,portal,holin NA
DBSCAN-SWA_10 1480113 : 1489206 10 Vibrio_phage(50.0%) tRNA NA
DBSCAN-SWA_11 1659136 : 1726843 60 Bacillus_phage(37.5%) transposase,protease NA
DBSCAN-SWA_12 1941155 : 1959874 25 Synechococcus_phage(100.0%) transposase,tail NA
DBSCAN-SWA_13 2496221 : 2551890 55 uncultured_Caudovirales_phage(15.0%) transposase,protease,tRNA NA
DBSCAN-SWA_14 2558232 : 2692239 171 Vibrio_virus(14.67%) tRNA,integrase,capsid,tail,head,terminase,transposase,plate,protease,portal attL 2621037:2621057|attR 2647106:2647126
DBSCAN-SWA_15 3428235 : 3486029 39 Streptococcus_phage(33.33%) integrase,transposase attL 3429499:3429516|attR 3489360:3489377
DBSCAN-SWA_16 3616653 : 3667692 42 Tetraselmis_virus(20.0%) tRNA,tail,transposase NA
DBSCAN-SWA_17 4381701 : 4447586 82 Vibrio_phage(14.29%) tRNA,integrase,capsid,tail,head,terminase,transposase,plate,protease,portal,holin attL 4409572:4409596|attR 4444085:4444109
DBSCAN-SWA_18 4456939 : 4491619 35 Vibrio_virus(50.0%) integrase,tail,terminase,plate,protease,portal,holin attL 4453157:4453176|attR 4496255:4496274
DBSCAN-SWA_19 4497445 : 4505407 12 Pseudomonas_phage(33.33%) integrase attL 4496603:4496615|attR 4508090:4508102
DBSCAN-SWA_20 5783600 : 5812406 22 uncultured_Caudovirales_phage(25.0%) transposase,holin NA
DBSCAN-SWA_21 5962331 : 6013991 49 Salicola_phage(20.0%) tRNA,transposase NA
DBSCAN-SWA_22 6019060 : 6064091 48 Bacillus_virus(40.0%) transposase NA
DBSCAN-SWA_23 6254450 : 6317125 47 Tupanvirus(33.33%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage