Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047882 Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence 0 crisprs cas3,c2c9_V-U4,DEDDh,cas14j 0 0 2 0
NZ_CP047881 Salmonella enterica subsp. enterica serovar Infantis strain 119944 chromosome, complete genome 3 crisprs DEDDh,WYL,DinG,cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 32 340 0

Results visualization

1. NZ_CP047881
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047881_1 3039144-3039251 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047881_2 3516244-3518140 TypeI-E I-E
30 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047881_3 3534422-3536038 TypeI-E I-E
26 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047881_3 3.14|3535245|32|NZ_CP047881|CRISPRCasFinder,CRT 3535245-3535276 32 NZ_CP039495 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669_2, complete sequence 16537-16568 0 1.0
NZ_CP047881_3 3.14|3535245|32|NZ_CP047881|CRISPRCasFinder,CRT 3535245-3535276 32 KC139516 Salmonella phage FSL SP-016, partial genome 44540-44571 0 1.0
NZ_CP047881_3 3.14|3535245|32|NZ_CP047881|CRISPRCasFinder,CRT 3535245-3535276 32 NC_042346 Salmonella virus BTP1 genome assembly, chromosome: BTP1 23602-23633 0 1.0
NZ_CP047881_3 3.14|3535245|32|NZ_CP047881|CRISPRCasFinder,CRT 3535245-3535276 32 NZ_KP763470 Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence 45442-45473 1 0.969
NZ_CP047881_3 3.14|3535245|32|NZ_CP047881|CRISPRCasFinder,CRT 3535245-3535276 32 CP051275 Salmonella phage SW-37, complete genome 22992-23023 1 0.969
NZ_CP047881_2 2.8|3516740|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3516740-3516771 32 CP053410 Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence 44895-44926 3 0.906
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 MN098327 Klebsiella phage Mulock, complete genome 34232-34261 5 0.833
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 KY271395 Klebsiella phage 2b LV-2017, complete genome 11683-11712 5 0.833
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 KY271396 Klebsiella phage 2 LV-2017, complete genome 33331-33360 5 0.833
NZ_CP047881_3 3.10|3535001|32|NZ_CP047881|CRISPRCasFinder,CRT 3535001-3535032 32 NZ_LN554848 Aliivibrio wodanis genome assembly AWOD1, plasmid : pAWOD920 55242-55273 5 0.844
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NZ_CP047230 Moraxella osloensis strain YV1 plasmid p4, complete sequence 5721-5750 6 0.8
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 MK448230 Klebsiella phage ST16-OXA48phi5.2, complete genome 13190-13219 6 0.8
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NC_008771 Verminephrobacter eiseniae EF01-2 plasmid pVEIS01, complete sequence 26884-26913 6 0.8
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NZ_KX364409 Aeromonas salmonicida subsp. salmonicida strain M16474-11 plasmid pAsa8, complete sequence 44288-44317 6 0.8
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NZ_CP022660 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence 12970-12999 6 0.8
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NZ_CP022660 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence 284684-284713 6 0.8
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NZ_CP045061 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence 12975-13004 6 0.8
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NZ_CP045054 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence 12979-13008 6 0.8
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NZ_CP045058 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence 12978-13007 6 0.8
NZ_CP047881_2 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder 3516334-3516365 32 NZ_CP033726 Clavibacter michiganensis subsp. michiganensis strain UF1 plasmid pCM2U-F1, complete sequence 43935-43966 6 0.812
NZ_CP047881_2 2.11|3516923|29|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3516923-3516951 29 NZ_CP010957 Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence 225651-225679 6 0.793
NZ_CP047881_2 2.11|3516923|29|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3516923-3516951 29 AP013537 Uncultured Mediterranean phage uvMED DNA, complete genome, group G6, isolate: uvMED-CGR-C59A-MedDCM-OCT-S34-C49 24370-24398 6 0.793
NZ_CP047881_2 2.11|3516923|29|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3516923-3516951 29 AP014007 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C59A-MedDCM-OCT-S29-C45, *** SEQUENCING IN PROGRESS *** 26235-26263 6 0.793
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_KT307967 Yersinia pseudotuberculosis strain IP2666 plasmid pYV2666, complete sequence 3657-3688 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NC_010157 Yersinia pestis Angola plasmid new_pCD, complete sequence 52733-52764 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NC_006153 Yersinia pseudotuberculosis IP 32953 plasmid pYV, complete sequence 3655-3686 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NC_005813 Yersinia pestis biovar Microtus str. 91001 plasmid pCD1, complete sequence 5726-5757 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP009491 Yersinia pestis strain PBM19 plasmid pCD1, complete sequence 22794-22825 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NC_010635 Yersinia pseudotuberculosis PB1/+ plasmid pYPTS01, complete sequence 18045-18076 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP009758 Yersinia pseudotuberculosis strain EP2/+ plasmid pCD, complete sequence 29230-29261 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP009779 Yersinia pseudotuberculosis PB1/+ plasmid pYAB, complete sequence 30995-31026 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP009711 Yersinia pseudotuberculosis IP 32953 strain IP32953 plasmid pYAC_1, complete sequence 33462-33493 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP009713 Yersinia pestis Pestoides F plasmid pCD, complete sequence 8420-8451 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP009703 Yersinia pestis strain Harbin35 plasmid unnamed2, complete sequence 53711-53742 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP009783 Yersinia pestis strain El Dorado plasmid pCD, complete sequence 41473-41504 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP009721 Yersinia pestis strain Shasta plasmid pCD, complete sequence 15954-15985 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP045260 Yersinia pestis strain SCPM-O-B-5942 (I-2638) plasmid pCD, complete sequence 2016-2047 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP033695 Yersinia pestis strain FDAARGOS_602 plasmid unnamed2, complete sequence 32080-32111 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NC_009377 Yersinia pestis Pestoides F plasmid CD, complete sequence 3737-3768 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NC_014017 Yersinia pestis Z176003 plasmid pCD1, complete sequence 53160-53191 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NC_017263 Yersinia pestis biovar Medievalis str. Harbin 35 plasmid pCD, complete sequence 53373-53404 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP033697 Yersinia pestis strain FDAARGOS_601 plasmid unnamed1, complete sequence 67337-67368 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP033712 Yersinia pseudotuberculosis strain FDAARGOS_581 plasmid unnamed, complete sequence 52835-52866 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP033714 Yersinia pseudotuberculosis strain FDAARGOS_580 plasmid unnamed, complete sequence 1810-1841 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP032567 Yersinia pseudotuberculosis strain IP2666pIB1 plasmid pIB1, complete sequence 3657-3688 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP033708 Yersinia pseudotuberculosis strain FDAARGOS_583 plasmid unnamed, complete sequence 8879-8910 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP045147 Yersinia pestis strain SCPM-O-B-6899 (231) plasmid pCD, complete sequence 2016-2047 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP045156 Yersinia pestis strain SCPM-O-B-5935 (I-1996) plasmid pCD, complete sequence 2016-2047 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP045160 Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 plasmid pCD, complete sequence 2016-2047 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP006747 Yersinia pestis 8787 plasmid pCD1, complete sequence 29547-29578 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP009972 Yersinia pestis CO92 plasmid unnamed, complete sequence 21695-21726 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NC_003131 Yersinia pestis CO92 plasmid pCD1, complete sequence 55118-55149 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP045151 Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pCD, complete sequence 2016-2047 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP006791 Yersinia pestis 2944 plasmid pCD, complete sequence 25332-25363 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP006750 Yersinia pestis 3770 plasmid pCD1, complete sequence 63914-63945 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP006757 Yersinia pestis 1522 plasmid pCD, complete sequence 16846-16877 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_LT596222 Yersinia pseudotuberculosis isolate NZYP4713 plasmid 2 2004-2035 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP033710 Yersinia pseudotuberculosis strain FDAARGOS_582 plasmid unnamed, complete sequence 41051-41082 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NC_017157 Yersinia pestis D182038 plasmid pCD1, complete sequence 54483-54514 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NC_017153 Yersinia pestis D106004 plasmid pCD1, complete sequence 53160-53191 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP033716 Yersinia pseudotuberculosis strain FDAARGOS_579 plasmid unnamed, complete sequence 33032-33063 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NC_004839 Yersinia pestis strain KIM5 plasmid pCD1, complete sequence 3737-3768 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP033689 Yersinia pestis strain FDAARGOS_603 plasmid unnamed1, complete sequence 36155-36186 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP006761 Yersinia pestis 1413 plasmid pCD, complete sequence 34564-34595 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP006780 Yersinia pestis 1412 plasmid pCD, complete sequence 17614-17645 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP006753 Yersinia pestis 3067 plasmid pCD1, complete sequence 17769-17800 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP016274 Yersinia pestis strain Cadman plasmid pCD1, complete sequence 26932-26963 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP019710 Yersinia pestis strain 195/P plasmid pCD1, complete sequence 9952-9983 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP009905 Yersinia pestis Antiqua plasmid pCD, complete sequence 21643-21674 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP009990 Yersinia pestis strain Nicholisk 41 plasmid 2, complete sequence 51092-51123 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP009937 Yersinia pestis Angola plasmid pCD, complete sequence 11000-11031 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP009842 Yersinia pestis strain Dodson plasmid pCD, complete sequence 61073-61104 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP010069 Yersinia pseudotuberculosis str. PA3606 plasmid unnamed1, complete sequence 58463-58494 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP010246 Yersinia pestis Pestoides G plasmid pCD, complete sequence 47330-47361 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP010022 Yersinia pestis str. Pestoides B plasmid pCD, complete sequence 28027-28058 6 0.812
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NC_015056 Yersinia pestis Java 9 plasmid pCD, complete sequence 76315-76346 6 0.812
NZ_CP047881_2 2.20|3517469|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517469-3517500 32 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 178636-178667 6 0.812
NZ_CP047881_2 2.32|3516336|32|NZ_CP047881|PILER-CR 3516336-3516367 32 NZ_CP033726 Clavibacter michiganensis subsp. michiganensis strain UF1 plasmid pCM2U-F1, complete sequence 43935-43966 6 0.812
NZ_CP047881_3 3.19|3535550|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535550-3535581 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3403299-3403330 6 0.812
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NZ_CP011866 Enterobacter asburiae strain ATCC 35953 plasmid unnamed 3, complete sequence 4507-4536 7 0.767
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NZ_CP011866 Enterobacter asburiae strain ATCC 35953 plasmid unnamed 3, complete sequence 9665-9694 7 0.767
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NZ_CP011866 Enterobacter asburiae strain ATCC 35953 plasmid unnamed 3, complete sequence 14816-14845 7 0.767
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NC_019298 Rahnella sp. WMR121 plasmid pHW121, complete sequence 1909-1938 7 0.767
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NC_011667 Thauera sp. MZ1T plasmid pTha01, complete sequence 77731-77760 7 0.767
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NC_012209 Yersinia enterocolitica plasmid pYe4449-2, complete sequence 14304-14333 7 0.767
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 652620-652651 7 0.781
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 666481-666512 7 0.781
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 591710-591741 7 0.781
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP021819 Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence 492570-492601 7 0.781
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 1326784-1326815 7 0.781
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 235632-235663 7 0.781
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 834462-834493 7 0.781
NZ_CP047881_3 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT 3534451-3534482 32 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 4747-4778 7 0.781
NZ_CP047881_3 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT 3534451-3534482 32 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 389262-389293 7 0.781
NZ_CP047881_3 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT 3534451-3534482 32 AP014010 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C97-MedDCM-OCT-S27-C11, *** SEQUENCING IN PROGRESS *** 33568-33599 7 0.781
NZ_CP047881_3 3.3|3534573|32|NZ_CP047881|CRISPRCasFinder,CRT 3534573-3534604 32 NZ_CP014690 Gluconobacter albidus strain TMW2.1191 plasmid pGS1191_1, complete sequence 221609-221640 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NZ_CP044974 Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B4) plasmid pPBL-H3_B4-2, complete sequence 75250-75281 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NZ_CP053984 Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence 8273-8304 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NZ_CP015373 Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence 23025-23056 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NZ_CP026268 Aminobacter sp. MSH1 plasmid pBAM1, complete sequence 23153-23184 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NC_010935 Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence 9729-9760 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NC_017908 Mycobacterium abscessus subsp. bolletii F1725 plasmid BRA100, complete sequence 41202-41233 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NZ_LR594690 Variovorax sp. WDL1 plasmid 2 549233-549264 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 JX469834 Uncultured bacterium plasmid pDS3, complete sequence 38822-38853 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 JX469828 Uncultured bacterium plasmid pRSB223, complete sequence 6551-6582 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 JX469831 Uncultured bacterium plasmid pKSP212, complete sequence 45664-45695 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NZ_CP044977 Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-2, complete sequence 77800-77831 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 JN106171 Uncultured bacterium plasmid pAKD26, complete sequence 71417-71448 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 JN106172 Uncultured bacterium plasmid pAKD29, complete sequence 38666-38697 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 JN106173 Uncultured bacterium plasmid pAKD31, complete sequence 39847-39878 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 JN106174 Uncultured bacterium plasmid pAKD33, complete sequence 39847-39878 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 JN106165 Uncultured bacterium plasmid pAKD14, complete sequence 39844-39875 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 JN106166 Uncultured bacterium plasmid pAKD15, complete sequence 39844-39875 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 JN106168 Uncultured bacterium plasmid pAKD17, complete sequence 39844-39875 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 JN106169 Uncultured bacterium plasmid pAKD18, complete sequence 39829-39860 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NZ_CP044551 Hydrogenophaga sp. BPS33 plasmid pBPS33-2, complete sequence 62497-62528 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NC_016968 Comamonas testosteroni plasmid pTB30, complete sequence 76964-76995 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NC_016978 Comamonas testosteroni plasmid pI2, complete sequence 66272-66303 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NZ_CP017760 Cupriavidus necator strain NH9 plasmid pENH91, complete sequence 20743-20774 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NZ_CP053554 Diaphorobacter sp. JS3050 plasmid pDCNB, complete sequence 19175-19206 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 KF743817 Proteus mirabilis plasmid R772, complete sequence 38759-38790 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 KF743818 Bordetella bronchiseptica plasmid R906, complete sequence 40977-41008 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NZ_CP038640 Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence 74199-74230 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NC_019263 Delftia acidovorans plasmid pLME1, complete sequence 75102-75133 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NC_019264 Delftia acidovorans plasmid pNB8c, complete sequence 58096-58127 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NC_019283 Delftia acidovorans plasmid pC1-1, complete sequence 71953-71984 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NC_019320 Variovorax sp. DB1 plasmid pDB1, complete sequence 8004-8035 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NZ_LR594664 Variovorax sp. RA8 plasmid 3 307956-307987 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NC_021077 Comamonas sp. 7D-2 plasmid pBHB, complete sequence 80572-80603 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NC_007337 Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence 8004-8035 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NZ_LR594677 Variovorax sp. PBS-H4 plasmid 3 91682-91713 7 0.781
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NC_006830 Achromobacter xylosoxidans A8 plasmid pA81, complete sequence 78675-78706 7 0.781
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NZ_CP038104 Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa9-like, complete sequence 58151-58180 8 0.733
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NZ_KY555070 Aeromonas salmonicida subsp. salmonicida strain 01-B526 plasmid pAsa9, complete sequence 57943-57972 8 0.733
NZ_CP047881_2 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder 3516334-3516365 32 NZ_CP015231 Epibacterium mobile F1926 plasmid unnamed1, complete sequence 463868-463899 8 0.75
NZ_CP047881_2 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder 3516334-3516365 32 NC_021304 Streptomyces phage Sujidade, complete genome 1599-1630 8 0.75
NZ_CP047881_2 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder 3516334-3516365 32 MG663585 Streptomyces phage ToriToki, complete genome 15079-15110 8 0.75
NZ_CP047881_2 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder 3516334-3516365 32 MK112550 Streptomyces phage Olicious, complete genome 15086-15117 8 0.75
NZ_CP047881_2 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder 3516334-3516365 32 MG663582 Streptomyces phage HaugeAnator, complete genome 15086-15117 8 0.75
NZ_CP047881_2 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder 3516334-3516365 32 MG663586 Streptomyces phage ZooBear, complete genome 15086-15117 8 0.75
NZ_CP047881_2 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder 3516334-3516365 32 NC_048686 Streptomyces phage Immanuel3, complete genome 15090-15121 8 0.75
NZ_CP047881_2 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder 3516334-3516365 32 MG663584 Streptomyces phage Romero, complete genome 15079-15110 8 0.75
NZ_CP047881_2 2.6|3516618|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3516618-3516649 32 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 411938-411969 8 0.75
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 508622-508653 8 0.75
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 938103-938134 8 0.75
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 1142696-1142727 8 0.75
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 1515253-1515284 8 0.75
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 544308-544339 8 0.75
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 1138201-1138232 8 0.75
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 1084795-1084826 8 0.75
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 1048974-1049005 8 0.75
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 1239699-1239730 8 0.75
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 1224396-1224427 8 0.75
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 808919-808950 8 0.75
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 771861-771892 8 0.75
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 936442-936473 8 0.75
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 840415-840446 8 0.75
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 KC292024 Halovirus HHTV-2, complete genome 51651-51682 8 0.75
NZ_CP047881_2 2.32|3516336|32|NZ_CP047881|PILER-CR 3516336-3516367 32 NZ_CP015231 Epibacterium mobile F1926 plasmid unnamed1, complete sequence 463868-463899 8 0.75
NZ_CP047881_2 2.32|3516336|32|NZ_CP047881|PILER-CR 3516336-3516367 32 NC_021304 Streptomyces phage Sujidade, complete genome 1599-1630 8 0.75
NZ_CP047881_2 2.32|3516336|32|NZ_CP047881|PILER-CR 3516336-3516367 32 MG663585 Streptomyces phage ToriToki, complete genome 15079-15110 8 0.75
NZ_CP047881_2 2.32|3516336|32|NZ_CP047881|PILER-CR 3516336-3516367 32 MK112550 Streptomyces phage Olicious, complete genome 15086-15117 8 0.75
NZ_CP047881_2 2.32|3516336|32|NZ_CP047881|PILER-CR 3516336-3516367 32 MG663582 Streptomyces phage HaugeAnator, complete genome 15086-15117 8 0.75
NZ_CP047881_2 2.32|3516336|32|NZ_CP047881|PILER-CR 3516336-3516367 32 MG663586 Streptomyces phage ZooBear, complete genome 15086-15117 8 0.75
NZ_CP047881_2 2.32|3516336|32|NZ_CP047881|PILER-CR 3516336-3516367 32 NC_048686 Streptomyces phage Immanuel3, complete genome 15090-15121 8 0.75
NZ_CP047881_2 2.32|3516336|32|NZ_CP047881|PILER-CR 3516336-3516367 32 MG663584 Streptomyces phage Romero, complete genome 15079-15110 8 0.75
NZ_CP047881_3 3.12|3535123|32|NZ_CP047881|CRISPRCasFinder,CRT 3535123-3535154 32 NZ_CP042333 Bosea sp. F3-2 plasmid pB32-2, complete sequence 28489-28520 8 0.75
NZ_CP047881_3 3.16|3535367|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535367-3535398 32 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 188876-188907 8 0.75
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NZ_CP040989 Vibrio furnissii strain FDAARGOS_777 plasmid unnamed1, complete sequence 23089-23120 8 0.75
NZ_CP047881_3 3.19|3535550|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535550-3535581 32 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 272071-272102 8 0.75
NZ_CP047881_3 3.22|3535733|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535733-3535764 32 NZ_CP028919 Gemmobacter sp. HYN0069 plasmid unnamed1, complete sequence 34712-34743 8 0.75
NZ_CP047881_1 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder 3039183-3039212 30 NZ_CP014310 Burkholderia sp. PAMC 26561 plasmid unnamed3, complete sequence 203476-203505 9 0.7
NZ_CP047881_2 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder 3516334-3516365 32 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 341970-342001 9 0.719
NZ_CP047881_2 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder 3516334-3516365 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 321406-321437 9 0.719
NZ_CP047881_2 2.9|3516801|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3516801-3516832 32 LR877331 Klebsiella phage vB_KpnM_311F genome assembly, chromosome: 1 58865-58896 9 0.719
NZ_CP047881_2 2.9|3516801|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3516801-3516832 32 MN434095 Klebsiella pneumoniae phage JIPh_Kp122, complete genome 157694-157725 9 0.719
NZ_CP047881_2 2.9|3516801|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3516801-3516832 32 KY000080 Klebsiella phage KPV15, complete genome 11451-11482 9 0.719
NZ_CP047881_2 2.9|3516801|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3516801-3516832 32 NC_028686 Klebsiella phage JD18, complete genome 157483-157514 9 0.719
NZ_CP047881_2 2.9|3516801|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3516801-3516832 32 MK421971 Klebsiella phage vB_KpnM_GF, partial genome 152891-152922 9 0.719
NZ_CP047881_2 2.13|3517042|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517042-3517073 32 AP014927 Ralstonia phage RSF1 DNA, complete genome 117193-117224 9 0.719
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP044424 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence 48814-48845 9 0.719
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 KT381276 Mycobacterium phage Serenity, complete genome 13746-13777 9 0.719
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 77981-78012 9 0.719
NZ_CP047881_2 2.19|3517408|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517408-3517439 32 NZ_CP047261 Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326F, complete sequence 86590-86621 9 0.719
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 84729-84760 9 0.719
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 145047-145078 9 0.719
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 145256-145287 9 0.719
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 148548-148579 9 0.719
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 148330-148361 9 0.719
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 MF344568 Pseudomonas aeruginosa plasmid p727-IMP, complete sequence 151010-151041 9 0.719
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 147600-147631 9 0.719
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 150756-150787 9 0.719
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 NZ_CP039294 Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence 392902-392933 9 0.719
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 223040-223071 9 0.719
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 NZ_CP040126 Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence 84333-84364 9 0.719
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 78216-78247 9 0.719
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 156756-156787 9 0.719
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 154605-154636 9 0.719
NZ_CP047881_2 2.22|3517591|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517591-3517622 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 436590-436621 9 0.719
NZ_CP047881_2 2.22|3517591|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517591-3517622 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 610630-610661 9 0.719
NZ_CP047881_2 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517774-3517805 32 NZ_CP025882 Escherichia coli strain 503440 plasmid p503440_52, complete sequence 21245-21276 9 0.719
NZ_CP047881_2 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517774-3517805 32 NZ_CP025895 Escherichia coli strain 503025 plasmid p503025_52, complete sequence 49736-49767 9 0.719
NZ_CP047881_2 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517774-3517805 32 NZ_CP025867 Escherichia coli strain 504211 plasmid p504211_50, complete sequence 49975-50006 9 0.719
NZ_CP047881_2 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517774-3517805 32 NZ_CP025980 Escherichia marmotae strain HT073016 plasmid pEM148, complete sequence 137273-137304 9 0.719
NZ_CP047881_2 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517774-3517805 32 NZ_CP025871 Escherichia coli strain 503829 plasmid p503829_52, complete sequence 8728-8759 9 0.719
NZ_CP047881_2 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517774-3517805 32 NZ_CP054369 Escherichia coli strain SCU-115 plasmid pSCU-115-1, complete sequence 142880-142911 9 0.719
NZ_CP047881_2 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517774-3517805 32 NZ_CP006000 Escherichia coli B7A plasmid pEB2, complete sequence 28176-28207 9 0.719
NZ_CP047881_2 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517774-3517805 32 NZ_CP012377 Escherichia coli strain GE3 isolate human faeces plasmid pGE3, complete sequence 101019-101050 9 0.719
NZ_CP047881_2 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517774-3517805 32 NZ_CP050647 Escherichia coli strain PapM-36-2 plasmid pIncFIB, complete sequence 101888-101919 9 0.719
NZ_CP047881_2 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517774-3517805 32 CP025897 Escherichia coli strain 500465 plasmid p500465_152, complete sequence 63594-63625 9 0.719
NZ_CP047881_2 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517774-3517805 32 NZ_CP010126 Escherichia coli strain C8 plasmid A, complete genome 65388-65419 9 0.719
NZ_CP047881_2 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517774-3517805 32 NZ_CP031323 Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_2, complete sequence 27432-27463 9 0.719
NZ_CP047881_2 2.32|3516336|32|NZ_CP047881|PILER-CR 3516336-3516367 32 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 341970-342001 9 0.719
NZ_CP047881_2 2.32|3516336|32|NZ_CP047881|PILER-CR 3516336-3516367 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 321406-321437 9 0.719
NZ_CP047881_2 2.33|3516496|32|NZ_CP047881|PILER-CR,CRT 3516496-3516527 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1282116-1282147 9 0.719
NZ_CP047881_2 2.33|3516496|32|NZ_CP047881|PILER-CR,CRT 3516496-3516527 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 983836-983867 9 0.719
NZ_CP047881_2 2.33|3516496|32|NZ_CP047881|PILER-CR,CRT 3516496-3516527 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1282272-1282303 9 0.719
NZ_CP047881_3 3.9|3534939|33|NZ_CP047881|CRISPRCasFinder,CRT 3534939-3534971 33 NZ_CP030128 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence 337150-337182 9 0.727
NZ_CP047881_3 3.16|3535367|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535367-3535398 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 760675-760706 9 0.719
NZ_CP047881_3 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535428-3535459 32 NZ_CP044073 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed2, complete sequence 88620-88651 9 0.719
NZ_CP047881_3 3.22|3535733|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535733-3535764 32 NC_049851 Burkholderia phage BcepSauron, complete genome 40328-40359 9 0.719
NZ_CP047881_3 3.22|3535733|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535733-3535764 32 NC_049850 Burkholderia phage BcepSaruman, complete genome 39621-39652 9 0.719
NZ_CP047881_3 3.26|3535977|33|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535977-3536009 33 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 991009-991041 9 0.727
NZ_CP047881_2 2.1|3516273|32|NZ_CP047881|CRISPRCasFinder 3516273-3516304 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
NZ_CP047881_2 2.1|3516273|32|NZ_CP047881|CRISPRCasFinder 3516273-3516304 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
NZ_CP047881_2 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder 3516334-3516365 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 774630-774661 10 0.688
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP018080 Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence 170081-170112 10 0.688
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 NZ_CP020568 Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence 149487-149518 10 0.688
NZ_CP047881_2 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517164-3517195 32 MH727593 Acidovorax phage ACPWH, complete genome 37920-37951 10 0.688
NZ_CP047881_2 2.17|3517286|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517286-3517317 32 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 84615-84646 10 0.688
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 MG962370 Mycobacterium phage Kykar, complete genome 13914-13945 10 0.688
NZ_CP047881_2 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517347-3517378 32 MK359312 Mycobacterium phage Fushigi, complete genome 14740-14771 10 0.688
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 91265-91296 10 0.688
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 NZ_LT969519 Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1 116070-116101 10 0.688
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 200841-200872 10 0.688
NZ_CP047881_2 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517530-3517561 32 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 478203-478234 10 0.688
NZ_CP047881_2 2.31|3516275|32|NZ_CP047881|PILER-CR 3516275-3516306 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
NZ_CP047881_2 2.31|3516275|32|NZ_CP047881|PILER-CR 3516275-3516306 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
NZ_CP047881_2 2.32|3516336|32|NZ_CP047881|PILER-CR 3516336-3516367 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 774630-774661 10 0.688
NZ_CP047881_3 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT 3534451-3534482 32 NC_011246 Borrelia recurrentis A1 plasmid pl124, complete sequence 78355-78386 10 0.688
NZ_CP047881_3 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT 3534451-3534482 32 NZ_CP053971 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence 72031-72062 10 0.688
NZ_CP047881_3 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT 3534451-3534482 32 NZ_CP013278 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence 3413-3444 10 0.688
NZ_CP047881_3 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT 3534451-3534482 32 NC_018509 Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence 232722-232753 10 0.688
NZ_CP047881_3 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT 3534451-3534482 32 NZ_CP039724 Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence 129890-129921 10 0.688
NZ_CP047881_3 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT 3534451-3534482 32 NZ_CP051859 Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence 109941-109972 10 0.688
NZ_CP047881_3 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT 3534451-3534482 32 NZ_CP009347 Bacillus thuringiensis HD1002 plasmid 3, complete sequence 148697-148728 10 0.688
NZ_CP047881_3 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT 3534451-3534482 32 NZ_CP045025 Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence 3413-3444 10 0.688
NZ_CP047881_3 3.6|3534756|32|NZ_CP047881|CRISPRCasFinder,CRT 3534756-3534787 32 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 613341-613372 10 0.688
NZ_CP047881_3 3.16|3535367|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535367-3535398 32 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 102029-102060 10 0.688
NZ_CP047881_3 3.16|3535367|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535367-3535398 32 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 251833-251864 10 0.688
NZ_CP047881_3 3.16|3535367|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535367-3535398 32 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 286129-286160 10 0.688
NZ_CP047881_3 3.16|3535367|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR 3535367-3535398 32 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 442068-442099 10 0.688
NZ_CP047881_2 2.9|3516801|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3516801-3516832 32 MH729874 Klebsiella phage KP179, complete genome 150763-150794 11 0.656
NZ_CP047881_2 2.26|3517835|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT 3517835-3517866 32 KU963249 Gordonia phage Yeezy, complete genome 46010-46041 11 0.656
NZ_CP047881_3 3.14|3535245|32|NZ_CP047881|CRISPRCasFinder,CRT 3535245-3535276 32 NC_010683 Ralstonia pickettii 12J plasmid pRPIC01, complete sequence 22365-22396 11 0.656

1. spacer 3.14|3535245|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NZ_CP039495 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669_2, complete sequence) position: , mismatch: 0, identity: 1.0

tgcgtctttttcccgctggagttgaatattct	CRISPR spacer
tgcgtctttttcccgctggagttgaatattct	Protospacer
********************************

2. spacer 3.14|3535245|32|NZ_CP047881|CRISPRCasFinder,CRT matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 0, identity: 1.0

tgcgtctttttcccgctggagttgaatattct	CRISPR spacer
tgcgtctttttcccgctggagttgaatattct	Protospacer
********************************

3. spacer 3.14|3535245|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NC_042346 (Salmonella virus BTP1 genome assembly, chromosome: BTP1) position: , mismatch: 0, identity: 1.0

tgcgtctttttcccgctggagttgaatattct	CRISPR spacer
tgcgtctttttcccgctggagttgaatattct	Protospacer
********************************

4. spacer 3.14|3535245|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NZ_KP763470 (Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence) position: , mismatch: 1, identity: 0.969

tgcgtctttttcccgctggagttgaatattct	CRISPR spacer
tgcgtctttttcccgctggagttgagtattct	Protospacer
*************************.******

5. spacer 3.14|3535245|32|NZ_CP047881|CRISPRCasFinder,CRT matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 1, identity: 0.969

tgcgtctttttcccgctggagttgaatattct	CRISPR spacer
tgcgtctttttcccgctggagttgaagattct	Protospacer
************************** *****

6. spacer 2.8|3516740|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to CP053410 (Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

tgctgccagcgtgaaatataattctgcaatct	CRISPR spacer
cgctgccagtgtgaaatataattctgcaagct	Protospacer
.********.******************* **

7. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to MN098327 (Klebsiella phage Mulock, complete genome) position: , mismatch: 5, identity: 0.833

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
accttcaaacccgcgccattgctgggctcg	Protospacer
  ******* ****************.*.*

8. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 5, identity: 0.833

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
accttcaaacccgcgccattgctgggctcg	Protospacer
  ******* ****************.*.*

9. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 5, identity: 0.833

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
accttcaaacccgcgccattgctgggctcg	Protospacer
  ******* ****************.*.*

10. spacer 3.10|3535001|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NZ_LN554848 (Aliivibrio wodanis genome assembly AWOD1, plasmid : pAWOD920) position: , mismatch: 5, identity: 0.844

tccgttgtgataacttcccacattgatgatcc-	CRISPR spacer
tccgtagtaataacttcccaca-taataatccc	Protospacer
***** **.************* *.**.**** 

11. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NZ_CP047230 (Moraxella osloensis strain YV1 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.8

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
cagttcaaagccgcgccattactgggctag	Protospacer
.. *****************.*****.* *

12. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to MK448230 (Klebsiella phage ST16-OXA48phi5.2, complete genome) position: , mismatch: 6, identity: 0.8

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
accttcaaacccgcgccattgctggactcg	Protospacer
  ******* ***************..*.*

13. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NC_008771 (Verminephrobacter eiseniae EF01-2 plasmid pVEIS01, complete sequence) position: , mismatch: 6, identity: 0.8

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
ggccgaaaagccgcgccaatgctgggtttc	Protospacer
 **.  ************ ********** 

14. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NZ_KX364409 (Aeromonas salmonicida subsp. salmonicida strain M16474-11 plasmid pAsa8, complete sequence) position: , mismatch: 6, identity: 0.8

----tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
gcgatgc----aagccgcgccgttgctgggtttt	Protospacer
    ***    **********.*********** 

15. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 6, identity: 0.8

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
agcctacaggccgcgccattactgggtttg	Protospacer
 **.*  *.***********.*********

16. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 6, identity: 0.8

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
agcctacaggccgcgccattactgggtttg	Protospacer
 **.*  *.***********.*********

17. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NZ_CP045061 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence) position: , mismatch: 6, identity: 0.8

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
agcctacaggccgcgccattactgggtttg	Protospacer
 **.*  *.***********.*********

18. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NZ_CP045054 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence) position: , mismatch: 6, identity: 0.8

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
agcctacaggccgcgccattactgggtttg	Protospacer
 **.*  *.***********.*********

19. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NZ_CP045058 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence) position: , mismatch: 6, identity: 0.8

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
agcctacaggccgcgccattactgggtttg	Protospacer
 **.*  *.***********.*********

20. spacer 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder matches to NZ_CP033726 (Clavibacter michiganensis subsp. michiganensis strain UF1 plasmid pCM2U-F1, complete sequence) position: , mismatch: 6, identity: 0.812

accgacagccaggtgacgaacgccaccaacga--	CRISPR spacer
accgacagccaggtcaagaacgcggcc--cgact	Protospacer
************** * ****** .**  ***  

21. spacer 2.11|3516923|29|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 6, identity: 0.793

caaccccgccgccgcctgtatttaacaag	CRISPR spacer
caaccgcgccgtcgcctgtatttctctcg	Protospacer
***** *****.***********  *  *

22. spacer 2.11|3516923|29|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to AP013537 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G6, isolate: uvMED-CGR-C59A-MedDCM-OCT-S34-C49) position: , mismatch: 6, identity: 0.793

caaccccgccgccgcctgtatttaacaag	CRISPR spacer
caccaccgccgccgcctgtatttgcgatg	Protospacer
** * ******************.  * *

23. spacer 2.11|3516923|29|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to AP014007 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C59A-MedDCM-OCT-S29-C45, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.793

caaccccgccgccgcctgtatttaacaag	CRISPR spacer
caccaccgccgccgcctgtatttgcgatg	Protospacer
** * ******************.  * *

24. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_KT307967 (Yersinia pseudotuberculosis strain IP2666 plasmid pYV2666, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

25. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_010157 (Yersinia pestis Angola plasmid new_pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

26. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_006153 (Yersinia pseudotuberculosis IP 32953 plasmid pYV, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

27. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_005813 (Yersinia pestis biovar Microtus str. 91001 plasmid pCD1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

28. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP009491 (Yersinia pestis strain PBM19 plasmid pCD1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

29. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_010635 (Yersinia pseudotuberculosis PB1/+ plasmid pYPTS01, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

30. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP009758 (Yersinia pseudotuberculosis strain EP2/+ plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

31. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP009779 (Yersinia pseudotuberculosis PB1/+ plasmid pYAB, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

32. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP009711 (Yersinia pseudotuberculosis IP 32953 strain IP32953 plasmid pYAC_1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

33. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP009713 (Yersinia pestis Pestoides F plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

34. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP009703 (Yersinia pestis strain Harbin35 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

35. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP009783 (Yersinia pestis strain El Dorado plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

36. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP009721 (Yersinia pestis strain Shasta plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

37. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP045260 (Yersinia pestis strain SCPM-O-B-5942 (I-2638) plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

38. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP033695 (Yersinia pestis strain FDAARGOS_602 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

39. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_009377 (Yersinia pestis Pestoides F plasmid CD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

40. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_014017 (Yersinia pestis Z176003 plasmid pCD1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

41. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_017263 (Yersinia pestis biovar Medievalis str. Harbin 35 plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

42. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP033697 (Yersinia pestis strain FDAARGOS_601 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

43. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP033712 (Yersinia pseudotuberculosis strain FDAARGOS_581 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

44. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP033714 (Yersinia pseudotuberculosis strain FDAARGOS_580 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

45. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP032567 (Yersinia pseudotuberculosis strain IP2666pIB1 plasmid pIB1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

46. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP033708 (Yersinia pseudotuberculosis strain FDAARGOS_583 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

47. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP045147 (Yersinia pestis strain SCPM-O-B-6899 (231) plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

48. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP045156 (Yersinia pestis strain SCPM-O-B-5935 (I-1996) plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

49. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP045160 (Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

50. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP006747 (Yersinia pestis 8787 plasmid pCD1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

51. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP009972 (Yersinia pestis CO92 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

52. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_003131 (Yersinia pestis CO92 plasmid pCD1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

53. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP045151 (Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

54. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP006791 (Yersinia pestis 2944 plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

55. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP006750 (Yersinia pestis 3770 plasmid pCD1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

56. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP006757 (Yersinia pestis 1522 plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

57. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_LT596222 (Yersinia pseudotuberculosis isolate NZYP4713 plasmid 2) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

58. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP033710 (Yersinia pseudotuberculosis strain FDAARGOS_582 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

59. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_017157 (Yersinia pestis D182038 plasmid pCD1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

60. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_017153 (Yersinia pestis D106004 plasmid pCD1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

61. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP033716 (Yersinia pseudotuberculosis strain FDAARGOS_579 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

62. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_004839 (Yersinia pestis strain KIM5 plasmid pCD1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

63. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP033689 (Yersinia pestis strain FDAARGOS_603 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

64. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP006761 (Yersinia pestis 1413 plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

65. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP006780 (Yersinia pestis 1412 plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

66. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP006753 (Yersinia pestis 3067 plasmid pCD1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

67. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP016274 (Yersinia pestis strain Cadman plasmid pCD1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

68. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP019710 (Yersinia pestis strain 195/P plasmid pCD1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

69. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP009905 (Yersinia pestis Antiqua plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

70. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP009990 (Yersinia pestis strain Nicholisk 41 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

71. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP009937 (Yersinia pestis Angola plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

72. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP009842 (Yersinia pestis strain Dodson plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

73. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP010069 (Yersinia pseudotuberculosis str. PA3606 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

74. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP010246 (Yersinia pestis Pestoides G plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

75. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP010022 (Yersinia pestis str. Pestoides B plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

76. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_015056 (Yersinia pestis Java 9 plasmid pCD, complete sequence) position: , mismatch: 6, identity: 0.812

--gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
cggcag--caccatctcgacgcctggcaatagag	Protospacer
  ****   .********** **.**********

77. spacer 2.20|3517469|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 6, identity: 0.812

gctcacgcggcctttttattttgctactgtat-	CRISPR spacer
gctcacgcggccttttttctttgc-gctatttg	Protospacer
***************** .***** .**.* * 

78. spacer 2.32|3516336|32|NZ_CP047881|PILER-CR matches to NZ_CP033726 (Clavibacter michiganensis subsp. michiganensis strain UF1 plasmid pCM2U-F1, complete sequence) position: , mismatch: 6, identity: 0.812

accgacagccaggtgacgaacgccaccaacga--	CRISPR spacer
accgacagccaggtcaagaacgcggcc--cgact	Protospacer
************** * ****** .**  ***  

79. spacer 3.19|3535550|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.812

tgatgctggccaacaggagcgcccgcgggagc-	CRISPR spacer
tgatgctggccagcaggatcg-ccacggtcgcg	Protospacer
************.***** ** **.***  ** 

80. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NZ_CP011866 (Enterobacter asburiae strain ATCC 35953 plasmid unnamed 3, complete sequence) position: , mismatch: 7, identity: 0.767

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
gggctacaagccgcgccattgctggatttc	Protospacer
 * .*  ******************.*** 

81. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NZ_CP011866 (Enterobacter asburiae strain ATCC 35953 plasmid unnamed 3, complete sequence) position: , mismatch: 7, identity: 0.767

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
gggctacaagccgcgccattgctggatttc	Protospacer
 * .*  ******************.*** 

82. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NZ_CP011866 (Enterobacter asburiae strain ATCC 35953 plasmid unnamed 3, complete sequence) position: , mismatch: 7, identity: 0.767

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
gggctacaagccgcgccattgctggatttc	Protospacer
 * .*  ******************.*** 

83. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NC_019298 (Rahnella sp. WMR121 plasmid pHW121, complete sequence) position: , mismatch: 7, identity: 0.767

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
gggctacaagccgcgccattgctggatttc	Protospacer
 * .*  ******************.*** 

84. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NC_011667 (Thauera sp. MZ1T plasmid pTha01, complete sequence) position: , mismatch: 7, identity: 0.767

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
cggcgcaaagccgcgccgttgctgggggtg	Protospacer
.* . ************.********  **

85. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NC_012209 (Yersinia enterocolitica plasmid pYe4449-2, complete sequence) position: , mismatch: 7, identity: 0.767

tgcttca-aagccgcgccattgctgggtttg	CRISPR spacer
-acgccgtaagccgcgccattactggttttg	Protospacer
 .* .*. *************.**** ****

86. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 7, identity: 0.781

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctg	Protospacer
******.*.************** *  ..***

87. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctg	Protospacer
******.*.************** *  ..***

88. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctg	Protospacer
******.*.************** *  ..***

89. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctg	Protospacer
******.*.************** *  ..***

90. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctg	Protospacer
******.*.************** *  ..***

91. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctg	Protospacer
******.*.************** *  ..***

92. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
gtcggcggtcatctcgacccccgccaaggcag	Protospacer
*. *****.************** *** . **

93. spacer 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 7, identity: 0.781

ttgatgaaagttcatctaataatgatt-gtgct	CRISPR spacer
ttgatgcaagttcatctaaaaatctttcgtaa-	Protospacer
****** ************ ***  ** **.  

94. spacer 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 7, identity: 0.781

ttgatgaaagttcatctaataatgatt-gtgct	CRISPR spacer
ttgatgcaagttcatctaaaaatctttcgtaa-	Protospacer
****** ************ ***  ** **.  

95. spacer 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT matches to AP014010 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C97-MedDCM-OCT-S27-C11, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.781

ttgatga--aagttcatctaataatgattgtgct	CRISPR spacer
--catcaccaagttcatctaataattcttgtgtt	Protospacer
   ** *  ****************  *****.*

96. spacer 3.3|3534573|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NZ_CP014690 (Gluconobacter albidus strain TMW2.1191 plasmid pGS1191_1, complete sequence) position: , mismatch: 7, identity: 0.781

accaccctgtccgacagtctggataaatatcg	CRISPR spacer
ccgaccctgccggacagtctggataagcagcg	Protospacer
 * ******.* **************..* **

97. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044974 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B4) plasmid pPBL-H3_B4-2, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

98. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053984 (Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

99. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

100. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026268 (Aminobacter sp. MSH1 plasmid pBAM1, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

101. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NC_010935 (Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

102. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NC_017908 (Mycobacterium abscessus subsp. bolletii F1725 plasmid BRA100, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

103. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

104. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to JX469834 (Uncultured bacterium plasmid pDS3, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

105. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

106. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

107. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044977 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-2, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

108. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to JN106171 (Uncultured bacterium plasmid pAKD26, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

109. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

110. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

111. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

112. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

113. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

114. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

115. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

116. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044551 (Hydrogenophaga sp. BPS33 plasmid pBPS33-2, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

117. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NC_016968 (Comamonas testosteroni plasmid pTB30, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

118. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NC_016978 (Comamonas testosteroni plasmid pI2, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

119. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017760 (Cupriavidus necator strain NH9 plasmid pENH91, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

120. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053554 (Diaphorobacter sp. JS3050 plasmid pDCNB, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

121. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to KF743817 (Proteus mirabilis plasmid R772, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

122. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to KF743818 (Bordetella bronchiseptica plasmid R906, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

123. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

124. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NC_019263 (Delftia acidovorans plasmid pLME1, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

125. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NC_019264 (Delftia acidovorans plasmid pNB8c, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

126. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NC_019283 (Delftia acidovorans plasmid pC1-1, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

127. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

128. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

129. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

130. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

131. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594677 (Variovorax sp. PBS-H4 plasmid 3) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

132. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NC_006830 (Achromobacter xylosoxidans A8 plasmid pA81, complete sequence) position: , mismatch: 7, identity: 0.781

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
ccgtccacctcgatctccaggcggtcggccag	Protospacer
**. *******.*.*************..* *

133. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NZ_CP038104 (Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa9-like, complete sequence) position: , mismatch: 8, identity: 0.733

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
ttgcgcaaagccgcgccgttgctgggaata	Protospacer
*  . ************.********  *.

134. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NZ_KY555070 (Aeromonas salmonicida subsp. salmonicida strain 01-B526 plasmid pAsa9, complete sequence) position: , mismatch: 8, identity: 0.733

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
ttgcgcaaagccgcgccgttgctgggaata	Protospacer
*  . ************.********  *.

135. spacer 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder matches to NZ_CP015231 (Epibacterium mobile F1926 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
tcggacatccaggtgacaaacgccaccatttc	Protospacer
 * **** *********.********** .  

136. spacer 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder matches to NC_021304 (Streptomyces phage Sujidade, complete genome) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
acggacagccaggcgacgaacgccagaagaac	Protospacer
** **********.***********  *. . 

137. spacer 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder matches to MG663585 (Streptomyces phage ToriToki, complete genome) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
atgaacaccaaggtgacgaacgccaccaagct	Protospacer
*. .*** * *******************   

138. spacer 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder matches to MK112550 (Streptomyces phage Olicious, complete genome) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
atgaacaccaaggtgacgaacgccaccaagct	Protospacer
*. .*** * *******************   

139. spacer 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder matches to MG663582 (Streptomyces phage HaugeAnator, complete genome) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
atgaacaccaaggtgacgaacgccaccaagct	Protospacer
*. .*** * *******************   

140. spacer 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder matches to MG663586 (Streptomyces phage ZooBear, complete genome) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
atgaacaccaaggtgacgaacgccaccaagct	Protospacer
*. .*** * *******************   

141. spacer 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder matches to NC_048686 (Streptomyces phage Immanuel3, complete genome) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
atgaacaccaaggtgacgaacgccaccaagct	Protospacer
*. .*** * *******************   

142. spacer 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder matches to MG663584 (Streptomyces phage Romero, complete genome) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
atgaacaccaaggtgacgaacgccaccaagct	Protospacer
*. .*** * *******************   

143. spacer 2.6|3516618|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 8, identity: 0.75

tgttgctgccattgcggcgcagccctgccaag	CRISPR spacer
cattgccgccaatgcggcgcagcccatcacag	Protospacer
..****.**** *************  *  **

144. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 8, identity: 0.75

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgccaccagcgcggctggcctgggccgt	Protospacer
***********.*.**********    **  

145. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctc	Protospacer
******.*.************** *  ..** 

146. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctc	Protospacer
******.*.************** *  ..** 

147. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 8, identity: 0.75

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctc	Protospacer
******.*.************** *  ..** 

148. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctc	Protospacer
******.*.************** *  ..** 

149. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 8, identity: 0.75

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctc	Protospacer
******.*.************** *  ..** 

150. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctc	Protospacer
******.*.************** *  ..** 

151. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctc	Protospacer
******.*.************** *  ..** 

152. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctc	Protospacer
******.*.************** *  ..** 

153. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctc	Protospacer
******.*.************** *  ..** 

154. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctc	Protospacer
******.*.************** *  ..** 

155. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctc	Protospacer
******.*.************** *  ..** 

156. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gcaccgtcgccggtgcggctggcggagctctc	Protospacer
******.*.************** *  ..** 

157. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.75

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gggcaggggccggtgcggctggccttcgcctg	Protospacer
* .* *  .*************** ** ****

158. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to KC292024 (Halovirus HHTV-2, complete genome) position: , mismatch: 8, identity: 0.75

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
acctcccacccggagaggctggccgtctcctg	Protospacer
.* .* *  **** * ****************

159. spacer 2.32|3516336|32|NZ_CP047881|PILER-CR matches to NZ_CP015231 (Epibacterium mobile F1926 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
tcggacatccaggtgacaaacgccaccatttc	Protospacer
 * **** *********.********** .  

160. spacer 2.32|3516336|32|NZ_CP047881|PILER-CR matches to NC_021304 (Streptomyces phage Sujidade, complete genome) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
acggacagccaggcgacgaacgccagaagaac	Protospacer
** **********.***********  *. . 

161. spacer 2.32|3516336|32|NZ_CP047881|PILER-CR matches to MG663585 (Streptomyces phage ToriToki, complete genome) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
atgaacaccaaggtgacgaacgccaccaagct	Protospacer
*. .*** * *******************   

162. spacer 2.32|3516336|32|NZ_CP047881|PILER-CR matches to MK112550 (Streptomyces phage Olicious, complete genome) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
atgaacaccaaggtgacgaacgccaccaagct	Protospacer
*. .*** * *******************   

163. spacer 2.32|3516336|32|NZ_CP047881|PILER-CR matches to MG663582 (Streptomyces phage HaugeAnator, complete genome) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
atgaacaccaaggtgacgaacgccaccaagct	Protospacer
*. .*** * *******************   

164. spacer 2.32|3516336|32|NZ_CP047881|PILER-CR matches to MG663586 (Streptomyces phage ZooBear, complete genome) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
atgaacaccaaggtgacgaacgccaccaagct	Protospacer
*. .*** * *******************   

165. spacer 2.32|3516336|32|NZ_CP047881|PILER-CR matches to NC_048686 (Streptomyces phage Immanuel3, complete genome) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
atgaacaccaaggtgacgaacgccaccaagct	Protospacer
*. .*** * *******************   

166. spacer 2.32|3516336|32|NZ_CP047881|PILER-CR matches to MG663584 (Streptomyces phage Romero, complete genome) position: , mismatch: 8, identity: 0.75

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
atgaacaccaaggtgacgaacgccaccaagct	Protospacer
*. .*** * *******************   

167. spacer 3.12|3535123|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NZ_CP042333 (Bosea sp. F3-2 plasmid pB32-2, complete sequence) position: , mismatch: 8, identity: 0.75

caaaagcgaggtttccagcgagctaaaaccgg--	CRISPR spacer
caaaaccgaggattccagcgagc--ggccctgct	Protospacer
***** ***** ***********  .. ** *  

168. spacer 3.16|3535367|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 8, identity: 0.75

gcccgcccacggcgatcagaatcaatccacgc	CRISPR spacer
gcccgcccacgtcgatcagcatcaccatgccc	Protospacer
*********** ******* **** . ..* *

169. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040989 (Vibrio furnissii strain FDAARGOS_777 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
gcaatcacctcaacgtccaggcggtggcatag	Protospacer
 ***.********* ********** *  . *

170. spacer 3.19|3535550|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 8, identity: 0.75

tgatgctggccaacaggagcgcccgcgggagc	CRISPR spacer
tcgcgctggccaacaagagcgctcgcgtcatc	Protospacer
* ..***********.******.****  * *

171. spacer 3.22|3535733|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028919 (Gemmobacter sp. HYN0069 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gccagcggcgcagggttcgcgtcaatgctgga	CRISPR spacer
cgcagcggcgcagggatcgcggcaaggtcggc	Protospacer
  ************* ***** *** *..** 

172. spacer 1.1|3039183|30|NZ_CP047881|CRISPRCasFinder matches to NZ_CP014310 (Burkholderia sp. PAMC 26561 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7

tgcttcaaagccgcgccattgctgggtttg	CRISPR spacer
gtcttctaagccgcgccattgctcacacgg	Protospacer
  **** **************** .  . *

173. spacer 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 9, identity: 0.719

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
ttggacagccaggtgaccaacaccacctcccg	Protospacer
 . ************** ***.*****  * .

174. spacer 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 9, identity: 0.719

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
ggcgcggcccatgtgacggacgccaccaacgc	Protospacer
. **  . *** ******.************ 

175. spacer 2.9|3516801|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to LR877331 (Klebsiella phage vB_KpnM_311F genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.719

atttcgtacccgtcttcattaatccaatcctg	CRISPR spacer
tcccagtacccgtctttatcaatccaatgcag	Protospacer
 ... ***********.**.******** * *

176. spacer 2.9|3516801|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to MN434095 (Klebsiella pneumoniae phage JIPh_Kp122, complete genome) position: , mismatch: 9, identity: 0.719

atttcgtacccgtcttcattaatccaatcctg	CRISPR spacer
tcccagtacccgtctttatcaatccaatgcag	Protospacer
 ... ***********.**.******** * *

177. spacer 2.9|3516801|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to KY000080 (Klebsiella phage KPV15, complete genome) position: , mismatch: 9, identity: 0.719

atttcgtacccgtcttcattaatccaatcctg	CRISPR spacer
tcccagtacccgtctttatcaatccaatgcag	Protospacer
 ... ***********.**.******** * *

178. spacer 2.9|3516801|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_028686 (Klebsiella phage JD18, complete genome) position: , mismatch: 9, identity: 0.719

atttcgtacccgtcttcattaatccaatcctg	CRISPR spacer
tcccagtacccgtctttatcaatccaatgcag	Protospacer
 ... ***********.**.******** * *

179. spacer 2.9|3516801|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to MK421971 (Klebsiella phage vB_KpnM_GF, partial genome) position: , mismatch: 9, identity: 0.719

atttcgtacccgtcttcattaatccaatcctg	CRISPR spacer
tcccagtacccgtctttatcaatccaatgcag	Protospacer
 ... ***********.**.******** * *

180. spacer 2.13|3517042|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to AP014927 (Ralstonia phage RSF1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

gacggtggaaatcgctattgtccgcgagatgt	CRISPR spacer
tccggtggaaatcgctgttggccgcgcatcga	Protospacer
  **************.*** ***** . .* 

181. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP044424 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence) position: , mismatch: 9, identity: 0.719

gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
gcgggcggccatctcgtcccccggcgccccgt	Protospacer
**.************* ********. .  . 

182. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to KT381276 (Mycobacterium phage Serenity, complete genome) position: , mismatch: 9, identity: 0.719

gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
gtaggcggtcatctcgaccaccggcagcgtgt	Protospacer
*.******.********** ******... . 

183. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 9, identity: 0.719

gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
gcaggcggccatctcggcctccgtgggccggg	Protospacer
****************.**.***  ... *.*

184. spacer 2.19|3517408|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP047261 (Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326F, complete sequence) position: , mismatch: 9, identity: 0.719

acggcggtgaaaactcgggcaaaacggcattg	CRISPR spacer
ttgtggtcgaaaacccgggcaaaaccgcattt	Protospacer
 .*  * .******.********** ***** 

185. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 9, identity: 0.719

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacaggtacgcatcgaggaatatccc	Protospacer
 ...******************* *** * . 

186. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 9, identity: 0.719

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacaggtacgcatcgaggaatatccc	Protospacer
 ...******************* *** * . 

187. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 9, identity: 0.719

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacaggtacgcatcgaggaatatccc	Protospacer
 ...******************* *** * . 

188. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 9, identity: 0.719

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacaggtacgcatcgaggaatatccc	Protospacer
 ...******************* *** * . 

189. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 9, identity: 0.719

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacaggtacgcatcgaggaatatccc	Protospacer
 ...******************* *** * . 

190. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 9, identity: 0.719

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacaggtacgcatcgaggaatatccc	Protospacer
 ...******************* *** * . 

191. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 9, identity: 0.719

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacaggtacgcatcgaggaatatccc	Protospacer
 ...******************* *** * . 

192. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 9, identity: 0.719

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacaggtacgcatcgaggaatatccc	Protospacer
 ...******************* *** * . 

193. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 9, identity: 0.719

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacaggtacgcatcgaggaatatccc	Protospacer
 ...******************* *** * . 

194. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacaggtacgcatcgaggaatatccc	Protospacer
 ...******************* *** * . 

195. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP040126 (Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence) position: , mismatch: 9, identity: 0.719

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacaggtacgcatcgaggaatatccc	Protospacer
 ...******************* *** * . 

196. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 9, identity: 0.719

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacaggtacgcatcgaggaatatccc	Protospacer
 ...******************* *** * . 

197. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 9, identity: 0.719

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacaggtacgcatcgaggaatatccc	Protospacer
 ...******************* *** * . 

198. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 9, identity: 0.719

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacaggtacgcatcgaggaatatccc	Protospacer
 ...******************* *** * . 

199. spacer 2.22|3517591|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

gattttgttcgctacgtcgccagccatgccaa	CRISPR spacer
gtccgggagcgcgacgtcgccagccacgccaa	Protospacer
* ..  *  *** *************.*****

200. spacer 2.22|3517591|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719

gattttgttcgctacgtcgccagccatgccaa	CRISPR spacer
gtccgggagcgcgacgtcgccagccacgccaa	Protospacer
* ..  *  *** *************.*****

201. spacer 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP025882 (Escherichia coli strain 503440 plasmid p503440_52, complete sequence) position: , mismatch: 9, identity: 0.719

ctgcaattcgcgttctctggcctgtttcgcca	CRISPR spacer
atcaaattcaccttctctggcctgtttttcac	Protospacer
 *  *****.* ***************. *  

202. spacer 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP025895 (Escherichia coli strain 503025 plasmid p503025_52, complete sequence) position: , mismatch: 9, identity: 0.719

ctgcaattcgcgttctctggcctgtttcgcca	CRISPR spacer
atcaaattcaccttctctggcctgtttttcac	Protospacer
 *  *****.* ***************. *  

203. spacer 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP025867 (Escherichia coli strain 504211 plasmid p504211_50, complete sequence) position: , mismatch: 9, identity: 0.719

ctgcaattcgcgttctctggcctgtttcgcca	CRISPR spacer
atcaaattcaccttctctggcctgtttttcac	Protospacer
 *  *****.* ***************. *  

204. spacer 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP025980 (Escherichia marmotae strain HT073016 plasmid pEM148, complete sequence) position: , mismatch: 9, identity: 0.719

ctgcaattcgcgttctctggcctgtttcgcca	CRISPR spacer
atcaaattcaccttctctggcctgtttttcac	Protospacer
 *  *****.* ***************. *  

205. spacer 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP025871 (Escherichia coli strain 503829 plasmid p503829_52, complete sequence) position: , mismatch: 9, identity: 0.719

ctgcaattcgcgttctctggcctgtttcgcca	CRISPR spacer
atcaaattcaccttctctggcctgtttttcac	Protospacer
 *  *****.* ***************. *  

206. spacer 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP054369 (Escherichia coli strain SCU-115 plasmid pSCU-115-1, complete sequence) position: , mismatch: 9, identity: 0.719

ctgcaattcgcgttctctggcctgtttcgcca	CRISPR spacer
atcaaattcaccttctctggcctgtttttcac	Protospacer
 *  *****.* ***************. *  

207. spacer 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP006000 (Escherichia coli B7A plasmid pEB2, complete sequence) position: , mismatch: 9, identity: 0.719

ctgcaattcgcgttctctggcctgtttcgcca	CRISPR spacer
atcaaattcaccttctctggcctgtttttcac	Protospacer
 *  *****.* ***************. *  

208. spacer 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP012377 (Escherichia coli strain GE3 isolate human faeces plasmid pGE3, complete sequence) position: , mismatch: 9, identity: 0.719

ctgcaattcgcgttctctggcctgtttcgcca	CRISPR spacer
atcaaattcaccttctctggcctgtttttcac	Protospacer
 *  *****.* ***************. *  

209. spacer 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP050647 (Escherichia coli strain PapM-36-2 plasmid pIncFIB, complete sequence) position: , mismatch: 9, identity: 0.719

ctgcaattcgcgttctctggcctgtttcgcca	CRISPR spacer
atcaaattcaccttctctggcctgtttttcac	Protospacer
 *  *****.* ***************. *  

210. spacer 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to CP025897 (Escherichia coli strain 500465 plasmid p500465_152, complete sequence) position: , mismatch: 9, identity: 0.719

ctgcaattcgcgttctctggcctgtttcgcca	CRISPR spacer
atcaaattcaccttctctggcctgtttttcac	Protospacer
 *  *****.* ***************. *  

211. spacer 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP010126 (Escherichia coli strain C8 plasmid A, complete genome) position: , mismatch: 9, identity: 0.719

ctgcaattcgcgttctctggcctgtttcgcca	CRISPR spacer
atcaaattcaccttctctggcctgtttttcac	Protospacer
 *  *****.* ***************. *  

212. spacer 2.25|3517774|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP031323 (Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_2, complete sequence) position: , mismatch: 9, identity: 0.719

ctgcaattcgcgttctctggcctgtttcgcca	CRISPR spacer
atcaaattcaccttctctggcctgtttttcac	Protospacer
 *  *****.* ***************. *  

213. spacer 2.32|3516336|32|NZ_CP047881|PILER-CR matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 9, identity: 0.719

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
ttggacagccaggtgaccaacaccacctcccg	Protospacer
 . ************** ***.*****  * .

214. spacer 2.32|3516336|32|NZ_CP047881|PILER-CR matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 9, identity: 0.719

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
ggcgcggcccatgtgacggacgccaccaacgc	Protospacer
. **  . *** ******.************ 

215. spacer 2.33|3516496|32|NZ_CP047881|PILER-CR,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tggggttacctgcactccagtcccggcaggta	CRISPR spacer
ccggccggcctgcacttcagtccgggcaggtg	Protospacer
. ** . .********.****** *******.

216. spacer 2.33|3516496|32|NZ_CP047881|PILER-CR,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719

tggggttacctgcactccagtcccggcaggta	CRISPR spacer
ccggccggcctgcacttcagtccgggcaggtg	Protospacer
. ** . .********.****** *******.

217. spacer 2.33|3516496|32|NZ_CP047881|PILER-CR,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

tggggttacctgcactccagtcccggcaggta	CRISPR spacer
ccggccggcctgcacttcagtccgggcaggtg	Protospacer
. ** . .********.****** *******.

218. spacer 3.9|3534939|33|NZ_CP047881|CRISPRCasFinder,CRT matches to NZ_CP030128 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727

acaaaatccttgcattccagacgctgaatttcg	CRISPR spacer
aaggtactgttgcattcccgacgctgtatttcg	Protospacer
* .. *.. ********* ******* ******

219. spacer 3.16|3535367|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

gcccgcccacggcgatcagaatcaatccacgc	CRISPR spacer
gcccgcgcacggcgatcggaatcttgcgggcc	Protospacer
****** **********.*****   * .  *

220. spacer 3.17|3535428|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044073 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ccaaccacctcaacctccaggcggtcgatctg	CRISPR spacer
tcgtcttgctcagcctccaggcgggcgatctc	Protospacer
.*. *.  ****.*********** ****** 

221. spacer 3.22|3535733|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NC_049851 (Burkholderia phage BcepSauron, complete genome) position: , mismatch: 9, identity: 0.719

gccagcggcgcagggttcgcgtcaatgctgga	CRISPR spacer
gccagcgacgcagtgttcgcgtcggcagagca	Protospacer
*******.***** *********....  * *

222. spacer 3.22|3535733|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NC_049850 (Burkholderia phage BcepSaruman, complete genome) position: , mismatch: 9, identity: 0.719

gccagcggcgcagggttcgcgtcaatgctgga	CRISPR spacer
gccagcgacgcagtgttcgcgtcggcagagca	Protospacer
*******.***** *********....  * *

223. spacer 3.26|3535977|33|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.727

gcacggacactccggtaaagcgctggtgtacga	CRISPR spacer
gccgatgacctccggtaaagcgccggtgttcga	Protospacer
**  . .  **************.***** ***

224. spacer 2.1|3516273|32|NZ_CP047881|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****  

225. spacer 2.1|3516273|32|NZ_CP047881|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****  

226. spacer 2.2|3516334|32|NZ_CP047881|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
cacgacagccaggggacggacgccatgagatt	Protospacer
  *********** ****.******. *.   

227. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP018080 (Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
ctgacgccgccggtggggctggccgtctatgc	Protospacer
 .. ****.****** ************ .  

228. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
gtgccgccgccggtgcggcgggccgttcgacc	Protospacer
*..*****.********** ******..  . 

229. spacer 2.15|3517164|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to MH727593 (Acidovorax phage ACPWH, complete genome) position: , mismatch: 10, identity: 0.688

gcaccgccaccggtgcggctggccgtctcctg	CRISPR spacer
acaccgccaacggtgcggccggccccgccgac	Protospacer
.******** *********.**** . .*   

230. spacer 2.17|3517286|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 10, identity: 0.688

gtcgttaccattgcgtcataggcgcggatcac	CRISPR spacer
tttccggtgatggcatcataggcgcggatcac	Protospacer
 *. . .. ** **.*****************

231. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to MG962370 (Mycobacterium phage Kykar, complete genome) position: , mismatch: 10, identity: 0.688

gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
gtaggcggtcatctcgaccaccggctgcgtga	Protospacer
*.******.********** ***** ... ..

232. spacer 2.18|3517347|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to MK359312 (Mycobacterium phage Fushigi, complete genome) position: , mismatch: 10, identity: 0.688

gcaggcggccatctcgacccccggcaatagag	CRISPR spacer
gtaggcggtcatctcgaccaccggctgcgtga	Protospacer
*.******.********** ***** ... ..

233. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 10, identity: 0.688

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacgggtacgcatcgaggaatatccc	Protospacer
 ...*****.************* *** * . 

234. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 10, identity: 0.688

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacgggtacgcatcgaggaatatccc	Protospacer
 ...*****.************* *** * . 

235. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 10, identity: 0.688

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacgggtacgcatcgaggaatatccc	Protospacer
 ...*****.************* *** * . 

236. spacer 2.21|3517530|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 10, identity: 0.688

agatttcacaggtacgcatcgagtaatttatg	CRISPR spacer
cagcttcacgggtacgcatcgaggaatatccc	Protospacer
 ...*****.************* *** * . 

237. spacer 2.31|3516275|32|NZ_CP047881|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****  

238. spacer 2.31|3516275|32|NZ_CP047881|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****  

239. spacer 2.32|3516336|32|NZ_CP047881|PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688

accgacagccaggtgacgaacgccaccaacga	CRISPR spacer
cacgacagccaggggacggacgccatgagatt	Protospacer
  *********** ****.******. *.   

240. spacer 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NC_011246 (Borrelia recurrentis A1 plasmid pl124, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
ttgttgaaaattcatctaataatgccataaga	Protospacer
*** *****.************** .   .  

241. spacer 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NZ_CP053971 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

242. spacer 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NZ_CP013278 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

243. spacer 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NC_018509 (Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

244. spacer 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NZ_CP039724 (Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

245. spacer 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NZ_CP051859 (Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

246. spacer 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NZ_CP009347 (Bacillus thuringiensis HD1002 plasmid 3, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

247. spacer 3.1|3534451|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NZ_CP045025 (Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatgaaagttcatctaataatgattgtgct	CRISPR spacer
aaaagaaaagttcatctaataatgcatgttgg	Protospacer
  .* .******************  ***   

248. spacer 3.6|3534756|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ccagcgtggcgggattttgccgaacagggcat	CRISPR spacer
ctgctccggcgggattgtgccggacagggcca	Protospacer
*.. . .********* *****.*******  

249. spacer 3.16|3535367|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

gcccgcccacggcgatcagaatcaatccacgc	CRISPR spacer
ccccgcccccggcgaccagaatcagcgtcagg	Protospacer
 ******* ******.********.. .  * 

250. spacer 3.16|3535367|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 10, identity: 0.688

gcccgcccacggcgatcagaatcaatccacgc	CRISPR spacer
ccccgcccccggcgaccagaatcagcgtcagg	Protospacer
 ******* ******.********.. .  * 

251. spacer 3.16|3535367|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688

gcccgcccacggcgatcagaatcaatccacgc	CRISPR spacer
ccccgcccccggcgaccagaatcagcgtcagg	Protospacer
 ******* ******.********.. .  * 

252. spacer 3.16|3535367|32|NZ_CP047881|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 10, identity: 0.688

gcccgcccacggcgatcagaatcaatccacgc	CRISPR spacer
ccccgcccccggcgaccagaatcagcgtcagg	Protospacer
 ******* ******.********.. .  * 

253. spacer 2.9|3516801|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to MH729874 (Klebsiella phage KP179, complete genome) position: , mismatch: 11, identity: 0.656

atttcgtacccgtcttcattaatccaatcctg	CRISPR spacer
tcccagtacccgtctttatcaatccaatgtaa	Protospacer
 ... ***********.**.******** . .

254. spacer 2.26|3517835|32|NZ_CP047881|CRISPRCasFinder,PILER-CR,CRT matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 11, identity: 0.656

gctgacatggaaaccgtcgccggcaattgggc	CRISPR spacer
atctgtgcagaaaccgtccccggcaattgcgc	Protospacer
... .....********* ********** **

255. spacer 3.14|3535245|32|NZ_CP047881|CRISPRCasFinder,CRT matches to NC_010683 (Ralstonia pickettii 12J plasmid pRPIC01, complete sequence) position: , mismatch: 11, identity: 0.656

tgcgtctttttcccgctggagttgaatattct	CRISPR spacer
cccgcctttttcacgctggagttgagcgacga	Protospacer
. **.******* ************... .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 27791 34 Escherichia_phage(69.7%) lysis,plate,terminase,portal,holin,capsid,head,tail NA
DBSCAN-SWA_2 40292 : 41828 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_3 52662 : 57273 5 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_4 80606 : 81269 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_5 98531 : 100376 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_6 109112 : 112206 3 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_7 116326 : 126777 4 Chrysochromulina_ericina_virus(33.33%) NA NA
DBSCAN-SWA_8 135194 : 136957 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_9 142441 : 144031 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_10 158159 : 161843 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_11 170275 : 188179 22 Burkholderia_phage(42.11%) plate,tail NA
DBSCAN-SWA_12 200719 : 201829 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_13 209087 : 209696 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_14 216430 : 218957 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_15 223052 : 226656 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_16 249186 : 251253 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_17 256138 : 257488 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_18 263700 : 265659 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_19 275353 : 283713 8 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_20 301883 : 306387 4 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_21 324959 : 326943 2 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_22 332011 : 332545 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_23 336272 : 337250 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_24 344974 : 345520 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_25 350302 : 353491 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_26 359036 : 363456 3 Pithovirus(50.0%) NA NA
DBSCAN-SWA_27 368319 : 369483 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_28 404694 : 406450 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_29 413121 : 413580 1 Saccharomonospora_phage(100.0%) transposase NA
DBSCAN-SWA_30 442125 : 445465 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_31 449131 : 455680 7 Enterobacteria_phage(33.33%) transposase NA
DBSCAN-SWA_32 467786 : 472733 3 Klosneuvirus(50.0%) tRNA NA
DBSCAN-SWA_33 480544 : 485507 3 Acanthamoeba_polyphaga_mimivirus(50.0%) NA NA
DBSCAN-SWA_34 506916 : 612281 116 Shigella_phage(42.37%) integrase,plate,terminase,transposase,tRNA,protease,holin,portal,capsid,head,tail attL 518347:518375|attR 590622:590650
DBSCAN-SWA_35 619969 : 632272 12 Cyanophage(20.0%) NA NA
DBSCAN-SWA_36 648001 : 649495 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_37 652753 : 653920 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_38 660418 : 663253 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_39 682437 : 683586 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_40 689123 : 694763 4 Hepacivirus(50.0%) NA NA
DBSCAN-SWA_41 702524 : 704414 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_42 707540 : 708964 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_43 716693 : 722125 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_44 729900 : 730608 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_45 738974 : 740546 1 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_46 772587 : 773631 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_47 777888 : 778452 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_48 789539 : 790964 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_49 802302 : 812012 9 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_50 822781 : 824200 1 unidentified_phage(100.0%) NA NA
DBSCAN-SWA_51 827216 : 829691 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_52 834884 : 835682 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_53 849072 : 849417 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_54 853400 : 854828 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_55 868264 : 869023 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_56 877834 : 881937 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_57 895924 : 896956 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_58 903974 : 904778 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_59 908829 : 913040 5 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_60 920099 : 922739 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_61 942812 : 947555 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_62 974957 : 975536 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_63 978750 : 979890 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_64 984663 : 988994 4 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_65 997438 : 997711 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_66 1010255 : 1010780 1 Shigella_phage(100.0%) NA NA
DBSCAN-SWA_67 1018427 : 1028138 6 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_68 1041556 : 1043443 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_69 1057947 : 1059060 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_70 1062752 : 1072671 7 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_71 1080642 : 1092036 14 uncultured_Mediterranean_phage(50.0%) tRNA,transposase NA
DBSCAN-SWA_72 1101573 : 1102683 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_73 1123759 : 1128927 4 Agrobacterium_phage(25.0%) protease NA
DBSCAN-SWA_74 1132220 : 1132916 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_75 1137315 : 1140862 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_76 1160906 : 1169685 8 Klosneuvirus(25.0%) NA NA
DBSCAN-SWA_77 1178785 : 1184004 5 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_78 1187279 : 1187966 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_79 1192819 : 1193836 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_80 1198307 : 1200098 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_81 1207539 : 1208688 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_82 1219960 : 1224394 6 Moumouvirus(50.0%) tRNA NA
DBSCAN-SWA_83 1236126 : 1237412 2 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_84 1241766 : 1246937 6 Salmonella_phage(66.67%) NA NA
DBSCAN-SWA_85 1263146 : 1269265 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_86 1283736 : 1285562 2 uncultured_marine_virus(50.0%) NA NA
DBSCAN-SWA_87 1288938 : 1295486 6 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_88 1310598 : 1312128 3 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_89 1316083 : 1318568 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_90 1326795 : 1329378 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_91 1340203 : 1345006 4 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_92 1350906 : 1351992 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_93 1356608 : 1358273 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_94 1362927 : 1373140 7 Vibrio_phage(25.0%) tRNA NA
DBSCAN-SWA_95 1384223 : 1384901 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_96 1388171 : 1395604 6 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_97 1399119 : 1399911 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_98 1426142 : 1429666 4 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_99 1433391 : 1434660 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_100 1440329 : 1441106 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_101 1445414 : 1453032 8 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_102 1461489 : 1464918 3 Catovirus(50.0%) NA NA
DBSCAN-SWA_103 1471779 : 1475077 2 Phage_Gifsy-2(50.0%) NA NA
DBSCAN-SWA_104 1486792 : 1497423 9 Anomala_cuprea_entomopoxvirus(20.0%) transposase NA
DBSCAN-SWA_105 1500888 : 1506198 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_106 1511184 : 1517748 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_107 1522069 : 1523941 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_108 1539466 : 1541472 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_109 1549043 : 1558210 10 Vibrio_phage(25.0%) NA NA
DBSCAN-SWA_110 1565021 : 1567773 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_111 1571362 : 1573081 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_112 1579866 : 1587179 7 Dickeya_phage(16.67%) protease,integrase attL 1581117:1581131|attR 1592371:1592385
DBSCAN-SWA_113 1591794 : 1608542 10 Bacillus_phage(25.0%) tRNA NA
DBSCAN-SWA_114 1612835 : 1617537 3 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_115 1621633 : 1622722 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_116 1627778 : 1632342 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_117 1647285 : 1654359 6 Enterobacteria_phage(50.0%) tRNA,transposase NA
DBSCAN-SWA_118 1659780 : 1662393 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_119 1667644 : 1669552 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_120 1682073 : 1684128 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_121 1689907 : 1691866 2 uncultured_Caudovirales_phage(50.0%) protease NA
DBSCAN-SWA_122 1699276 : 1699957 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_123 1713318 : 1715560 3 Phage_258-320(50.0%) NA NA
DBSCAN-SWA_124 1721845 : 1722013 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_125 1729957 : 1733581 3 Cronobacter_phage(33.33%) NA NA
DBSCAN-SWA_126 1743287 : 1744121 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_127 1748275 : 1748815 1 Scale_drop_disease_virus(100.0%) NA NA
DBSCAN-SWA_128 1757878 : 1758799 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_129 1763458 : 1763704 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_130 1779714 : 1780665 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_131 1793166 : 1794293 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_132 1797567 : 1798209 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_133 1811367 : 1811625 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_134 1817810 : 1821536 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_135 1825122 : 1827106 2 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_136 1833426 : 1834797 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_137 1838324 : 1839575 1 Phage_21(100.0%) NA NA
DBSCAN-SWA_138 1843409 : 1846751 5 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_139 1851377 : 1851908 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_140 1856456 : 1857254 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_141 1872219 : 1875640 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_142 1885048 : 1885705 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_143 1890590 : 1892540 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_144 1896127 : 1897354 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_145 1904052 : 1904880 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_146 1911047 : 1913300 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_147 1923431 : 1943060 19 Tupanvirus(22.22%) tRNA NA
DBSCAN-SWA_148 1965573 : 1968783 3 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_149 1986639 : 1990978 3 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_150 2014931 : 2022355 8 Orpheovirus(20.0%) NA NA
DBSCAN-SWA_151 2027430 : 2027952 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_152 2034867 : 2036142 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_153 2061333 : 2065756 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_154 2083473 : 2102756 19 Escherichia_phage(40.0%) NA NA
DBSCAN-SWA_155 2112042 : 2112426 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_156 2121363 : 2122482 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_157 2141509 : 2141794 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_158 2164257 : 2165268 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_159 2171636 : 2172719 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_160 2180881 : 2182426 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_161 2190361 : 2192482 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_162 2210106 : 2212071 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_163 2228181 : 2235271 5 Megavirus(33.33%) NA NA
DBSCAN-SWA_164 2241810 : 2242542 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_165 2246302 : 2251716 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_166 2256508 : 2257498 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_167 2262610 : 2270640 8 Morganella_phage(20.0%) tRNA NA
DBSCAN-SWA_168 2280856 : 2281714 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_169 2285264 : 2286134 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_170 2304622 : 2305429 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_171 2310807 : 2314986 2 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_172 2320570 : 2321161 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_173 2326254 : 2331593 4 Tupanvirus(33.33%) protease NA
DBSCAN-SWA_174 2336574 : 2339532 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_175 2351197 : 2354090 3 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_176 2362459 : 2368867 7 Serratia_phage(33.33%) NA NA
DBSCAN-SWA_177 2373171 : 2374707 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_178 2385046 : 2390704 7 Mythimna_unipuncta_granulovirus(33.33%) NA NA
DBSCAN-SWA_179 2394051 : 2396809 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_180 2433497 : 2440810 7 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_181 2444780 : 2446340 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_182 2453827 : 2454037 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_183 2459414 : 2461463 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_184 2468969 : 2476502 10 Enterobacteria_phage(40.0%) integrase,transposase attL 2466203:2466217|attR 2484693:2484707
DBSCAN-SWA_185 2481760 : 2490053 12 Salmonella_phage(28.57%) integrase,tail attL 2483837:2483851|attR 2494110:2494124
DBSCAN-SWA_186 2497950 : 2499426 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_187 2503363 : 2511353 10 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_188 2515374 : 2521934 7 Escherichia_coli_phage(33.33%) tRNA NA
DBSCAN-SWA_189 2529886 : 2534028 4 Bacillus_thuringiensis_phage(66.67%) NA NA
DBSCAN-SWA_190 2549179 : 2549845 1 Sphingomonas_phage(100.0%) NA NA
DBSCAN-SWA_191 2558108 : 2558861 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_192 2586520 : 2605393 19 Burkholderia_phage(16.67%) protease NA
DBSCAN-SWA_193 2617102 : 2617918 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_194 2631430 : 2632225 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_195 2652123 : 2657050 4 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_196 2665713 : 2666613 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_197 2674056 : 2681619 5 Paramecium_bursaria_Chlorella_virus(25.0%) NA NA
DBSCAN-SWA_198 2686257 : 2688732 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_199 2694289 : 2700995 6 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_200 2706170 : 2715470 7 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_201 2725918 : 2732530 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_202 2736954 : 2739813 2 Phage_TP(50.0%) tRNA NA
DBSCAN-SWA_203 2756763 : 2765934 10 Enterobacteria_phage(71.43%) tRNA NA
DBSCAN-SWA_204 2791988 : 2793509 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_205 2797461 : 2798130 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_206 2803569 : 2805561 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_207 2809677 : 2810535 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_208 2820675 : 2821248 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_209 2827172 : 2842295 13 Vibrio_phage(33.33%) tail NA
DBSCAN-SWA_210 2850628 : 2851246 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_211 2858349 : 2864167 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_212 2868334 : 2875547 3 Hokovirus(33.33%) NA NA
DBSCAN-SWA_213 2878987 : 2886188 6 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_214 2895777 : 2896983 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_215 2900630 : 2905639 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_216 2918206 : 2919208 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_217 2940746 : 2944017 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_218 2954825 : 2955845 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_219 2959573 : 2960347 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_220 2971776 : 2973294 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_221 2977903 : 3051769 98 Salmonella_phage(66.22%) integrase,lysis,tRNA,terminase,protease,portal,capsid,head,tail attL 2976486:2976501|attR 3016272:3016287
DBSCAN-SWA_222 3059335 : 3060256 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_223 3081545 : 3091395 9 Lactobacillus_phage(25.0%) NA NA
DBSCAN-SWA_224 3096707 : 3106308 11 Streptococcus_phage(20.0%) NA NA
DBSCAN-SWA_225 3125758 : 3126709 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_226 3145332 : 3146046 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_227 3149384 : 3150524 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_228 3156106 : 3161381 6 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_229 3167843 : 3168035 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_230 3171325 : 3180616 3 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_231 3206945 : 3212194 5 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_232 3222998 : 3232950 12 Mycoplasma_phage(16.67%) tRNA NA
DBSCAN-SWA_233 3240369 : 3241623 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_234 3248838 : 3258685 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_235 3267269 : 3275115 9 Lactobacillus_phage(25.0%) NA NA
DBSCAN-SWA_236 3280955 : 3287126 7 uncultured_Mediterranean_phage(25.0%) tRNA NA
DBSCAN-SWA_237 3292427 : 3294288 2 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_238 3300164 : 3302738 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_239 3309523 : 3312765 3 Escherichia_coli_O157_typing_phage(50.0%) NA NA
DBSCAN-SWA_240 3324474 : 3324957 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_241 3338519 : 3351465 12 Enterobacteria_phage(75.0%) integrase attL 3339860:3339875|attR 3346682:3346697
DBSCAN-SWA_242 3354804 : 3360921 3 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_243 3381292 : 3385296 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_244 3391994 : 3397049 4 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_245 3408885 : 3416139 6 Acanthocystis_turfacea_Chlorella_virus(20.0%) tRNA NA
DBSCAN-SWA_246 3422045 : 3423011 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_247 3446927 : 3447749 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_248 3481243 : 3482932 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_249 3488417 : 3492492 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_250 3498458 : 3508872 12 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_251 3511982 : 3514014 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_252 3536334 : 3540160 3 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_253 3544947 : 3550243 3 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_254 3557660 : 3558509 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_255 3563375 : 3564191 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_256 3575734 : 3592313 10 environmental_halophage(16.67%) tRNA NA
DBSCAN-SWA_257 3597795 : 3604750 6 Cronobacter_phage(33.33%) NA NA
DBSCAN-SWA_258 3615580 : 3618111 2 Aichi_virus(50.0%) NA NA
DBSCAN-SWA_259 3632898 : 3633435 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_260 3643974 : 3653647 9 uncultured_Caudovirales_phage(14.29%) integrase,tRNA attL 3636812:3636824|attR 3659493:3659505
DBSCAN-SWA_261 3657631 : 3663335 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_262 3671603 : 3672836 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_263 3684012 : 3684669 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_264 3692420 : 3693893 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_265 3699722 : 3700877 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_266 3718185 : 3719271 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_267 3761266 : 3762145 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_268 3765543 : 3767016 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_269 3782441 : 3787581 6 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_270 3793523 : 3799228 5 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_271 3805066 : 3808766 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_272 3812081 : 3813974 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_273 3818374 : 3820215 2 Erwinia_phage(50.0%) NA NA
DBSCAN-SWA_274 3826014 : 3827940 2 Enterobacteria_phage(50.0%) transposase NA
DBSCAN-SWA_275 3831991 : 3833425 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_276 3838653 : 3855519 14 Sinorhizobium_phage(14.29%) tRNA NA
DBSCAN-SWA_277 3861709 : 3862678 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_278 3875863 : 3878158 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_279 3884521 : 3885667 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_280 3896354 : 3903003 9 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_281 3908781 : 3910671 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_282 3916206 : 3922863 4 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_283 3926333 : 3929221 2 Pandoravirus(50.0%) protease NA
DBSCAN-SWA_284 3937154 : 3938645 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_285 3942754 : 3957661 17 Staphylococcus_phage(28.57%) NA NA
DBSCAN-SWA_286 3964428 : 3965532 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_287 3970322 : 3974357 4 Burkholderia_virus(50.0%) protease NA
DBSCAN-SWA_288 3979224 : 3980592 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_289 3987590 : 3988859 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_290 4007311 : 4008355 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_291 4020439 : 4023821 3 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_292 4037693 : 4042013 6 Pandoravirus(33.33%) tRNA NA
DBSCAN-SWA_293 4061906 : 4067477 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_294 4073436 : 4075344 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_295 4079876 : 4083873 3 environmental_Halophage(50.0%) NA NA
DBSCAN-SWA_296 4101589 : 4102426 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_297 4119466 : 4123229 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_298 4129841 : 4130756 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_299 4136813 : 4139207 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_300 4155040 : 4157488 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_301 4179110 : 4180918 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_302 4184328 : 4186528 4 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_303 4192319 : 4203982 12 Dickeya_phage(28.57%) NA NA
DBSCAN-SWA_304 4210573 : 4213315 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_305 4221559 : 4223602 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_306 4238319 : 4239219 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_307 4265832 : 4270654 5 Saccharomonospora_phage(33.33%) transposase NA
DBSCAN-SWA_308 4288970 : 4295301 6 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_309 4300014 : 4300557 1 Macacine_betaherpesvirus(100.0%) transposase NA
DBSCAN-SWA_310 4304506 : 4305502 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_311 4331943 : 4333794 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_312 4359301 : 4368802 9 Rhizobium_phage(16.67%) NA NA
DBSCAN-SWA_313 4383179 : 4387733 7 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_314 4393711 : 4398737 4 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_315 4402986 : 4404378 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_316 4412719 : 4415587 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_317 4419434 : 4425469 4 Paramecium_bursaria_Chlorella_virus(33.33%) transposase NA
DBSCAN-SWA_318 4433836 : 4435219 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_319 4453799 : 4458756 5 Micromonas_pusilla_virus(50.0%) NA NA
DBSCAN-SWA_320 4467259 : 4468210 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_321 4475808 : 4487023 8 Brazilian_cedratvirus(25.0%) NA NA
DBSCAN-SWA_322 4493004 : 4502795 9 Oenococcus_phage(25.0%) NA NA
DBSCAN-SWA_323 4509789 : 4516681 7 Moraxella_phage(33.33%) NA NA
DBSCAN-SWA_324 4521090 : 4524479 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_325 4537363 : 4538356 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_326 4541649 : 4545668 3 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_327 4561065 : 4562712 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_328 4568071 : 4568413 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_329 4571854 : 4577257 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_330 4581391 : 4587552 6 Enterobacteria_phage(40.0%) NA NA
DBSCAN-SWA_331 4604989 : 4608906 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_332 4613782 : 4615612 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_333 4629831 : 4633266 4 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_334 4644193 : 4644808 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_335 4657301 : 4660088 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_336 4665445 : 4666495 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_337 4684934 : 4687730 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_338 4691660 : 4692590 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_339 4695929 : 4698980 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_340 4717717 : 4725696 13 Salmonella_phage(40.0%) integrase attL 4715072:4715084|attR 4723944:4723956
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP047882
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 83077 : 160236 42 Enterobacteria_phage(11.76%) integrase,transposase attL 148980:148994|attR 166076:166090
DBSCAN-SWA_2 233413 : 268702 45 Sodalis_phage(13.33%) integrase,transposase attL 263542:263601|attR 270051:270721
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage