Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP044459 Acinetobacter indicus strain B18 plasmid pB18-4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP044456 Acinetobacter indicus strain B18 plasmid pB18-1, complete sequence 1 crisprs csf2gr7 0 1 0 0
NZ_CP044455 Acinetobacter indicus strain B18 chromosome, complete genome 4 crisprs c2c9_V-U4,cas14j,csa3,cas3,WYL,DEDDh,TnsE_C 3 27 13 0
NZ_CP044460 Acinetobacter indicus strain B18 plasmid pB18-5, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 1 crisprs cas3-cas2,cas8f,cas5f,cas7f,cas6f 0 28 0 0
NZ_CP044457 Acinetobacter indicus strain B18 plasmid pB18-2, complete sequence 0 crisprs DEDDh,RT,WYL 0 0 1 0
NZ_CP044462 Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP044461 Acinetobacter indicus strain B18 plasmid pB18-6, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP044456
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044456_1 246442-246534 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044456_1 1.1|246466|45|NZ_CP044456|CRISPRCasFinder 246466-246510 45 NZ_CP044456 Acinetobacter indicus strain B18 plasmid pB18-1, complete sequence 246466-246510 0 1.0
NZ_CP044456_1 1.1|246466|45|NZ_CP044456|CRISPRCasFinder 246466-246510 45 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 69930-69974 0 1.0

1. spacer 1.1|246466|45|NZ_CP044456|CRISPRCasFinder matches to NZ_CP044456 (Acinetobacter indicus strain B18 plasmid pB18-1, complete sequence) position: , mismatch: 0, identity: 1.0

caacaatggcggtcaaggcggtggctttggtggcggttatggtaa	CRISPR spacer
caacaatggcggtcaaggcggtggctttggtggcggttatggtaa	Protospacer
*********************************************

2. spacer 1.1|246466|45|NZ_CP044456|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

caacaatggcggtcaaggcggtggctttggtggcggttatggtaa	CRISPR spacer
caacaatggcggtcaaggcggtggctttggtggcggttatggtaa	Protospacer
*********************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP044455
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044455_1 334618-334892 Unclear NA
3 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044455_2 1138237-1144620 Orphan NA
81 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044455_3 1756167-1756310 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044455_4 2258528-2258611 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP044455_2 2.50|1142833|30|NZ_CP044455|CRT 1142833-1142862 30 NZ_CP044455.1 1138231-1138260 2 0.933
NZ_CP044455_2 2.53|1143001|30|NZ_CP044455|CRT 1143001-1143030 30 NZ_CP044455.1 1138231-1138260 2 0.933
NZ_CP044455_2 2.54|1143049|30|NZ_CP044455|CRT 1143049-1143078 30 NZ_CP044455.1 1138231-1138260 2 0.933

1. spacer 2.50|1142833|30|NZ_CP044455|CRT matches to position: 1138231-1138260, mismatch: 2, identity: 0.933

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactctgactctgatagcgacagcga	Protospacer
*******************  *********

2. spacer 2.53|1143001|30|NZ_CP044455|CRT matches to position: 1138231-1138260, mismatch: 2, identity: 0.933

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactctgactctgatagcgacagcga	Protospacer
*******************  *********

3. spacer 2.54|1143049|30|NZ_CP044455|CRT matches to position: 1138231-1138260, mismatch: 2, identity: 0.933

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactctgactctgatagcgacagcga	Protospacer
*******************  *********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154685-154708 1 0.958
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154703-154726 1 0.958
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154901-154924 1 0.958
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155099-155122 1 0.958
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155333-155356 1 0.958
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2168-2191 1 0.958
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1316-1339 1 0.958
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19037-19060 1 0.958
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18521-18544 1 0.958
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1316-1339 1 0.958
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19037-19060 1 0.958
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18521-18544 1 0.958
NZ_CP044455_2 2.31|1141663|24|NZ_CP044455|CRT 1141663-1141686 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16169-16192 2 0.917
NZ_CP044455_2 2.31|1141663|24|NZ_CP044455|CRT 1141663-1141686 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16187-16210 2 0.917
NZ_CP044455_2 2.31|1141663|24|NZ_CP044455|CRT 1141663-1141686 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16301-16324 2 0.917
NZ_CP044455_2 2.31|1141663|24|NZ_CP044455|CRT 1141663-1141686 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16319-16342 2 0.917
NZ_CP044455_2 2.31|1141663|24|NZ_CP044455|CRT 1141663-1141686 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16433-16456 2 0.917
NZ_CP044455_2 2.31|1141663|24|NZ_CP044455|CRT 1141663-1141686 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17111-17134 2 0.917
NZ_CP044455_2 2.31|1141663|24|NZ_CP044455|CRT 1141663-1141686 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19763-19786 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151550-151573 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151586-151609 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154061-154084 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156809-156832 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156977-157000 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151622-151645 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151862-151885 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151988-152011 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153191-153214 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153311-153334 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154721-154744 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154757-154780 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154919-154942 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155117-155140 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155153-155176 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155351-155374 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155387-155410 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155867-155890 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155921-155944 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156395-156418 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 47-70 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 65-88 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1310-1333 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1328-1351 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1832-1855 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2294-2317 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2654-2677 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2708-2731 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2912-2935 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3188-3211 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 11-34 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 29-52 2 0.917
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19043-19066 2 0.917
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2984-3013 2 0.933
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1304-1333 2 0.933
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1358-1387 2 0.933
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1808-1837 2 0.933
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3446-3475 2 0.933
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151670-151699 2 0.933
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154301-154330 2 0.933
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157331-157360 2 0.933
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1034-1063 2 0.933
NZ_CP044455_2 2.37|1141975|24|NZ_CP044455|CRT 1141975-1141998 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153839-153862 2 0.917
NZ_CP044455_2 2.37|1141975|24|NZ_CP044455|CRT 1141975-1141998 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156113-156136 2 0.917
NZ_CP044455_2 2.37|1141975|24|NZ_CP044455|CRT 1141975-1141998 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156587-156610 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 53-76 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1370-1393 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1424-1447 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1682-1705 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1820-1843 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2000-2023 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2174-2197 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2300-2323 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2582-2605 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2714-2737 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2864-2887 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2900-2923 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2918-2941 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3422-3445 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16601-16624 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16667-16690 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16913-16936 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17027-17050 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18269-18292 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19841-19864 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20057-20080 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154313-154336 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154691-154714 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154709-154732 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154763-154786 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154907-154930 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155105-155128 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155159-155182 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155213-155236 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155339-155362 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155393-155416 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 17-40 2 0.917
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1046-1069 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19967-19990 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16139-16162 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16271-16294 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16403-16426 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16529-16552 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16715-16738 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17081-17104 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17207-17230 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17429-17452 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17483-17506 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17549-17572 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17711-17734 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18011-18034 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18209-18232 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18395-18418 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18473-18496 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18743-18766 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18797-18820 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18953-18976 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19115-19138 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19193-19216 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19493-19516 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19691-19714 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155693-155716 2 0.917
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156155-156178 2 0.917
NZ_CP044455_2 2.50|1142833|30|NZ_CP044455|CRT 1142833-1142862 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151267-151296 2 0.933
NZ_CP044455_2 2.50|1142833|30|NZ_CP044455|CRT 1142833-1142862 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3578-3607 2 0.933
NZ_CP044455_2 2.53|1143001|30|NZ_CP044455|CRT 1143001-1143030 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151267-151296 2 0.933
NZ_CP044455_2 2.53|1143001|30|NZ_CP044455|CRT 1143001-1143030 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3578-3607 2 0.933
NZ_CP044455_2 2.54|1143049|30|NZ_CP044455|CRT 1143049-1143078 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151267-151296 2 0.933
NZ_CP044455_2 2.54|1143049|30|NZ_CP044455|CRT 1143049-1143078 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3578-3607 2 0.933
NZ_CP044455_2 2.58|1143271|30|NZ_CP044455|CRT 1143271-1143300 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18515-18544 2 0.933
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151261-151290 2 0.933
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19835-19858 2 0.917
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19883-19906 2 0.917
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19835-19858 2 0.917
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19883-19906 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 53-76 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1370-1393 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1424-1447 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1682-1705 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1820-1843 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2000-2023 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2174-2197 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2300-2323 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2582-2605 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2714-2737 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2864-2887 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2900-2923 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2918-2941 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3422-3445 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16601-16624 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16667-16690 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16913-16936 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17027-17050 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18269-18292 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19841-19864 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20057-20080 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154313-154336 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154691-154714 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154709-154732 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154763-154786 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154907-154930 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155105-155128 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155159-155182 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155213-155236 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155339-155362 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155393-155416 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 17-40 2 0.917
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1046-1069 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19967-19990 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16139-16162 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16271-16294 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16403-16426 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16529-16552 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16715-16738 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17081-17104 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17207-17230 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17429-17452 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17483-17506 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17549-17572 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17711-17734 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18011-18034 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18209-18232 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18395-18418 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18473-18496 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18743-18766 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18797-18820 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18953-18976 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19115-19138 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19193-19216 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19493-19516 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19691-19714 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155693-155716 2 0.917
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156155-156178 2 0.917
NZ_CP044455_2 2.31|1141663|24|NZ_CP044455|CRT 1141663-1141686 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17345-17368 3 0.875
NZ_CP044455_2 2.31|1141663|24|NZ_CP044455|CRT 1141663-1141686 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18623-18646 3 0.875
NZ_CP044455_2 2.31|1141663|24|NZ_CP044455|CRT 1141663-1141686 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18659-18682 3 0.875
NZ_CP044455_2 2.31|1141663|24|NZ_CP044455|CRT 1141663-1141686 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19973-19996 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151406-151429 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151514-151537 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153275-153298 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153293-153316 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153527-153550 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153635-153658 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153755-153778 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153773-153796 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153893-153916 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153953-153976 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154775-154798 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155045-155068 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155171-155194 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155225-155248 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155279-155302 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155405-155428 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156047-156070 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156203-156226 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156755-156778 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156905-156928 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156941-156964 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157283-157306 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157319-157342 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157607-157630 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1220-1243 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1346-1369 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1418-1441 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1796-1819 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2222-2245 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2390-2413 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2576-2599 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2822-2845 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2990-3013 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3590-3613 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3782-3805 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1058-1081 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16091-16114 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16223-16246 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16355-16378 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16631-16654 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16763-16786 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16805-16828 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16943-16966 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17033-17056 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17381-17404 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17597-17620 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17639-17662 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17759-17782 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17801-17824 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18257-18280 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18299-18322 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18599-18622 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18695-18718 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18845-18868 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18887-18910 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19241-19264 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19283-19306 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19739-19762 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19799-19822 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19973-19996 3 0.875
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20045-20068 3 0.875
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1106-1135 3 0.9
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1412-1441 3 0.9
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2570-2599 3 0.9
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3272-3301 3 0.9
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3776-3805 3 0.9
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2480-2509 3 0.9
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157097-157126 3 0.9
NZ_CP044455_2 2.37|1141975|24|NZ_CP044455|CRT 1141975-1141998 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156167-156190 3 0.875
NZ_CP044455_2 2.37|1141975|24|NZ_CP044455|CRT 1141975-1141998 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19043-19066 3 0.875
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 17-40 3 0.875
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1478-1501 3 0.875
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1802-1825 3 0.875
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2996-3019 3 0.875
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3458-3481 3 0.875
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151285-151308 3 0.875
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151628-151651 3 0.875
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151682-151705 3 0.875
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153317-153340 3 0.875
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155477-155500 3 0.875
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156257-156280 3 0.875
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156401-156424 3 0.875
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157343-157366 3 0.875
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1100-1123 3 0.875
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152030-152053 3 0.875
NZ_CP044455_2 2.40|1142125|24|NZ_CP044455|CRT 1142125-1142148 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155783-155806 3 0.875
NZ_CP044455_2 2.58|1143271|30|NZ_CP044455|CRT 1143271-1143300 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16133-16162 3 0.9
NZ_CP044455_2 2.58|1143271|30|NZ_CP044455|CRT 1143271-1143300 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16265-16294 3 0.9
NZ_CP044455_2 2.58|1143271|30|NZ_CP044455|CRT 1143271-1143300 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16397-16426 3 0.9
NZ_CP044455_2 2.58|1143271|30|NZ_CP044455|CRT 1143271-1143300 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16709-16738 3 0.9
NZ_CP044455_2 2.58|1143271|30|NZ_CP044455|CRT 1143271-1143300 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17075-17104 3 0.9
NZ_CP044455_2 2.58|1143271|30|NZ_CP044455|CRT 1143271-1143300 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17423-17452 3 0.9
NZ_CP044455_2 2.58|1143271|30|NZ_CP044455|CRT 1143271-1143300 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17543-17572 3 0.9
NZ_CP044455_2 2.58|1143271|30|NZ_CP044455|CRT 1143271-1143300 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17705-17734 3 0.9
NZ_CP044455_2 2.58|1143271|30|NZ_CP044455|CRT 1143271-1143300 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18737-18766 3 0.9
NZ_CP044455_2 2.58|1143271|30|NZ_CP044455|CRT 1143271-1143300 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18947-18976 3 0.9
NZ_CP044455_2 2.58|1143271|30|NZ_CP044455|CRT 1143271-1143300 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19187-19216 3 0.9
NZ_CP044455_2 2.58|1143271|30|NZ_CP044455|CRT 1143271-1143300 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19961-19990 3 0.9
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1316-1345 3 0.9
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16847-16870 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17273-17296 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18407-18430 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18917-18940 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19031-19054 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19127-19150 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19853-19876 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16127-16150 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16259-16282 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16391-16414 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17069-17092 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17327-17350 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17417-17440 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17699-17722 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18569-18592 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18731-18754 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19181-19204 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20009-20032 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151267-151290 3 0.875
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3578-3601 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16847-16870 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17273-17296 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18407-18430 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18917-18940 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19031-19054 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19127-19150 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19853-19876 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16127-16150 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16259-16282 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16391-16414 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17069-17092 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17327-17350 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17417-17440 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17699-17722 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18569-18592 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18731-18754 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19181-19204 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20009-20032 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151267-151290 3 0.875
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3578-3601 3 0.875
NZ_CP044455_2 2.74|1144207|30|NZ_CP044455|CRT 1144207-1144236 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16553-16582 3 0.9
NZ_CP044455_2 2.74|1144207|30|NZ_CP044455|CRT 1144207-1144236 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17231-17260 3 0.9
NZ_CP044455_2 2.74|1144207|30|NZ_CP044455|CRT 1144207-1144236 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18035-18064 3 0.9
NZ_CP044455_2 2.74|1144207|30|NZ_CP044455|CRT 1144207-1144236 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18977-19006 3 0.9
NZ_CP044455_2 2.74|1144207|30|NZ_CP044455|CRT 1144207-1144236 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19517-19546 3 0.9
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 17-40 3 0.875
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1478-1501 3 0.875
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1802-1825 3 0.875
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2996-3019 3 0.875
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3458-3481 3 0.875
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151285-151308 3 0.875
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151628-151651 3 0.875
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151682-151705 3 0.875
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153317-153340 3 0.875
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155477-155500 3 0.875
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156257-156280 3 0.875
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156401-156424 3 0.875
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157343-157366 3 0.875
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1100-1123 3 0.875
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152030-152053 3 0.875
NZ_CP044455_2 2.80|1144543|24|NZ_CP044455|CRT 1144543-1144566 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155783-155806 3 0.875
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 944-973 4 0.867
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 980-1009 4 0.867
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155681-155710 4 0.867
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151796-151825 4 0.867
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16145-16168 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16277-16300 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16409-16432 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16721-16744 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17087-17110 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17435-17458 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17555-17578 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17717-17740 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18017-18040 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18215-18238 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18479-18502 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18527-18550 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18749-18772 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18959-18982 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19199-19222 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19499-19522 4 0.833
NZ_CP044455_2 2.32|1141705|24|NZ_CP044455|CRT 1141705-1141728 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19697-19720 4 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2438-2467 4 0.867
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155681-155710 4 0.867
NZ_CP044455_2 2.39|1142083|24|NZ_CP044455|CRT 1142083-1142106 24 NC_009444 Pseudomonas fluorescens SBW25 plasmid pQBR103, complete sequence 145876-145899 4 0.833
NZ_CP044455_2 2.50|1142833|30|NZ_CP044455|CRT 1142833-1142862 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 974-1003 4 0.867
NZ_CP044455_2 2.50|1142833|30|NZ_CP044455|CRT 1142833-1142862 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 938-967 4 0.867
NZ_CP044455_2 2.53|1143001|30|NZ_CP044455|CRT 1143001-1143030 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 974-1003 4 0.867
NZ_CP044455_2 2.53|1143001|30|NZ_CP044455|CRT 1143001-1143030 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 938-967 4 0.867
NZ_CP044455_2 2.54|1143049|30|NZ_CP044455|CRT 1143049-1143078 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 974-1003 4 0.867
NZ_CP044455_2 2.54|1143049|30|NZ_CP044455|CRT 1143049-1143078 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 938-967 4 0.867
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157055-157084 4 0.867
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3440-3469 4 0.867
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16661-16690 4 0.867
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154565-154594 4 0.867
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156527-156556 4 0.867
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1820-1849 4 0.867
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1316-1345 4 0.867
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2090-2119 4 0.867
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1370-1399 4 0.867
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2000-2029 4 0.867
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2174-2203 4 0.867
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154313-154342 4 0.867
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16097-16120 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16229-16252 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16361-16384 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16637-16660 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16811-16834 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16949-16972 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17039-17062 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17387-17410 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17441-17464 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17645-17668 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17807-17830 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18305-18328 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18605-18628 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18701-18724 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18755-18778 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18893-18916 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19049-19072 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19289-19312 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19805-19828 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19979-20002 4 0.833
NZ_CP044455_2 2.70|1144003|24|NZ_CP044455|CRT 1144003-1144026 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154571-154594 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16097-16120 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16229-16252 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16361-16384 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16637-16660 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16811-16834 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16949-16972 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17039-17062 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17387-17410 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17441-17464 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17645-17668 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17807-17830 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18305-18328 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18605-18628 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18701-18724 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18755-18778 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18893-18916 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19049-19072 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19289-19312 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19805-19828 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19979-20002 4 0.833
NZ_CP044455_2 2.72|1144117|24|NZ_CP044455|CRT 1144117-1144140 24 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154571-154594 4 0.833
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19031-19060 4 0.867
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21023-21052 4 0.867
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15410-15439 4 0.867
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9545-9574 4 0.867
NZ_CP044455_2 2.79|1144501|24|NZ_CP044455|CRT 1144501-1144524 24 NC_009444 Pseudomonas fluorescens SBW25 plasmid pQBR103, complete sequence 145876-145899 4 0.833
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17939-17968 5 0.833
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19421-19450 5 0.833
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19973-20002 5 0.833
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151273-151302 5 0.833
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155465-155494 5 0.833
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156143-156172 5 0.833
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156245-156274 5 0.833
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151796-151825 5 0.833
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16745-16774 5 0.833
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17741-17770 5 0.833
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18503-18532 5 0.833
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19223-19252 5 0.833
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 944-973 5 0.833
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 980-1009 5 0.833
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1808-1837 5 0.833
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154535-154564 5 0.833
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154805-154834 5 0.833
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155681-155710 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151273-151302 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151364-151393 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16145-16174 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16277-16306 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16409-16438 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16475-16504 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16721-16750 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17087-17116 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17153-17182 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17555-17584 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17717-17746 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18017-18046 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18215-18244 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18479-18508 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18527-18556 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18959-18988 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19199-19228 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19499-19528 5 0.833
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19697-19726 5 0.833
NZ_CP044455_2 2.50|1142833|30|NZ_CP044455|CRT 1142833-1142862 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153221-153250 5 0.833
NZ_CP044455_2 2.50|1142833|30|NZ_CP044455|CRT 1142833-1142862 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153701-153730 5 0.833
NZ_CP044455_2 2.50|1142833|30|NZ_CP044455|CRT 1142833-1142862 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155459-155488 5 0.833
NZ_CP044455_2 2.50|1142833|30|NZ_CP044455|CRT 1142833-1142862 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156239-156268 5 0.833
NZ_CP044455_2 2.50|1142833|30|NZ_CP044455|CRT 1142833-1142862 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2306-2335 5 0.833
NZ_CP044455_2 2.51|1142881|30|NZ_CP044455|CRT 1142881-1142910 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 974-1003 5 0.833
NZ_CP044455_2 2.51|1142881|30|NZ_CP044455|CRT 1142881-1142910 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 938-967 5 0.833
NZ_CP044455_2 2.53|1143001|30|NZ_CP044455|CRT 1143001-1143030 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153221-153250 5 0.833
NZ_CP044455_2 2.53|1143001|30|NZ_CP044455|CRT 1143001-1143030 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153701-153730 5 0.833
NZ_CP044455_2 2.53|1143001|30|NZ_CP044455|CRT 1143001-1143030 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155459-155488 5 0.833
NZ_CP044455_2 2.53|1143001|30|NZ_CP044455|CRT 1143001-1143030 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156239-156268 5 0.833
NZ_CP044455_2 2.53|1143001|30|NZ_CP044455|CRT 1143001-1143030 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2306-2335 5 0.833
NZ_CP044455_2 2.54|1143049|30|NZ_CP044455|CRT 1143049-1143078 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153221-153250 5 0.833
NZ_CP044455_2 2.54|1143049|30|NZ_CP044455|CRT 1143049-1143078 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153701-153730 5 0.833
NZ_CP044455_2 2.54|1143049|30|NZ_CP044455|CRT 1143049-1143078 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155459-155488 5 0.833
NZ_CP044455_2 2.54|1143049|30|NZ_CP044455|CRT 1143049-1143078 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156239-156268 5 0.833
NZ_CP044455_2 2.54|1143049|30|NZ_CP044455|CRT 1143049-1143078 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2306-2335 5 0.833
NZ_CP044455_2 2.55|1143097|30|NZ_CP044455|CRT 1143097-1143126 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 974-1003 5 0.833
NZ_CP044455_2 2.55|1143097|30|NZ_CP044455|CRT 1143097-1143126 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 938-967 5 0.833
NZ_CP044455_2 2.62|1143553|42|NZ_CP044455|CRT 1143553-1143594 42 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19037-19078 5 0.881
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154439-154468 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156173-156202 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156629-156658 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157037-157066 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157091-157120 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1352-1381 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1802-1831 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17021-17050 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16751-16780 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17747-17776 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19229-19258 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16793-16822 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17627-17656 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17789-17818 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17831-17860 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18875-18904 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19031-19060 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19271-19300 5 0.833
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19313-19342 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151538-151567 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151574-151603 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151850-151879 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151976-152005 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153179-153208 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154673-154702 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154889-154918 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155087-155116 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155321-155350 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155855-155884 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156797-156826 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156965-156994 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157271-157300 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 35-64 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2432-2461 5 0.833
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2696-2725 5 0.833
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1820-1849 5 0.833
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1316-1345 5 0.833
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2090-2119 5 0.833
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154565-154594 5 0.833
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156527-156556 5 0.833
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19031-19060 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 53-82 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1424-1453 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1682-1711 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1820-1849 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2582-2611 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2714-2743 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2864-2893 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2900-2929 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2918-2947 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3422-3451 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154691-154720 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154709-154738 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154763-154792 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154907-154936 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155105-155134 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155159-155188 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155213-155242 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155339-155368 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155393-155422 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19031-19060 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17021-17050 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18263-18292 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20051-20080 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 17-46 5 0.833
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1046-1075 5 0.833
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1820-1849 5 0.833
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1316-1345 5 0.833
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2090-2119 5 0.833
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154565-154594 5 0.833
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156527-156556 5 0.833
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19031-19060 5 0.833
NZ_CP044455_2 2.74|1144207|30|NZ_CP044455|CRT 1144207-1144236 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19643-19672 5 0.833
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16595-16624 5 0.833
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16661-16690 5 0.833
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16907-16936 5 0.833
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19883-19912 5 0.833
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154565-154594 5 0.833
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2090-2119 5 0.833
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2324-2353 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3584-3613 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2984-3013 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1304-1333 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1808-1837 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3446-3475 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16655-16684 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16697-16726 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16865-16894 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16967-16996 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17435-17464 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17825-17854 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17867-17896 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18323-18352 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18347-18376 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18749-18778 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18935-18964 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19067-19096 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19307-19336 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19349-19378 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154535-154564 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154805-154834 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151670-151699 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154301-154330 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157331-157360 6 0.8
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20111-20140 6 0.8
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16787-16816 6 0.8
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17621-17650 6 0.8
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17783-17812 6 0.8
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18869-18898 6 0.8
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19265-19294 6 0.8
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20027-20056 6 0.8
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1766-1795 6 0.8
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155771-155800 6 0.8
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156143-156172 6 0.8
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155843-155872 6 0.8
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156785-156814 6 0.8
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157259-157288 6 0.8
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3584-3613 6 0.8
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1214-1243 6 0.8
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2324-2353 6 0.8
NZ_CP044455_2 2.50|1142833|30|NZ_CP044455|CRT 1142833-1142862 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1196-1225 6 0.8
NZ_CP044455_2 2.51|1142881|30|NZ_CP044455|CRT 1142881-1142910 30 NZ_CP010312 Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence 64179-64208 6 0.8
NZ_CP044455_2 2.53|1143001|30|NZ_CP044455|CRT 1143001-1143030 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1196-1225 6 0.8
NZ_CP044455_2 2.54|1143049|30|NZ_CP044455|CRT 1143049-1143078 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1196-1225 6 0.8
NZ_CP044455_2 2.55|1143097|30|NZ_CP044455|CRT 1143097-1143126 30 NZ_CP010312 Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence 64179-64208 6 0.8
NZ_CP044455_2 2.58|1143271|30|NZ_CP044455|CRT 1143271-1143300 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156155-156184 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151664-151693 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151718-151747 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153353-153382 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153407-153436 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154295-154324 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155675-155704 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155963-155992 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157217-157246 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157235-157264 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157325-157354 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157451-157480 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 53-82 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1100-1129 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1424-1453 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1460-1489 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1664-1693 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1682-1711 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2474-2503 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2582-2611 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2714-2743 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2900-2929 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2978-3007 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3266-3295 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3422-3451 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3596-3625 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3734-3763 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3770-3799 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18587-18616 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16127-16156 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16259-16288 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16391-16420 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17069-17098 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17327-17356 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17417-17446 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17699-17728 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18731-18760 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19181-19210 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20009-20038 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 17-46 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1028-1057 6 0.8
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1046-1075 6 0.8
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19031-19060 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 35-64 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2432-2461 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2696-2725 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151538-151567 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151574-151603 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151850-151879 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151976-152005 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153179-153208 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154673-154702 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154889-154918 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155087-155116 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155321-155350 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155855-155884 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156797-156826 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156965-156994 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157271-157300 6 0.8
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP010312 Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence 64173-64202 6 0.8
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16595-16624 6 0.8
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16661-16690 6 0.8
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16907-16936 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 35-64 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2432-2461 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2696-2725 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151538-151567 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151574-151603 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151850-151879 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151976-152005 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153179-153208 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154673-154702 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154889-154918 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155087-155116 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155321-155350 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155855-155884 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156797-156826 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156965-156994 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157271-157300 6 0.8
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP010312 Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence 64173-64202 6 0.8
NZ_CP044455_2 2.74|1144207|30|NZ_CP044455|CRT 1144207-1144236 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18545-18574 6 0.8
NZ_CP044455_2 2.74|1144207|30|NZ_CP044455|CRT 1144207-1144236 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151802-151831 6 0.8
NZ_CP044455_2 2.74|1144207|30|NZ_CP044455|CRT 1144207-1144236 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154541-154570 6 0.8
NZ_CP044455_2 2.74|1144207|30|NZ_CP044455|CRT 1144207-1144236 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154811-154840 6 0.8
NZ_CP044455_2 2.74|1144207|30|NZ_CP044455|CRT 1144207-1144236 30 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1524524-1524553 6 0.8
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17021-17050 6 0.8
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18263-18292 6 0.8
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20051-20080 6 0.8
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16847-16876 6 0.8
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17273-17302 6 0.8
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18407-18436 6 0.8
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18917-18946 6 0.8
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19127-19156 6 0.8
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19853-19882 6 0.8
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1820-1849 6 0.8
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9833-9862 6 0.8
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1106-1135 7 0.767
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1412-1441 7 0.767
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2570-2599 7 0.767
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2852-2881 7 0.767
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3272-3301 7 0.767
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3776-3805 7 0.767
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155201-155230 7 0.767
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157097-157126 7 0.767
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2984-3013 7 0.767
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21011-21040 7 0.767
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15398-15427 7 0.767
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9533-9562 7 0.767
NZ_CP044455_2 2.36|1141927|30|NZ_CP044455|CRT 1141927-1141956 30 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 2292436-2292465 7 0.767
NZ_CP044455_2 2.50|1142833|30|NZ_CP044455|CRT 1142833-1142862 30 NZ_CP010312 Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence 64179-64208 7 0.767
NZ_CP044455_2 2.51|1142881|30|NZ_CP044455|CRT 1142881-1142910 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154319-154348 7 0.767
NZ_CP044455_2 2.51|1142881|30|NZ_CP044455|CRT 1142881-1142910 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154571-154600 7 0.767
NZ_CP044455_2 2.51|1142881|30|NZ_CP044455|CRT 1142881-1142910 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1322-1351 7 0.767
NZ_CP044455_2 2.51|1142881|30|NZ_CP044455|CRT 1142881-1142910 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2180-2209 7 0.767
NZ_CP044455_2 2.53|1143001|30|NZ_CP044455|CRT 1143001-1143030 30 NZ_CP010312 Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence 64179-64208 7 0.767
NZ_CP044455_2 2.54|1143049|30|NZ_CP044455|CRT 1143049-1143078 30 NZ_CP010312 Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence 64179-64208 7 0.767
NZ_CP044455_2 2.55|1143097|30|NZ_CP044455|CRT 1143097-1143126 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154319-154348 7 0.767
NZ_CP044455_2 2.55|1143097|30|NZ_CP044455|CRT 1143097-1143126 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154571-154600 7 0.767
NZ_CP044455_2 2.55|1143097|30|NZ_CP044455|CRT 1143097-1143126 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1322-1351 7 0.767
NZ_CP044455_2 2.55|1143097|30|NZ_CP044455|CRT 1143097-1143126 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2180-2209 7 0.767
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16703-16732 7 0.767
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18941-18970 7 0.767
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 43742-43771 7 0.767
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP039853 Salinimonas sp. KX18D6 plasmid plas12, complete sequence 52583-52612 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16097-16126 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16229-16258 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16361-16390 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16637-16666 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16769-16798 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16811-16840 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16949-16978 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17039-17068 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17387-17416 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17603-17632 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17645-17674 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17765-17794 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17807-17836 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18305-18334 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18701-18730 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18851-18880 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18893-18922 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19049-19078 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19247-19276 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19289-19318 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19805-19834 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19979-20008 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1-28 7 0.767
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP010312 Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence 64173-64202 7 0.767
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16847-16876 7 0.767
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17273-17302 7 0.767
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18407-18436 7 0.767
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18917-18946 7 0.767
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19127-19156 7 0.767
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19853-19882 7 0.767
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17441-17470 7 0.767
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18605-18634 7 0.767
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18755-18784 7 0.767
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 NZ_CP010312 Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence 64173-64202 7 0.767
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16847-16876 7 0.767
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17273-17302 7 0.767
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18407-18436 7 0.767
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18917-18946 7 0.767
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19127-19156 7 0.767
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19853-19882 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16097-16126 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16229-16258 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16361-16390 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16637-16666 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16811-16840 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16949-16978 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17039-17068 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17387-17416 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17645-17674 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17807-17836 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18305-18334 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18701-18730 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18893-18922 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19049-19078 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19289-19318 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19805-19834 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19979-20008 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16127-16156 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16259-16288 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16391-16420 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16871-16900 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16973-17002 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17069-17098 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17327-17356 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17417-17446 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17699-17728 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17873-17902 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17945-17974 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18329-18358 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18353-18382 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18731-18760 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19073-19102 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19181-19210 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19355-19384 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19427-19456 7 0.767
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20009-20038 7 0.767
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2198-2227 8 0.733
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2552-2581 8 0.733
NZ_CP044455_2 2.30|1141615|30|NZ_CP044455|CRT 1141615-1141644 30 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2798-2827 8 0.733
NZ_CP044455_2 2.51|1142881|30|NZ_CP044455|CRT 1142881-1142910 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156533-156562 8 0.733
NZ_CP044455_2 2.55|1143097|30|NZ_CP044455|CRT 1143097-1143126 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156533-156562 8 0.733
NZ_CP044455_2 2.56|1143145|36|NZ_CP044455|CRT 1143145-1143180 36 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19637-19672 8 0.778
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17537-17566 8 0.733
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16847-16876 8 0.733
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17273-17302 8 0.733
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18407-18436 8 0.733
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18917-18946 8 0.733
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19127-19156 8 0.733
NZ_CP044455_2 2.65|1143715|30|NZ_CP044455|CRT 1143715-1143744 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19853-19882 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16097-16126 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16229-16258 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16361-16390 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16637-16666 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16769-16798 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16811-16840 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16949-16978 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17039-17068 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17387-17416 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17603-17632 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17645-17674 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17765-17794 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17807-17836 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18305-18334 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18701-18730 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18851-18880 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18893-18922 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19049-19078 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19247-19276 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19289-19318 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19805-19834 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19979-20008 8 0.733
NZ_CP044455_2 2.66|1143763|30|NZ_CP044455|CRT 1143763-1143792 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1-28 8 0.733
NZ_CP044455_2 2.69|1143955|30|NZ_CP044455|CRT 1143955-1143984 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1-28 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16097-16126 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16229-16258 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16361-16390 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16637-16666 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16769-16798 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16811-16840 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16949-16978 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17039-17068 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17387-17416 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17603-17632 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17645-17674 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17765-17794 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17807-17836 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18305-18334 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18701-18730 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18851-18880 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18893-18922 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19049-19078 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19247-19276 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19289-19318 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19805-19834 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19979-20008 8 0.733
NZ_CP044455_2 2.73|1144159|30|NZ_CP044455|CRT 1144159-1144188 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1-28 8 0.733
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16679-16708 8 0.733
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16769-16798 8 0.733
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17603-17632 8 0.733
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17765-17794 8 0.733
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18851-18880 8 0.733
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19247-19276 8 0.733
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 LC589952 Enterobacter phage vB_EkoM5VN DNA, complete genome 25016-25045 8 0.733
NZ_CP044455_2 2.28|1141531|30|NZ_CP044455|CRT 1141531-1141560 30 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151364-151393 9 0.7
NZ_CP044455_2 2.64|1143667|30|NZ_CP044455|CRT 1143667-1143696 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1-28 9 0.7
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1-28 9 0.7
NZ_CP044455_2 2.78|1144453|30|NZ_CP044455|CRT 1144453-1144482 30 MH823906 Citrobacter phage Maroon, complete genome 154921-154950 9 0.7

1. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.958

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactcggattccga	Protospacer
*************** ********

2. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.958

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactcggattccga	Protospacer
*************** ********

3. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.958

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactcggattccga	Protospacer
*************** ********

4. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.958

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactcggattccga	Protospacer
*************** ********

5. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.958

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactcggattccga	Protospacer
*************** ********

6. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.958

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactcggattccga	Protospacer
*************** ********

7. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.958

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactctga	Protospacer
*** ********************

8. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.958

ctctgattccgacagcgactctga	CRISPR spacer
ctctgattcagacagcgactctga	Protospacer
********* **************

9. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.958

ctctgatagcgacagcgactctga	CRISPR spacer
ctctgacagcgacagcgactctga	Protospacer
******.*****************

10. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.958

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactctga	Protospacer
*** ********************

11. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.958

ctctgattccgacagcgactctga	CRISPR spacer
ctctgattcagacagcgactctga	Protospacer
********* **************

12. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.958

ctctgatagcgacagcgactctga	CRISPR spacer
ctctgacagcgacagcgactctga	Protospacer
******.*****************

13. spacer 2.31|1141663|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

tagcgacagcgactctgatagcga	CRISPR spacer
tagcgacagcgattcagatagcga	Protospacer
************.** ********

14. spacer 2.31|1141663|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

tagcgacagcgactctgatagcga	CRISPR spacer
tagcgacagcgattcagatagcga	Protospacer
************.** ********

15. spacer 2.31|1141663|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

tagcgacagcgactctgatagcga	CRISPR spacer
tagcgacagcgattcagatagcga	Protospacer
************.** ********

16. spacer 2.31|1141663|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

tagcgacagcgactctgatagcga	CRISPR spacer
tagcgacagcgattcagatagcga	Protospacer
************.** ********

17. spacer 2.31|1141663|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

tagcgacagcgactctgatagcga	CRISPR spacer
tagcgacagcgattcagatagcga	Protospacer
************.** ********

18. spacer 2.31|1141663|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

tagcgacagcgactctgatagcga	CRISPR spacer
tagcgacagcgattcagatagcga	Protospacer
************.** ********

19. spacer 2.31|1141663|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

tagcgacagcgactctgatagcga	CRISPR spacer
tagcgacagcgattcagatagcga	Protospacer
************.** ********

20. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattccga	Protospacer
.************** ********

21. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattccga	Protospacer
.************** ********

22. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattccga	Protospacer
.************** ********

23. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattccga	Protospacer
.************** ********

24. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattccga	Protospacer
.************** ********

25. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactcggattcgga	Protospacer
*************** ***** **

26. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttcggacagcgactcggattccga	Protospacer
*** *********** ********

27. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttcggacagcgactcggattccga	Protospacer
*** *********** ********

28. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttcggacagcgactcggattccga	Protospacer
*** *********** ********

29. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactcggactccga	Protospacer
*************** **.*****

30. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttcggacagcgactcggattccga	Protospacer
*** *********** ********

31. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactcggactccga	Protospacer
*************** **.*****

32. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttcggacagcgactcggattccga	Protospacer
*** *********** ********

33. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttcggacagcgactcggattccga	Protospacer
*** *********** ********

34. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactcggactccga	Protospacer
*************** **.*****

35. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttcggacagcgactcggattccga	Protospacer
*** *********** ********

36. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactcggactccga	Protospacer
*************** **.*****

37. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttcggacagcgactcggattccga	Protospacer
*** *********** ********

38. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttcggacagcgactcggattccga	Protospacer
*** *********** ********

39. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactcggactccga	Protospacer
*************** **.*****

40. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttctgacagcgactctgactccga	Protospacer
***.**************.*****

41. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactccgattctga	Protospacer
***************.*****.**

42. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactctgactcgga	Protospacer
******************.** **

43. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagtgactcggattccga	Protospacer
*********.***** ********

44. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttctgacagcgactccgattccga	Protospacer
***.***********.********

45. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactcggattctga	Protospacer
*************** *****.**

46. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgattcggattccga	Protospacer
************.** ********

47. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttctgacagcgactctgactccga	Protospacer
***.**************.*****

48. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttcggacagcgactctgactccga	Protospacer
*** **************.*****

49. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagtgactccgattccga	Protospacer
*********.*****.********

50. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttctgacagcgactctgactccga	Protospacer
***.**************.*****

51. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttccgacagcgactccgattctga	Protospacer
***************.*****.**

52. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ttccgacagcgactctgattccga	CRISPR spacer
ttcagacagcgactctgattcaga	Protospacer
*** ***************** **

53. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.933

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ctccgacagcgactctgactctgacagcga	Protospacer
.***********************.*****

54. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.933

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ttccgacagcgactctgactcggacagcga	Protospacer
********************* **.*****

55. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.933

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ttcggacagcgactctgactctgacagcga	Protospacer
*** ********************.*****

56. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.933

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ttccgacagcgattctgactctgacagcga	Protospacer
************.***********.*****

57. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.933

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ttccgacagtgactctgactctgacagcga	Protospacer
*********.**************.*****

58. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.933

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ttccgacagcgactcggactctgacagcga	Protospacer
*************** ********.*****

59. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.933

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ttccgacagcgactcggactctgacagcga	Protospacer
*************** ********.*****

60. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.933

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ttccgacagcgactcggactctgacagcga	Protospacer
*************** ********.*****

61. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.933

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ttctgacagcgactctgactctgacagcga	Protospacer
***.********************.*****

62. spacer 2.37|1141975|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttcagacagcgactctgatagcga	CRISPR spacer
ttcagacagcgactccgacagcga	Protospacer
***************.**.*****

63. spacer 2.37|1141975|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttcagacagcgactctgatagcga	CRISPR spacer
ttcagacagcgactccgacagcga	Protospacer
***************.**.*****

64. spacer 2.37|1141975|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ttcagacagcgactctgatagcga	CRISPR spacer
ttcagacagcgactccgacagcga	Protospacer
***************.**.*****

65. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattctgacagcgactctga	Protospacer
***.*****.**************

66. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattcggacagcgactctga	Protospacer
***.***** **************

67. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgactccgacagcgactctga	Protospacer
***.**.*****************

68. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattctgacagcgactctga	Protospacer
*** *****.**************

69. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattccgacagcgattctga	Protospacer
***.**************.*****

70. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattcggacagcgactctga	Protospacer
***.***** **************

71. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

72. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattccgacagcgactcgga	Protospacer
***.***************** **

73. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcagactccgacagcgactctga	Protospacer
*** **.*****************

74. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattctgacagcgactctga	Protospacer
***.*****.**************

75. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

76. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgactccgacagcgactcgga	Protospacer
******.************** **

77. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattcggacagcgactctga	Protospacer
***.***** **************

78. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattctgacagcgactctga	Protospacer
***.*****.**************

79. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgattcagatagcgactctga	Protospacer
********* **.***********

80. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgactcagacagcgactctga	Protospacer
******.** **************

81. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgattcagatagcgactctga	Protospacer
********* **.***********

82. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgactcagacagcgactctga	Protospacer
******.** **************

83. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgattcagatagcgactctga	Protospacer
********* **.***********

84. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgattcagatagcgactctga	Protospacer
********* **.***********

85. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgattcagatagcgactctga	Protospacer
********* **.***********

86. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

87. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

88. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

89. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

90. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

91. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

92. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

93. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

94. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

95. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

96. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattctgacagcgactctga	Protospacer
***.*****.**************

97. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattctgacagcgactctga	Protospacer
*** *****.**************

98. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ttcagatagcgacagcgactctga	Protospacer
.** ********************

99. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

100. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

101. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

102. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagatagcgatagcgactctga	Protospacer
*** ********.***********

103. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

104. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

105. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagatagcgatagcgactctga	Protospacer
*** ********.***********

106. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

107. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagatagcgatagcgactctga	Protospacer
*** ********.***********

108. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

109. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

110. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

111. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

112. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagatagcgatagcgactctga	Protospacer
*** ********.***********

113. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

114. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

115. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagatagcgatagcgactctga	Protospacer
*** ********.***********

116. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

117. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagatagcgatagcgactctga	Protospacer
*** ********.***********

118. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

119. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

120. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

121. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcggatagcgacagcgactcgga	Protospacer
*** ***************** **

122. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcggatagcgacagcgactcgga	Protospacer
*** ***************** **

123. spacer 2.50|1142833|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.933

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactctgactctgactctgacagcga	Protospacer
******************.**.********

124. spacer 2.50|1142833|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.933

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactctgactccgattcggacagcga	Protospacer
***************.***** ********

125. spacer 2.53|1143001|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.933

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactctgactctgactctgacagcga	Protospacer
******************.**.********

126. spacer 2.53|1143001|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.933

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactctgactccgattcggacagcga	Protospacer
***************.***** ********

127. spacer 2.54|1143049|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.933

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactctgactctgactctgacagcga	Protospacer
******************.**.********

128. spacer 2.54|1143049|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.933

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactctgactccgattcggacagcga	Protospacer
***************.***** ********

129. spacer 2.58|1143271|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ttctgactctgatagcgacagcgactctga	CRISPR spacer
ttcagactctgacagcgacagcgactctga	Protospacer
*** ********.*****************

130. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.933

ttctgactctgactctgacagcgactctga	CRISPR spacer
ctctgactctgactctgacagcgactcgga	Protospacer
.************************** **

131. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ttctgactctgattcagacagcga	CRISPR spacer
ttcagactctgattcagatagcga	Protospacer
*** **************.*****

132. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ttctgactctgattcagacagcga	CRISPR spacer
ttcagactctgattcagatagcga	Protospacer
*** **************.*****

133. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ttctgactctgattcagacagcga	CRISPR spacer
ttcagactctgattcagatagcga	Protospacer
*** **************.*****

134. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ttctgactctgattcagacagcga	CRISPR spacer
ttcagactctgattcagatagcga	Protospacer
*** **************.*****

135. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattctgacagcgactctga	Protospacer
***.*****.**************

136. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattcggacagcgactctga	Protospacer
***.***** **************

137. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgactccgacagcgactctga	Protospacer
***.**.*****************

138. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattctgacagcgactctga	Protospacer
*** *****.**************

139. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattccgacagcgattctga	Protospacer
***.**************.*****

140. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattcggacagcgactctga	Protospacer
***.***** **************

141. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

142. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattccgacagcgactcgga	Protospacer
***.***************** **

143. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcagactccgacagcgactctga	Protospacer
*** **.*****************

144. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattctgacagcgactctga	Protospacer
***.*****.**************

145. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

146. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgactccgacagcgactcgga	Protospacer
******.************** **

147. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattcggacagcgactctga	Protospacer
***.***** **************

148. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattctgacagcgactctga	Protospacer
***.*****.**************

149. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgattcagatagcgactctga	Protospacer
********* **.***********

150. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgactcagacagcgactctga	Protospacer
******.** **************

151. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgattcagatagcgactctga	Protospacer
********* **.***********

152. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgactcagacagcgactctga	Protospacer
******.** **************

153. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgattcagatagcgactctga	Protospacer
********* **.***********

154. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgattcagatagcgactctga	Protospacer
********* **.***********

155. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctctgattcagatagcgactctga	Protospacer
********* **.***********

156. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

157. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

158. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

159. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

160. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

161. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

162. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

163. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

164. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

165. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattccgacagcgactcgga	Protospacer
*** ***************** **

166. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctccgattctgacagcgactctga	Protospacer
***.*****.**************

167. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgattccgacagcgactctga	CRISPR spacer
ctcggattctgacagcgactctga	Protospacer
*** *****.**************

168. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ttcagatagcgacagcgactctga	Protospacer
.** ********************

169. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

170. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

171. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

172. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagatagcgatagcgactctga	Protospacer
*** ********.***********

173. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

174. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

175. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagatagcgatagcgactctga	Protospacer
*** ********.***********

176. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

177. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagatagcgatagcgactctga	Protospacer
*** ********.***********

178. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

179. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

180. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

181. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

182. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagatagcgatagcgactctga	Protospacer
*** ********.***********

183. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

184. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

185. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagatagcgatagcgactctga	Protospacer
*** ********.***********

186. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

187. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagatagcgatagcgactctga	Protospacer
*** ********.***********

188. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

189. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

190. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcagacagcgacagcgactctga	Protospacer
*** **.*****************

191. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcggatagcgacagcgactcgga	Protospacer
*** ***************** **

192. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.917

ctctgatagcgacagcgactctga	CRISPR spacer
ctcggatagcgacagcgactcgga	Protospacer
*** ***************** **

193. spacer 2.31|1141663|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

tagcgacagcgactctgatagcga	CRISPR spacer
cagcgacagcgattcagatagcga	Protospacer
.***********.** ********

194. spacer 2.31|1141663|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

tagcgacagcgactctgatagcga	CRISPR spacer
cagcgacagcgattcagatagcga	Protospacer
.***********.** ********

195. spacer 2.31|1141663|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

tagcgacagcgactctgatagcga	CRISPR spacer
cagcgacagcgattcagatagcga	Protospacer
.***********.** ********

196. spacer 2.31|1141663|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

tagcgacagcgactctgatagcga	CRISPR spacer
tagcgacagcgactctgattcaga	Protospacer
*******************   **

197. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattcgga	Protospacer
.************** ***** **

198. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattcgga	Protospacer
.************** ***** **

199. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactccgattctga	Protospacer
.**************.*****.**

200. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggactccga	Protospacer
.************** **.*****

201. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattctga	Protospacer
.************** *****.**

202. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgattcggattccga	Protospacer
.***********.** ********

203. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactccgattctga	Protospacer
.**************.*****.**

204. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggactccga	Protospacer
.************** **.*****

205. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattcgga	Protospacer
.************** ***** **

206. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactcggattccga	Protospacer
.**.*********** ********

207. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactcggattccga	Protospacer
.**.*********** ********

208. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattctga	Protospacer
.************** *****.**

209. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactcggattccga	Protospacer
.**.*********** ********

210. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactcggattccga	Protospacer
.**.*********** ********

211. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattctga	Protospacer
.************** *****.**

212. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactcggattccga	Protospacer
.**.*********** ********

213. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggactccga	Protospacer
.************** **.*****

214. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattctga	Protospacer
.************** *****.**

215. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactccgattctga	Protospacer
.**************.*****.**

216. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactccgattctga	Protospacer
.**************.*****.**

217. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattctga	Protospacer
.************** *****.**

218. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcggacagcgactccgattccga	Protospacer
.** ***********.********

219. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactccgattccga	Protospacer
.**.***********.********

220. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactccgattccga	Protospacer
.**.***********.********

221. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattctga	Protospacer
.************** *****.**

222. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactccgattccga	Protospacer
.**.***********.********

223. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactctgactcgga	Protospacer
.*****************.** **

224. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactctgactccga	Protospacer
.**.**************.*****

225. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcagactccga	Protospacer
.************** **.*****

226. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattctga	Protospacer
.************** *****.**

227. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactctgactcgga	Protospacer
.*****************.** **

228. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggactccga	Protospacer
.************** **.*****

229. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactctgactctga	Protospacer
.*****************.**.**

230. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcggacagcgactctgactccga	Protospacer
.** **************.*****

231. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactctgactcgga	Protospacer
.*****************.** **

232. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctccgacagcgactcggattctga	Protospacer
.************** *****.**

233. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattcaga	Protospacer
.** ***************** **

234. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattcaga	Protospacer
.** ***************** **

235. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattcaga	Protospacer
.** ***************** **

236. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattcaga	Protospacer
.** ***************** **

237. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactctgattctga	Protospacer
.**.*****************.**

238. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactctgattcaga	Protospacer
.**.***************** **

239. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattcaga	Protospacer
.** ***************** **

240. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattcaga	Protospacer
.** ***************** **

241. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattcaga	Protospacer
.** ***************** **

242. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattctga	Protospacer
.** *****************.**

243. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactctgattcaga	Protospacer
.**.***************** **

244. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactctgattctga	Protospacer
.**.*****************.**

245. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactctgattcaga	Protospacer
.**.***************** **

246. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattcaga	Protospacer
.** ***************** **

247. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattcaga	Protospacer
.** ***************** **

248. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattcaga	Protospacer
.** ***************** **

249. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattcaga	Protospacer
.** ***************** **

250. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattctga	Protospacer
.** *****************.**

251. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactctgattcaga	Protospacer
.**.***************** **

252. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactctgattctga	Protospacer
.**.*****************.**

253. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctctgacagcgactctgattcaga	Protospacer
.**.***************** **

254. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattcaga	Protospacer
.** ***************** **

255. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattcaga	Protospacer
.** ***************** **

256. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
tagcgacagcgactctgattcaga	Protospacer
*  ****************** **

257. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttccgacagcgactctgattccga	CRISPR spacer
ctcagacagcgactctgattcaga	Protospacer
.** ***************** **

258. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.9

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ctccgacagcgactcggactctgacagcga	Protospacer
.************** ********.*****

259. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.9

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ctccgacagcgactctgactcggacagcga	Protospacer
.******************** **.*****

260. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.9

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ctccgacagcgactctgactcggacagcga	Protospacer
.******************** **.*****

261. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.9

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ctccgacagcgactcggactctgacagcga	Protospacer
.************** ********.*****

262. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.9

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ctccgacagcgactctgactcggacagcga	Protospacer
.******************** **.*****

263. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.9

ttccgacagcgactctgactctgatagcga	CRISPR spacer
tgctgacagcgactctgactctgacagcga	Protospacer
* *.********************.*****

264. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.9

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ctccgacagtgactctgactctgacagcga	Protospacer
.********.**************.*****

265. spacer 2.37|1141975|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttcagacagcgactctgatagcga	CRISPR spacer
ctctgacagcgactcggatagcga	Protospacer
.** *********** ********

266. spacer 2.37|1141975|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttcagacagcgactctgatagcga	CRISPR spacer
ttcagacagcgactctgattcaga	Protospacer
*******************   **

267. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttcggattctgacagcgactctga	Protospacer
.** *****.**************

268. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttcggattcggacagcgactctga	Protospacer
.** ***** **************

269. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttctgactctgacagcgactctga	Protospacer
.*****.**.**************

270. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttcggactccgacagcgactctga	Protospacer
.** **.*****************

271. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttcggattccgacagtgactctga	Protospacer
.** ***********.********

272. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttcggattctgacagcgactctga	Protospacer
.** *****.**************

273. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttccgattccgacagcgactcgga	Protospacer
.**.***************** **

274. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttccgattccgacagcgactcgga	Protospacer
.**.***************** **

275. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttccgattccgacagcgactcgga	Protospacer
.**.***************** **

276. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttccgattctgacagcgactctga	Protospacer
.**.*****.**************

277. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttccgattctgacagcgactctga	Protospacer
.**.*****.**************

278. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttccgattccgacagcgactcgga	Protospacer
.**.***************** **

279. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttccgattccgacagcgactcgga	Protospacer
.**.***************** **

280. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttcggattctgacagcgactctga	Protospacer
.** *****.**************

281. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgatagcgacagcgactctga	CRISPR spacer
ttcggatagcgacagcgactcgga	Protospacer
.** ***************** **

282. spacer 2.40|1142125|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgatagcgacagcgactctga	CRISPR spacer
ttcggatagcgacagcgattctga	Protospacer
.** **************.*****

283. spacer 2.58|1143271|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ttctgactctgatagcgacagcgactctga	CRISPR spacer
ctctgactcagacagcgacagcgactctga	Protospacer
.******** **.*****************

284. spacer 2.58|1143271|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ttctgactctgatagcgacagcgactctga	CRISPR spacer
ctctgactcagacagcgacagcgactctga	Protospacer
.******** **.*****************

285. spacer 2.58|1143271|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ttctgactctgatagcgacagcgactctga	CRISPR spacer
ctctgactcagacagcgacagcgactctga	Protospacer
.******** **.*****************

286. spacer 2.58|1143271|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ttctgactctgatagcgacagcgactctga	CRISPR spacer
ctctgactcagacagcgacagcgactctga	Protospacer
.******** **.*****************

287. spacer 2.58|1143271|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ttctgactctgatagcgacagcgactctga	CRISPR spacer
ctctgactcagacagcgacagcgactctga	Protospacer
.******** **.*****************

288. spacer 2.58|1143271|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ttctgactctgatagcgacagcgactctga	CRISPR spacer
ctctgactcagacagcgacagcgactctga	Protospacer
.******** **.*****************

289. spacer 2.58|1143271|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ttctgactctgatagcgacagcgactctga	CRISPR spacer
ctctgactcagacagcgacagcgactctga	Protospacer
.******** **.*****************

290. spacer 2.58|1143271|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ttctgactctgatagcgacagcgactctga	CRISPR spacer
ctctgactcagacagcgacagcgactctga	Protospacer
.******** **.*****************

291. spacer 2.58|1143271|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ttctgactctgatagcgacagcgactctga	CRISPR spacer
ctctgactcagacagcgacagcgactctga	Protospacer
.******** **.*****************

292. spacer 2.58|1143271|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ttctgactctgatagcgacagcgactctga	CRISPR spacer
ctctgactcagacagcgacagcgactctga	Protospacer
.******** **.*****************

293. spacer 2.58|1143271|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ttctgactctgatagcgacagcgactctga	CRISPR spacer
ctctgactcagacagcgacagcgactctga	Protospacer
.******** **.*****************

294. spacer 2.58|1143271|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ttctgactctgatagcgacagcgactctga	CRISPR spacer
ctctgattcagatagcgacagcgactctga	Protospacer
.*****.** ********************

295. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.9

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagtgactcggattccgacagcgactctga	Protospacer
*  ****** ********************

296. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
tagcgactctgattcagacagcga	Protospacer
*  .********************

297. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
tagcgactctgattcagacagcga	Protospacer
*  .********************

298. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
tagcgactctgattcagacagcga	Protospacer
*  .********************

299. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
tagcgactctgattcagacagcga	Protospacer
*  .********************

300. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
tagcgactctgattcagacagcga	Protospacer
*  .********************

301. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
tagcgactctgattcagacagcga	Protospacer
*  .********************

302. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
tagcgactctgattcagacagcga	Protospacer
*  .********************

303. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

304. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

305. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

306. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

307. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

308. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

309. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

310. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctctgactcagactcagacagcga	Protospacer
.******** **.***********

311. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

312. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

313. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

314. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctctgactctgactctgacagcga	Protospacer
.***********.** ********

315. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctctgactccgattcggacagcga	Protospacer
.********.*****.********

316. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
tagcgactctgattcagacagcga	Protospacer
*  .********************

317. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
tagcgactctgattcagacagcga	Protospacer
*  .********************

318. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
tagcgactctgattcagacagcga	Protospacer
*  .********************

319. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
tagcgactctgattcagacagcga	Protospacer
*  .********************

320. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
tagcgactctgattcagacagcga	Protospacer
*  .********************

321. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
tagcgactctgattcagacagcga	Protospacer
*  .********************

322. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
tagcgactctgattcagacagcga	Protospacer
*  .********************

323. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

324. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

325. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

326. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

327. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

328. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

329. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

330. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctctgactcagactcagacagcga	Protospacer
.******** **.***********

331. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

332. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

333. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctcagactctgactcagacagcga	Protospacer
.** ********.***********

334. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctctgactctgactctgacagcga	Protospacer
.***********.** ********

335. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ttctgactctgattcagacagcga	CRISPR spacer
ctctgactccgattcggacagcga	Protospacer
.********.*****.********

336. spacer 2.74|1144207|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ctctgatagcgacagcgattccgacagcga	CRISPR spacer
ttcagatagcgacagcgattcagacagcga	Protospacer
.** ***************** ********

337. spacer 2.74|1144207|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ctctgatagcgacagcgattccgacagcga	CRISPR spacer
ttcagatagcgacagcgattcagacagcga	Protospacer
.** ***************** ********

338. spacer 2.74|1144207|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ctctgatagcgacagcgattccgacagcga	CRISPR spacer
ttcagatagcgacagcgattcagacagcga	Protospacer
.** ***************** ********

339. spacer 2.74|1144207|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ctctgatagcgacagcgattccgacagcga	CRISPR spacer
ttcagatagcgacagcgattcagacagcga	Protospacer
.** ***************** ********

340. spacer 2.74|1144207|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ctctgatagcgacagcgattccgacagcga	CRISPR spacer
ttcagatagcgacagcgattcagacagcga	Protospacer
.** ***************** ********

341. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttcggattctgacagcgactctga	Protospacer
.** *****.**************

342. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttcggattcggacagcgactctga	Protospacer
.** ***** **************

343. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttctgactctgacagcgactctga	Protospacer
.*****.**.**************

344. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttcggactccgacagcgactctga	Protospacer
.** **.*****************

345. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttcggattccgacagtgactctga	Protospacer
.** ***********.********

346. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttcggattctgacagcgactctga	Protospacer
.** *****.**************

347. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttccgattccgacagcgactcgga	Protospacer
.**.***************** **

348. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttccgattccgacagcgactcgga	Protospacer
.**.***************** **

349. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttccgattccgacagcgactcgga	Protospacer
.**.***************** **

350. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttccgattctgacagcgactctga	Protospacer
.**.*****.**************

351. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttccgattctgacagcgactctga	Protospacer
.**.*****.**************

352. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttccgattccgacagcgactcgga	Protospacer
.**.***************** **

353. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttccgattccgacagcgactcgga	Protospacer
.**.***************** **

354. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.875

ctctgattccgacagcgactctga	CRISPR spacer
ttcggattctgacagcgactctga	Protospacer
.** *****.**************

355. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgatagcgacagcgactctga	CRISPR spacer
ttcggatagcgacagcgactcgga	Protospacer
.** ***************** **

356. spacer 2.80|1144543|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.875

ctctgatagcgacagcgactctga	CRISPR spacer
ttcggatagcgacagcgattctga	Protospacer
.** **************.*****

357. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.867

tagcgacagcgactctgactctgattccga	CRISPR spacer
ctccgacagcgactcggactctgattccga	Protospacer
.  ************ **************

358. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.867

tagcgacagcgactctgactctgattccga	CRISPR spacer
ctccgacagcgactcggactctgattccga	Protospacer
.  ************ **************

359. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.867

tagcgacagcgactctgactctgattccga	CRISPR spacer
tagcgacagcgactcggactctgacagcga	Protospacer
*************** ********.  ***

360. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.867

tagcgacagcgattctgactctgattccga	CRISPR spacer
tagcgacagcgattcggactctgacagcga	Protospacer
*************** ********.  ***

361. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

362. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

363. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

364. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

365. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

366. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

367. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

368. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

369. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

370. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

371. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

372. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

373. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

374. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

375. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

376. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

377. spacer 2.32|1141705|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttccgacagcgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcaga	Protospacer
.  ****************** **

378. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.867

ttccgacagcgactctgactctgatagcga	CRISPR spacer
tgctgacagcgactctgactccgacagcga	Protospacer
* *.*****************.**.*****

379. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.867

ttccgacagcgactctgactctgatagcga	CRISPR spacer
tagcgacagcgactcggactctgacagcga	Protospacer
*  ************ ********.*****

380. spacer 2.39|1142083|24|NZ_CP044455|CRT matches to NC_009444 (Pseudomonas fluorescens SBW25 plasmid pQBR103, complete sequence) position: , mismatch: 4, identity: 0.833

ctctgattccgacagcgactctga	CRISPR spacer
tgctgattccgacagcgactcggt	Protospacer
. ******************* * 

381. spacer 2.50|1142833|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.867

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactcggactctgattccgattccga	Protospacer
********* **************.  ***

382. spacer 2.50|1142833|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.867

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactcggactctgattccgattccga	Protospacer
********* **************.  ***

383. spacer 2.53|1143001|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.867

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactcggactctgattccgattccga	Protospacer
********* **************.  ***

384. spacer 2.53|1143001|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.867

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactcggactctgattccgattccga	Protospacer
********* **************.  ***

385. spacer 2.54|1143049|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.867

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactcggactctgattccgattccga	Protospacer
********* **************.  ***

386. spacer 2.54|1143049|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.867

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactcggactctgattccgattccga	Protospacer
********* **************.  ***

387. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.867

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagtgactctgactctgacagtgactctga	Protospacer
.  ******************.********

388. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.867

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagtgactctgactctgacagcgactccga	Protospacer
.  ************************.**

389. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.867

ttctgactctgactctgacagcgactctga	CRISPR spacer
tagcgactctgactcagacagcgactctga	Protospacer
*  .*********** **************

390. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.867

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagtgactctgattcggacagcgattcgga	Protospacer
*  ************ *********** **

391. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.867

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagtgactcggattccgacagcgattccga	Protospacer
*  ****** *****************.**

392. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.867

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactccgattccgacagcgattctga	Protospacer
*  .*****.********************

393. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.867

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagtgactcggattccgacagcgactctga	Protospacer
*  ****** **************.*****

394. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.867

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagtgactcggattctgacagcgattctga	Protospacer
*  ****** *****.**************

395. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.867

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagtgactccgattcggacagcgactctga	Protospacer
*  ******.***** **************

396. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.867

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagtgactccgattcggacagcgactctga	Protospacer
*  ******.***** **************

397. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.867

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagtgactcggattccgacagcgactcgga	Protospacer
*  ****** ***************** **

398. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.867

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagtgactcggattccgacagcgactcgga	Protospacer
*  ****** ***************** **

399. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

400. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

401. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

402. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

403. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

404. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

405. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

406. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

407. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

408. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

409. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

410. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

411. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

412. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

413. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

414. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

415. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

416. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

417. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

418. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

419. spacer 2.70|1144003|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagtgactctgattcggacagcga	Protospacer
.  ************.********

420. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

421. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

422. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

423. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

424. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

425. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

426. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

427. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

428. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

429. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

430. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

431. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

432. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

433. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

434. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

435. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

436. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

437. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

438. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

439. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagcgactctgattcagacagcga	Protospacer
.  .********************

440. spacer 2.72|1144117|24|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.833

ttctgactctgattcagacagcga	CRISPR spacer
cagtgactctgattcggacagcga	Protospacer
.  ************.********

441. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.867

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgactctga	Protospacer
*  .********************.*****

442. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.867

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagtgattccgattcagacagcgattctga	Protospacer
*  ***.**.********************

443. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagtgattcagattcagacagcgattctga	Protospacer
*  ***.** ********************

444. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.867

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagtgattccgattcagacagcgattctga	Protospacer
*  ***.**.********************

445. spacer 2.79|1144501|24|NZ_CP044455|CRT matches to NC_009444 (Pseudomonas fluorescens SBW25 plasmid pQBR103, complete sequence) position: , mismatch: 4, identity: 0.833

ctctgattccgacagcgactctga	CRISPR spacer
tgctgattccgacagcgactcggt	Protospacer
. ******************* * 

446. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

tagcgacagcgactctgactctgattccga	CRISPR spacer
tagcgatagcgactctgactcagacagcga	Protospacer
******.************** **.  ***

447. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

tagcgacagcgactctgactctgattccga	CRISPR spacer
tagcgatagcgactctgactcagacagcga	Protospacer
******.************** **.  ***

448. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

tagcgacagcgactctgactctgattccga	CRISPR spacer
tagcgacagcgactctgattcagacagcga	Protospacer
******************.** **.  ***

449. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

tagcgacagcgactctgactctgattccga	CRISPR spacer
ttctgacagcgactctgactctgactctga	Protospacer
*  .********************.**.**

450. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

tagcgacagcgactctgactctgattccga	CRISPR spacer
ttctgacagcgactctgacagtgattccga	Protospacer
*  .***************  *********

451. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

tagcgacagcgactctgactctgattccga	CRISPR spacer
tagcgacagcgactcggactctgacagtga	Protospacer
*************** ********.  .**

452. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

tagcgacagcgactctgactctgattccga	CRISPR spacer
ttctgacagcgactctgacagtgattccga	Protospacer
*  .***************  *********

453. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

tagcgacagcgactctgactctgattccga	CRISPR spacer
tagcgacagcgattcggactctgacagcga	Protospacer
************.** ********.  ***

454. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

tagcgacagcgattctgactctgattccga	CRISPR spacer
tagcgacagtgattcagactctgacagcga	Protospacer
*********.***** ********.  ***

455. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

tagcgacagcgattctgactctgattccga	CRISPR spacer
tagcgacagtgattcagactctgacagcga	Protospacer
*********.***** ********.  ***

456. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

tagcgacagcgattctgactctgattccga	CRISPR spacer
tagcgacagtgattcagactctgacagcga	Protospacer
*********.***** ********.  ***

457. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

tagcgacagcgattctgactctgattccga	CRISPR spacer
tagcgacagtgattcagactctgacagcga	Protospacer
*********.***** ********.  ***

458. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 5, identity: 0.833

tagcgacagcgattctgactctgattccga	CRISPR spacer
ctccgacagcgactcggactctgattccga	Protospacer
.  *********.** **************

459. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

tagcgacagcgattctgactctgattccga	CRISPR spacer
ctccgacagcgactcggactctgattccga	Protospacer
.  *********.** **************

460. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

tagcgacagcgattctgactctgattccga	CRISPR spacer
ttccgacagcgattctgactctgacagcga	Protospacer
*  *********************.  ***

461. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

tagcgacagcgattctgactctgattccga	CRISPR spacer
tagcgacagcgattcggactctgacagtga	Protospacer
*************** ********.  .**

462. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

tagcgacagcgattctgactctgattccga	CRISPR spacer
tagcgacagcgattcggactctgacagtga	Protospacer
*************** ********.  .**

463. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

tagcgacagcgattctgactctgattccga	CRISPR spacer
tagcgacagcgactcggactctgacagcga	Protospacer
************.** ********.  ***

464. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ttctgacagcgactctgactctgactctga	Protospacer
***.********************.  .**

465. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ctccgacagcgactcggactctgacagtgg	Protospacer
.************** ********.**.*.

466. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgacagcgactctgattcagatagcga	Protospacer
.  ***************.** ********

467. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgacagcgactctgattcagatagcga	Protospacer
.  ***************.** ********

468. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgacagcgactctgattcagatagcga	Protospacer
.  ***************.** ********

469. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgatagcgactctgactcagatagcga	Protospacer
.  ***.************** ********

470. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgacagcgactctgattcagatagcga	Protospacer
.  ***************.** ********

471. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgacagcgactctgattcagatagcga	Protospacer
.  ***************.** ********

472. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgatagcgactctgactcagatagcga	Protospacer
.  ***.************** ********

473. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgacagcgactctgattcagatagcga	Protospacer
.  ***************.** ********

474. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgacagcgactctgattcagatagcga	Protospacer
.  ***************.** ********

475. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgacagcgactctgattcagatagcga	Protospacer
.  ***************.** ********

476. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgacagcgactctgattcagatagcga	Protospacer
.  ***************.** ********

477. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgacagcgactctgattcagatagcga	Protospacer
.  ***************.** ********

478. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgacagcgactctgattcagatagcga	Protospacer
.  ***************.** ********

479. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgacagcgactctgattcagatagcga	Protospacer
.  ***************.** ********

480. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgacagcgactctgattcagatagcga	Protospacer
.  ***************.** ********

481. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgacagcgactctgattcagatagcga	Protospacer
.  ***************.** ********

482. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttccgacagcgactctgactctgatagcga	CRISPR spacer
cagcgacagcgactctgattcagatagcga	Protospacer
.  ***************.** ********

483. spacer 2.50|1142833|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

cagcgactctgactctgattccgacagcga	CRISPR spacer
ttccgactctgactcggactccgacagcga	Protospacer
.  ************ **.***********

484. spacer 2.50|1142833|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

cagcgactctgactctgattccgacagcga	CRISPR spacer
ttccgactctgactcggactccgacagcga	Protospacer
.  ************ **.***********

485. spacer 2.50|1142833|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactctgacagtgattccgactctga	Protospacer
*************  **********  .**

486. spacer 2.50|1142833|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactctgacagtgattccgactctga	Protospacer
*************  **********  .**

487. spacer 2.50|1142833|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

cagcgactctgactctgattccgacagcga	CRISPR spacer
ctctgactccgactccgattccgacagcga	Protospacer
*  .*****.*****.**************

488. spacer 2.51|1142881|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

cagcgattctgactctgattccgacagcga	CRISPR spacer
cagcgactcggactctgattccgattccga	Protospacer
******.** **************.  ***

489. spacer 2.51|1142881|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 5, identity: 0.833

cagcgattctgactctgattccgacagcga	CRISPR spacer
cagcgactcggactctgattccgattccga	Protospacer
******.** **************.  ***

490. spacer 2.53|1143001|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

cagcgactctgactctgattccgacagcga	CRISPR spacer
ttccgactctgactcggactccgacagcga	Protospacer
.  ************ **.***********

491. spacer 2.53|1143001|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

cagcgactctgactctgattccgacagcga	CRISPR spacer
ttccgactctgactcggactccgacagcga	Protospacer
.  ************ **.***********

492. spacer 2.53|1143001|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactctgacagtgattccgactctga	Protospacer
*************  **********  .**

493. spacer 2.53|1143001|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactctgacagtgattccgactctga	Protospacer
*************  **********  .**

494. spacer 2.53|1143001|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

cagcgactctgactctgattccgacagcga	CRISPR spacer
ctctgactccgactccgattccgacagcga	Protospacer
*  .*****.*****.**************

495. spacer 2.54|1143049|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

cagcgactctgactctgattccgacagcga	CRISPR spacer
ttccgactctgactcggactccgacagcga	Protospacer
.  ************ **.***********

496. spacer 2.54|1143049|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

cagcgactctgactctgattccgacagcga	CRISPR spacer
ttccgactctgactcggactccgacagcga	Protospacer
.  ************ **.***********

497. spacer 2.54|1143049|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactctgacagtgattccgactctga	Protospacer
*************  **********  .**

498. spacer 2.54|1143049|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

cagcgactctgactctgattccgacagcga	CRISPR spacer
cagcgactctgacagtgattccgactctga	Protospacer
*************  **********  .**

499. spacer 2.54|1143049|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

cagcgactctgactctgattccgacagcga	CRISPR spacer
ctctgactccgactccgattccgacagcga	Protospacer
*  .*****.*****.**************

500. spacer 2.55|1143097|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

cagcgattctgactctgattccgacagcga	CRISPR spacer
cagcgactcggactctgattccgattccga	Protospacer
******.** **************.  ***

501. spacer 2.55|1143097|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 5, identity: 0.833

cagcgattctgactctgattccgacagcga	CRISPR spacer
cagcgactcggactctgattccgattccga	Protospacer
******.** **************.  ***

502. spacer 2.62|1143553|42|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.881

ctctgattccgacagcgactctgattccgacagcgattctga	CRISPR spacer
ctctgattcagacagcgactctgattcagacagcgatagcga	Protospacer
********* ***************** *********  .**

503. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagtgactctgactctgacagcgattcgga	Protospacer
.  *********************.** **

504. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagtgactccgactctgacagcgactcgga	Protospacer
.  ******.***************** **

505. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagtgactccgactctgacagcgactcgga	Protospacer
.  ******.***************** **

506. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagtgactctgactctgacagcgattcgga	Protospacer
.  *********************.** **

507. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagtgactctgactctgacagcgattcgga	Protospacer
.  *********************.** **

508. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactctgactctgacagcgactccga	Protospacer
.  .***********************.**

509. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgattctgactctgacagcgactctga	Protospacer
.  .**.***********************

510. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactctgactcagacagcgactctga	Protospacer
.  .*********** **************

511. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagtgattcagactctgacagcgactctga	Protospacer
.  ***.** ********************

512. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagtgattcagactctgacagcgactctga	Protospacer
.  ***.** ********************

513. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagtgattcagactctgacagcgactctga	Protospacer
.  ***.** ********************

514. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
tagcgattcagactctgacagcgactctga	Protospacer
*  .**.** ********************

515. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
tagcgattcagactctgacagcgactctga	Protospacer
*  .**.** ********************

516. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
tagcgattcagactctgacagcgactctga	Protospacer
*  .**.** ********************

517. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
tagcgactctgactcagacagcgactcaga	Protospacer
*  .*********** *********** **

518. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
tagcgattcagactctgacagcgactctga	Protospacer
*  .**.** ********************

519. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
tagcgactctgattcagacagcgactctga	Protospacer
*  .********.** **************

520. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
tagcgattcagactctgacagcgactctga	Protospacer
*  .**.** ********************

521. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgactctgacagcgactctga	CRISPR spacer
tagcgactctgactcagacagcgactcaga	Protospacer
*  .*********** *********** **

522. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattccga	Protospacer
*  .***** *****************.**

523. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattccga	Protospacer
*  .***** *****************.**

524. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
*  .***** ***************** **

525. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
*  .***** ***************** **

526. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
*  .***** ***************** **

527. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
*  .***** ***************** **

528. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
*  .***** ***************** **

529. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
*  .***** ***************** **

530. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
*  .***** ***************** **

531. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattccga	Protospacer
*  .***** *****************.**

532. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattccga	Protospacer
*  .***** *****************.**

533. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattccga	Protospacer
*  .***** *****************.**

534. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactccgattccgacagcgattcgga	Protospacer
*  .*****.***************** **

535. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgactccgacagcgattcgga	Protospacer
*  .********.************** **

536. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgactccgacagcgattcgga	Protospacer
*  .********.************** **

537. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgactccgacagcgattcgga	Protospacer
*  .********.************** **

538. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactccgattccgacagcgattctga	Protospacer
.  .*****.********************

539. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagtgactcggattccgacagcgactctga	Protospacer
.  ****** **************.*****

540. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagtgactcggattctgacagcgattctga	Protospacer
.  ****** *****.**************

541. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagtgactctgattcggacagcgattcgga	Protospacer
.  ************ *********** **

542. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagtgactcggattccgacagcgattccga	Protospacer
.  ****** *****************.**

543. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgactctga	Protospacer
*  .*********** ********.*****

544. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactccgattctgacagcgactctga	Protospacer
*  .*****.*****.**************

545. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactccgactccgacagcgactctga	Protospacer
*  .*****.**.*****************

546. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactcggattctgacagcgactctga	Protospacer
*  .***** *****.**************

547. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactccgattccgacagcgattctga	Protospacer
*  .*****.**************.*****

548. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactcagactccgacagcgactctga	Protospacer
*  .***** **.*****************

549. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactccgattctgacagcgactctga	Protospacer
*  .*****.*****.**************

550. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactcggattccgacagcgactcgga	Protospacer
*  .***** ***************** **

551. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactctgactccgacagcgactcgga	Protospacer
*  .********.************** **

552. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactccgattcggacagcgactctga	Protospacer
*  .*****.***** **************

553. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactccgattctgacagcgactctga	Protospacer
*  .*****.*****.**************

554. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactcggattccgacagcgactcgga	Protospacer
*  .***** ***************** **

555. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactcggattccgacagcgactcgga	Protospacer
*  .***** ***************** **

556. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactcggattccgacagcgactcgga	Protospacer
*  .***** ***************** **

557. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactcggattccgacagcgactcgga	Protospacer
*  .***** ***************** **

558. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactcggattccgacagcgactcgga	Protospacer
*  .***** ***************** **

559. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactcggattccgacagcgactcgga	Protospacer
*  .***** ***************** **

560. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactcggattccgacagcgactcgga	Protospacer
*  .***** ***************** **

561. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactcggattccgacagcgactcgga	Protospacer
*  .***** ***************** **

562. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactcggattccgacagcgactcgga	Protospacer
*  .***** ***************** **

563. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
tagcgactctgattcagacagcgactctga	Protospacer
.  .*********** **************

564. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactctgactcagacagcgactctga	Protospacer
*  .********.** **************

565. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactctgattcagatagcgactctga	Protospacer
*  .*********** **.***********

566. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactctgattcagatagcgactctga	Protospacer
*  .*********** **.***********

567. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactccgattctgacagcgactctga	Protospacer
*  .*****.*****.**************

568. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 5, identity: 0.833

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactcggattctgacagcgactctga	Protospacer
*  .***** *****.**************

569. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactccgattccgacagcgattctga	Protospacer
.  .*****.********************

570. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagtgactcggattccgacagcgactctga	Protospacer
.  ****** **************.*****

571. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagtgactcggattctgacagcgattctga	Protospacer
.  ****** *****.**************

572. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagtgactctgattcggacagcgattcgga	Protospacer
.  ************ *********** **

573. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagtgactcggattccgacagcgattccga	Protospacer
.  ****** *****************.**

574. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgactctga	Protospacer
*  .*********** ********.*****

575. spacer 2.74|1144207|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ctctgatagcgacagcgattccgacagcga	CRISPR spacer
ctcagatagcgacagcgattcagactcaga	Protospacer
*** ***************** ***   **

576. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgattcagatagcgactctga	Protospacer
*  .**************.*****.*****

577. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgactcagacagcgactctga	Protospacer
*  .********.***********.*****

578. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgattcagatagcgactctga	Protospacer
*  .**************.*****.*****

579. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

ttctgactctgattcagacagcgattctga	CRISPR spacer
ttcagactctgattcagatagcgacagtga	Protospacer
*** **************.*****.  ***

580. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.833

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagtgactctgattcggacagcgattcgga	Protospacer
.  ************.*********** **

581. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.833

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagtgactcggattctgacagcgattctga	Protospacer
.  ****** ***** **************

582. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
ctcggacagcgactcggactctgactccga	Protospacer
.   *********** ********.*****

583. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
ctcggacagcgactctgactccgattcgga	Protospacer
.   *****************.***** **

584. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
ctccgacagcgactctgactctgacagcga	Protospacer
.  *********************.  ***

585. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
ttccgacagcgactctgactcggacagcga	Protospacer
*  ****************** **.  ***

586. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
ttccgacagcgattctgactctgacagcga	Protospacer
*  *********.***********.  ***

587. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
ttccgacagtgactctgactctgacagcga	Protospacer
*  ******.**************.  ***

588. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
cagcgatagcgactctgactcagacagcga	Protospacer
.*****.************** **.  ***

589. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
cagcgatagcgactctgactcagacagcga	Protospacer
.*****.************** **.  ***

590. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
cagcgatagcgactctgactcagacagcga	Protospacer
.*****.************** **.  ***

591. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
cagcgatagcgactctgactcagacagcga	Protospacer
.*****.************** **.  ***

592. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcagacagcga	Protospacer
.*****************.** **.  ***

593. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
cagcgatagcgactctgactcagacagcga	Protospacer
.*****.************** **.  ***

594. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
cagcgatagcgactctgactcagacagcga	Protospacer
.*****.************** **.  ***

595. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
cagcgatagcgactctgactcagacagcga	Protospacer
.*****.************** **.  ***

596. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
cagcgatagcgactctgactcagacagcga	Protospacer
.*****.************** **.  ***

597. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
cagcgacagcgactctgattcagacagcga	Protospacer
.*****************.** **.  ***

598. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
cagcgatagcgactctgactcagacagcga	Protospacer
.*****.************** **.  ***

599. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
cagcgatagcgactctgactcagacagcga	Protospacer
.*****.************** **.  ***

600. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
cagcgatagcgactctgactcagacagcga	Protospacer
.*****.************** **.  ***

601. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
cagcgatagcgactctgactcagacagcga	Protospacer
.*****.************** **.  ***

602. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
tagcgacagcgattcggactctgacagtga	Protospacer
************.** ********.  .**

603. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
tagcgacagcgattcggactctgacagtga	Protospacer
************.** ********.  .**

604. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
ttccgacagcgactcggactctgacagcga	Protospacer
*  ************ ********.  ***

605. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
ttccgacagcgactcggactctgacagcga	Protospacer
*  ************ ********.  ***

606. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

tagcgacagcgactctgactctgattccga	CRISPR spacer
ttccgacagcgactcggactctgacagcga	Protospacer
*  ************ ********.  ***

607. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgattctgactctgattccga	CRISPR spacer
cagcgacagcgattcagactcagataaaga	Protospacer
.************** ***** ***   **

608. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgattctgactctgattccga	CRISPR spacer
cagcgatagcgattcagactctgacagcga	Protospacer
.*****.******** ********.  ***

609. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgattctgactctgattccga	CRISPR spacer
cagcgatagcgattcagactctgacagcga	Protospacer
.*****.******** ********.  ***

610. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgattctgactctgattccga	CRISPR spacer
cagcgatagcgattcagactctgacagcga	Protospacer
.*****.******** ********.  ***

611. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgattctgactctgattccga	CRISPR spacer
cagcgatagcgattcagactctgacagcga	Protospacer
.*****.******** ********.  ***

612. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgattctgactctgattccga	CRISPR spacer
cagcgatagcgattcagactctgacagcga	Protospacer
.*****.******** ********.  ***

613. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

tagcgacagcgattctgactctgattccga	CRISPR spacer
cagcgacagcgattcagactcagacagcga	Protospacer
.************** ***** **.  ***

614. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

tagcgacagcgattctgactctgattccga	CRISPR spacer
cagcgacagtgattcggactctgacagcga	Protospacer
.********.***** ********.  ***

615. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

tagcgacagcgattctgactctgattccga	CRISPR spacer
tagcgacagcgattctgacgccgacagtga	Protospacer
******************* *.**.  .**

616. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

tagcgacagcgattctgactctgattccga	CRISPR spacer
tagcgacagcgactcggactctgacagtga	Protospacer
************.** ********.  .**

617. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

tagcgacagcgattctgactctgattccga	CRISPR spacer
ttccgacagcgattccgactctgacagcga	Protospacer
*  ************.********.  ***

618. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

tagcgacagcgattctgactctgattccga	CRISPR spacer
ttccgacagcgattccgactctgacagcga	Protospacer
*  ************.********.  ***

619. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

tagcgacagcgattctgactctgattccga	CRISPR spacer
ttccgacagcgattcggactctgacagcga	Protospacer
*  ************ ********.  ***

620. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ctcggacagcgactctgactccgattcgga	Protospacer
.** *****************.***   **

621. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ctccgacagcgactcggattctgactccga	Protospacer
.************** **.*****.  ***

622. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ctcggacagcgactcggactctgactccga	Protospacer
.** *********** ********.  ***

623. spacer 2.50|1142833|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

cagcgactctgactctgattccgacagcga	CRISPR spacer
ttctgactccgactctgattccgacagtga	Protospacer
.  .*****.*****************.**

624. spacer 2.51|1142881|30|NZ_CP044455|CRT matches to NZ_CP010312 (Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence) position: , mismatch: 6, identity: 0.8

cagcgattctgactctgattccgacagcga	CRISPR spacer
cgataattctgagtctaattccgacagcga	Protospacer
*....******* ***.*************

625. spacer 2.53|1143001|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

cagcgactctgactctgattccgacagcga	CRISPR spacer
ttctgactccgactctgattccgacagtga	Protospacer
.  .*****.*****************.**

626. spacer 2.54|1143049|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

cagcgactctgactctgattccgacagcga	CRISPR spacer
ttctgactccgactctgattccgacagtga	Protospacer
.  .*****.*****************.**

627. spacer 2.55|1143097|30|NZ_CP044455|CRT matches to NZ_CP010312 (Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence) position: , mismatch: 6, identity: 0.8

cagcgattctgactctgattccgacagcga	CRISPR spacer
cgataattctgagtctaattccgacagcga	Protospacer
*....******* ***.*************

628. spacer 2.58|1143271|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgatagcgacagcgactctga	CRISPR spacer
cagcgactcggatagcgacagcgactcgga	Protospacer
.  .***** ***************** **

629. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcggactctgacagcgactcgga	Protospacer
.  .***** ***************** **

630. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcggactctgacagcgactcgga	Protospacer
.  .***** ***************** **

631. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcggactctgacagcgactcgga	Protospacer
.  .***** ***************** **

632. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcggactctgacagcgactcgga	Protospacer
.  .***** ***************** **

633. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcggactctgacagcgactccga	Protospacer
.  .***** *****************.**

634. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcggactctgacagcgactcgga	Protospacer
.  .***** ***************** **

635. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcggactctgacagcgactcgga	Protospacer
.  .***** ***************** **

636. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcggactctgacagcgactcgga	Protospacer
.  .***** ***************** **

637. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcggactctgacagcgactcgga	Protospacer
.  .***** ***************** **

638. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcggactctgacagcgactccga	Protospacer
.  .***** *****************.**

639. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcggactctgacagcgactcgga	Protospacer
.  .***** ***************** **

640. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactccgattctgacagcgactctga	Protospacer
.  .*****.**.*****************

641. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcggactctgacagcgactcgga	Protospacer
.  .***** ***************** **

642. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactccgactccgacagcgactctga	Protospacer
.  .*****.*****.**************

643. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactctgactcggacagcgactcgga	Protospacer
.  .*********** *********** **

644. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactctgactcggacagcgactcgga	Protospacer
.  .*********** *********** **

645. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcggattctgacagcgactctga	Protospacer
.  .***** **.*****************

646. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactctgactctgacagcgacagtga	Protospacer
.  .*********************  ***

647. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcagactccgacagcgactctga	Protospacer
.  .***** *****.**************

648. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactccgattctgacagcgactctga	Protospacer
.  .*****.**.*****************

649. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactctgactccgacagcgactcgga	Protospacer
.  .***********.*********** **

650. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactctgactctgacagcgattcgga	Protospacer
.  .********************.** **

651. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcggactctgacagcgactccga	Protospacer
.  .***** *****************.**

652. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactccgattctgacagcgactctga	Protospacer
.  .*****.**.*****************

653. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactccgactcggacagcgactctga	Protospacer
.  .*****.***** **************

654. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgattctgactctgacagcgactccga	Protospacer
.  .**.********************.**

655. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactctgactcggacagcgactccga	Protospacer
.  .*********** ***********.**

656. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcagactcagacagcgactctga	Protospacer
.  .***** ***** **************

657. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** *********** *********  .**

658. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** *********** *********  .**

659. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** *********** *********  .**

660. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** *********** *********  .**

661. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** *********** *********  .**

662. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** *********** *********  .**

663. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** *********** *********  .**

664. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** *********** *********  .**

665. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** *********** *********  .**

666. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** *********** *********  .**

667. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactccgattctgacagcgactctga	Protospacer
.  .*****.**.*****************

668. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactctgactctgacagcgattcgga	Protospacer
.  .********************.** **

669. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactcggattctgacagcgactctga	Protospacer
.  .***** **.*****************

670. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ctctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgactctga	Protospacer
.  .*********** ********.*****

671. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgactccgacagcgattcgga	Protospacer
.  .********.************** **

672. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgactccgacagcgattcgga	Protospacer
.  .********.************** **

673. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgactccgacagcgattcgga	Protospacer
.  .********.************** **

674. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattccga	Protospacer
.  .***** *****************.**

675. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattccga	Protospacer
.  .***** *****************.**

676. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
.  .***** ***************** **

677. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
.  .***** ***************** **

678. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
.  .***** ***************** **

679. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
.  .***** ***************** **

680. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
.  .***** ***************** **

681. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
.  .***** ***************** **

682. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
.  .***** ***************** **

683. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattccga	Protospacer
.  .***** *****************.**

684. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattccga	Protospacer
.  .***** *****************.**

685. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattccga	Protospacer
.  .***** *****************.**

686. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactccgattccgacagcgattcgga	Protospacer
.  .*****.***************** **

687. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP010312 (Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
ttctgagtctaattccgacagcgaaaacga	Protospacer
****** ***.*************   .**

688. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ctctgactctgattccgacagcgactctga	CRISPR spacer
tagcgactctgattcagatagcgactctga	Protospacer
.  .*********** **.***********

689. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ctctgactctgattccgacagcgactctga	CRISPR spacer
tagcgactctgactcagacagcgactctga	Protospacer
.  .********.** **************

690. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ctctgactctgattccgacagcgactctga	CRISPR spacer
tagcgactctgattcagatagcgactctga	Protospacer
.  .*********** **.***********

691. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgactccgacagcgattcgga	Protospacer
.  .********.************** **

692. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgactccgacagcgattcgga	Protospacer
.  .********.************** **

693. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgactccgacagcgattcgga	Protospacer
.  .********.************** **

694. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattccga	Protospacer
.  .***** *****************.**

695. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattccga	Protospacer
.  .***** *****************.**

696. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
.  .***** ***************** **

697. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
.  .***** ***************** **

698. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
.  .***** ***************** **

699. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
.  .***** ***************** **

700. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
.  .***** ***************** **

701. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
.  .***** ***************** **

702. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattcgga	Protospacer
.  .***** ***************** **

703. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattccga	Protospacer
.  .***** *****************.**

704. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattccga	Protospacer
.  .***** *****************.**

705. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactcggattccgacagcgattccga	Protospacer
.  .***** *****************.**

706. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactccgattccgacagcgattcgga	Protospacer
.  .*****.***************** **

707. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP010312 (Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgattccgacagcgattctga	CRISPR spacer
ttctgagtctaattccgacagcgaaaacga	Protospacer
****** ***.*************   .**

708. spacer 2.74|1144207|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ctctgatagcgacagcgattccgacagcga	CRISPR spacer
ttcagatagcgacagcgattcagactctga	Protospacer
.** ***************** ***  .**

709. spacer 2.74|1144207|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ctctgatagcgacagcgattccgacagcga	CRISPR spacer
ttcggatagcgacagcgattcggactctga	Protospacer
.** ***************** ***  .**

710. spacer 2.74|1144207|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ctctgatagcgacagcgattccgacagcga	CRISPR spacer
ttcggatagcgacagcgattcggactctga	Protospacer
.** ***************** ***  .**

711. spacer 2.74|1144207|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.8

ctctgatagcgacagcgattccgacagcga	CRISPR spacer
ttcggatagcgacagcgattcggactctga	Protospacer
.** ***************** ***  .**

712. spacer 2.74|1144207|30|NZ_CP044455|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.8

ctctgatagcgacagcgattccgacagcga	CRISPR spacer
caccctgagcgacagcgagtccgacagcga	Protospacer
* *.   *********** ***********

713. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgactcagacagcgactctga	Protospacer
.  .********.***********.*****

714. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagatagcgactctga	Protospacer
.  .**************.*****.*****

715. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagatagcgactctga	Protospacer
.  .**************.*****.*****

716. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********************  .**

717. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********************  .**

718. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********************  .**

719. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********************  .**

720. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********************  .**

721. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********************  .**

722. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.8

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactccgattccgacagcgattctga	Protospacer
.  .*****.***** **************

723. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.8

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactcagattcagacagcgattcaga	Protospacer
.  .***** ***************** **

724. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.767

tagcgacagcgactctgactctgattccga	CRISPR spacer
ctccgacagcgactcggactctgacagcga	Protospacer
.  ************ ********.  ***

725. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.767

tagcgacagcgactctgactctgattccga	CRISPR spacer
ctccgacagcgactctgactcggacagcga	Protospacer
.  ****************** **.  ***

726. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.767

tagcgacagcgactctgactctgattccga	CRISPR spacer
ctccgacagcgactctgactcggacagcga	Protospacer
.  ****************** **.  ***

727. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.767

tagcgacagcgactctgactctgattccga	CRISPR spacer
ttccgacagcgactcggactctgacagtga	Protospacer
*  ************ ********.  .**

728. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.767

tagcgacagcgactctgactctgattccga	CRISPR spacer
ctccgacagcgactcggactctgacagcga	Protospacer
.  ************ ********.  ***

729. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.767

tagcgacagcgactctgactctgattccga	CRISPR spacer
ctccgacagcgactctgactcggacagcga	Protospacer
.  ****************** **.  ***

730. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.767

tagcgacagcgactctgactctgattccga	CRISPR spacer
ttccgacagcgactcggactctgacagtga	Protospacer
*  ************ ********.  .**

731. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.767

tagcgacagcgactctgactctgattccga	CRISPR spacer
ctccgacagtgactctgactctgacagcga	Protospacer
.  ******.**************.  ***

732. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.767

tagcgacagcgattctgactctgattccga	CRISPR spacer
ctccgacagcgactctgactctgacagcga	Protospacer
.  *********.***********.  ***

733. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 7, identity: 0.767

tagcgacagcgattctgactctgattccga	CRISPR spacer
ttcagacagcgattctgaatctgataaaga	Protospacer
*   ************** ******   **

734. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

tagcgacagcgattctgactctgattccga	CRISPR spacer
ttcagacagcgattctgaatctgataaaga	Protospacer
*   ************** ******   **

735. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 7, identity: 0.767

tagcgacagcgattctgactctgattccga	CRISPR spacer
ttcagacagcgattctgaatctgataaaga	Protospacer
*   ************** ******   **

736. spacer 2.36|1141927|30|NZ_CP044455|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 7, identity: 0.767

ttccgacagcgactctgactctgatagcga	CRISPR spacer
ttccgaccgcgactctcactctgcggtcca	Protospacer
******* ******** ******  . * *

737. spacer 2.50|1142833|30|NZ_CP044455|CRT matches to NZ_CP010312 (Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence) position: , mismatch: 7, identity: 0.767

cagcgactctgactctgattccgacagcga	CRISPR spacer
cgataattctgagtctaattccgacagcga	Protospacer
*....*.***** ***.*************

738. spacer 2.51|1142881|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.767

cagcgattctgactctgattccgacagcga	CRISPR spacer
ctctgacagtgactcggattccgacagcga	Protospacer
*  .**.  ****** **************

739. spacer 2.51|1142881|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.767

cagcgattctgactctgattccgacagcga	CRISPR spacer
ctctgacagtgactctgattcggacagcga	Protospacer
*  .**.  ************ ********

740. spacer 2.51|1142881|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.767

cagcgattctgactctgattccgacagcga	CRISPR spacer
ttccgacagtgactcggattccgacagcga	Protospacer
.  ***.  ****** **************

741. spacer 2.51|1142881|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.767

cagcgattctgactctgattccgacagcga	CRISPR spacer
ctctgacagtgactcggattccgacagcga	Protospacer
*  .**.  ****** **************

742. spacer 2.53|1143001|30|NZ_CP044455|CRT matches to NZ_CP010312 (Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence) position: , mismatch: 7, identity: 0.767

cagcgactctgactctgattccgacagcga	CRISPR spacer
cgataattctgagtctaattccgacagcga	Protospacer
*....*.***** ***.*************

743. spacer 2.54|1143049|30|NZ_CP044455|CRT matches to NZ_CP010312 (Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence) position: , mismatch: 7, identity: 0.767

cagcgactctgactctgattccgacagcga	CRISPR spacer
cgataattctgagtctaattccgacagcga	Protospacer
*....*.***** ***.*************

744. spacer 2.55|1143097|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.767

cagcgattctgactctgattccgacagcga	CRISPR spacer
ctctgacagtgactcggattccgacagcga	Protospacer
*  .**.  ****** **************

745. spacer 2.55|1143097|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.767

cagcgattctgactctgattccgacagcga	CRISPR spacer
ctctgacagtgactctgattcggacagcga	Protospacer
*  .**.  ************ ********

746. spacer 2.55|1143097|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.767

cagcgattctgactctgattccgacagcga	CRISPR spacer
ttccgacagtgactcggattccgacagcga	Protospacer
.  ***.  ****** **************

747. spacer 2.55|1143097|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.767

cagcgattctgactctgattccgacagcga	CRISPR spacer
ctctgacagtgactcggattccgacagcga	Protospacer
*  .**.  ****** **************

748. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgactctgacagcgactctga	CRISPR spacer
tagcgactctgactcagacagcgacagcga	Protospacer
*  .*********** *********  .**

749. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgactctgacagcgactctga	CRISPR spacer
tagcgactctgactcagacagcgacagcga	Protospacer
*  .*********** *********  .**

750. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgactctgacagcgactctga	CRISPR spacer
ttctgactctgactctggctgcgtatcctc	Protospacer
*****************.* ***  **.  

751. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP039853 (Salinimonas sp. KX18D6 plasmid plas12, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgactctgacagcgactctga	CRISPR spacer
ttcagactttgactctgacagcgttcttgt	Protospacer
*** ****.************** ...** 

752. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

753. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

754. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

755. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

756. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
*  .***********.*********  .**

757. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

758. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

759. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

760. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

761. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
*  .***********.*********  .**

762. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

763. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
*  .***********.*********  .**

764. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

765. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

766. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

767. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
*  .***********.*********  .**

768. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

769. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

770. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
*  .***********.*********  .**

771. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

772. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

773. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

774. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgactccgacagcgattcg--	Protospacer
*  .********.**************   

775. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP010312 (Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgattctga	CRISPR spacer
ttctgagtctaattccgacagcgaaaacga	Protospacer
.***** ***.*************   .**

776. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

777. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

778. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

779. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

780. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

781. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

782. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactctgattcagacagcgacagcga	Protospacer
*  .*********** *********  .**

783. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactctgattcagacagcgacagcga	Protospacer
*  .*********** *********  .**

784. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactctgattcagacagcgacagcga	Protospacer
*  .*********** *********  .**

785. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to NZ_CP010312 (Geoalkalibacter subterraneus strain Red1 plasmid pGSUB1, complete sequence) position: , mismatch: 7, identity: 0.767

ctctgactctgattccgacagcgactctga	CRISPR spacer
ttctgagtctaattccgacagcgaaaacga	Protospacer
.***** ***.*************   .**

786. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

787. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

788. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

789. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

790. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

791. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
*  .*********** *********  .**

792. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

793. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

794. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

795. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

796. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

797. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

798. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

799. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

800. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

801. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

802. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

803. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

804. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

805. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

806. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

807. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

808. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********************  .**

809. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** ********.***********.  .**

810. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** ********.***********.  .**

811. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** ********.***********.  .**

812. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgactcagacagcgatagcga	Protospacer
*  .********.************  .**

813. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgactcagacagcgatagcga	Protospacer
*  .********.************  .**

814. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** ********.***********.  .**

815. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** ********.***********.  .**

816. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** ********.***********.  .**

817. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** ********.***********.  .**

818. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgactcagacagcgatagcga	Protospacer
*  .********.************  .**

819. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgactcagacagcgatagcga	Protospacer
*  .********.************  .**

820. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgactcagacagcgatagcga	Protospacer
*  .********.************  .**

821. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgactcagacagcgatagcga	Protospacer
*  .********.************  .**

822. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** ********.***********.  .**

823. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgactcagacagcgatagcga	Protospacer
*  .********.************  .**

824. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** ********.***********.  .**

825. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgactcagacagcgatagcga	Protospacer
*  .********.************  .**

826. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
tagcgactctgactcagacagcgatagcga	Protospacer
*  .********.************  .**

827. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctgactctgattcagacagcgattctga	CRISPR spacer
ctcagactctgactcagacagcgacagcga	Protospacer
.** ********.***********.  .**

828. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.733

tagcgacagcgactctgactctgattccga	CRISPR spacer
ctccgacagcgactcggactctgacagtga	Protospacer
.  ************ ********.  .**

829. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.733

tagcgacagcgattctgactctgattccga	CRISPR spacer
ctcggacagcgattcggactctgatagtga	Protospacer
.   *********** *********  .**

830. spacer 2.30|1141615|30|NZ_CP044455|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.733

tagcgacagcgattctgactctgattccga	CRISPR spacer
ctccgacagcgattccgactctgacagtga	Protospacer
.  ************.********.  .**

831. spacer 2.51|1142881|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.733

cagcgattctgactctgattccgacagcga	CRISPR spacer
ttctgacagtgactcggattccgacagcga	Protospacer
.  .**.  ****** **************

832. spacer 2.55|1143097|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.733

cagcgattctgactctgattccgacagcga	CRISPR spacer
ttctgacagtgactcggattccgacagcga	Protospacer
.  .**.  ****** **************

833. spacer 2.56|1143145|36|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.778

cagcgactctgatagcgacagcgattccgacagcga	CRISPR spacer
ctcagactcagatagcgacagcgattcagactcaga	Protospacer
*   ***** ***************** ***   **

834. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactctgactcagacagcgacagcga	Protospacer
.  .*********** *********  .**

835. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ctctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

836. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ctctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

837. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ctctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

838. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ctctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

839. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ctctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

840. spacer 2.65|1143715|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ctctgactctgattccgacagcgattctga	CRISPR spacer
tagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

841. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

842. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

843. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

844. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

845. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
.  .***********.*********  .**

846. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

847. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

848. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

849. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

850. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
.  .***********.*********  .**

851. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

852. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
.  .***********.*********  .**

853. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

854. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

855. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

856. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
.  .***********.*********  .**

857. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

858. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

859. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
.  .***********.*********  .**

860. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

861. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

862. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

863. spacer 2.66|1143763|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgactccgacagcgattcg--	Protospacer
.  .********.**************   

864. spacer 2.69|1143955|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 8, identity: 0.733

ctctgactctgattccgacagcgactctga	CRISPR spacer
cagcgactctgactccgacagcgattcg--	Protospacer
*  .********.***********.**   

865. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

866. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

867. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

868. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

869. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
.  .***********.*********  .**

870. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

871. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

872. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

873. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

874. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
.  .***********.*********  .**

875. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

876. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
.  .***********.*********  .**

877. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

878. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

879. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

880. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
.  .***********.*********  .**

881. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

882. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

883. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
.  .***********.*********  .**

884. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

885. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

886. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgattcagacagcgatagcga	Protospacer
.  .*********** *********  .**

887. spacer 2.73|1144159|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattccgacagcgattctga	CRISPR spacer
cagcgactctgactccgacagcgattcg--	Protospacer
.  .********.**************   

888. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgactcagacagcgatagcga	Protospacer
.  .********.************  .**

889. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
.  .*********** *********  .**

890. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
.  .*********** *********  .**

891. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
.  .*********** *********  .**

892. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
.  .*********** *********  .**

893. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgattctgacagcgatagcga	Protospacer
.  .*********** *********  .**

894. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to LC589952 (Enterobacter phage vB_EkoM5VN DNA, complete genome) position: , mismatch: 8, identity: 0.733

ttctgactctgattcagacagcgattctga	CRISPR spacer
atgagcgcatgattcagaaagcgattctga	Protospacer
 *  *  . ********* ***********

895. spacer 2.28|1141531|30|NZ_CP044455|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 9, identity: 0.7

tagcgacagcgactctgactctgattccga	CRISPR spacer
ctccgacagcgactcggactctgacagtgg	Protospacer
.  ************ ********.  .*.

896. spacer 2.64|1143667|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 9, identity: 0.7

ttctgactctgactctgacagcgactctga	CRISPR spacer
cagcgactctgactccgacagcgattcg--	Protospacer
.  .***********.********.**   

897. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 9, identity: 0.7

ttctgactctgattcagacagcgattctga	CRISPR spacer
cagcgactctgactccgacagcgattcg--	Protospacer
.  .********.** ***********   

898. spacer 2.78|1144453|30|NZ_CP044455|CRT matches to MH823906 (Citrobacter phage Maroon, complete genome) position: , mismatch: 9, identity: 0.7

ttctgactctgattcagacagcgattctga	CRISPR spacer
atgaacgcatgattcagaaagcgattctga	Protospacer
 *  .  . ********* ***********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8431 : 45278 26 Helicobacter_phage(22.22%) tRNA,transposase NA
DBSCAN-SWA_2 253143 : 311393 51 Paenibacillus_phage(33.33%) tRNA,transposase NA
DBSCAN-SWA_3 393586 : 458526 54 Tupanvirus(10.0%) tRNA,transposase,protease NA
DBSCAN-SWA_4 997220 : 1049451 68 Acinetobacter_phage(63.41%) head,holin,transposase,integrase,terminase,coat attL 998398:998414|attR 1049630:1049646
DBSCAN-SWA_5 1058636 : 1068308 11 uncultured_Caudovirales_phage(44.44%) tRNA,transposase NA
DBSCAN-SWA_6 1183905 : 1194473 9 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_7 1532136 : 1566012 24 Vibrio_phage(50.0%) holin,transposase,plate NA
DBSCAN-SWA_8 1756427 : 1805236 48 Bacillus_phage(18.18%) integrase,transposase attL 1793621:1793635|attR 1807434:1807448
DBSCAN-SWA_9 2014674 : 2025536 12 Acinetobacter_phage(37.5%) transposase,protease NA
DBSCAN-SWA_10 2106450 : 2124028 25 Acinetobacter_phage(29.41%) terminase NA
DBSCAN-SWA_11 2127686 : 2137349 15 Acinetobacter_phage(55.56%) NA NA
DBSCAN-SWA_12 2487860 : 2543383 53 Enterobacteria_phage(14.29%) tRNA,transposase NA
DBSCAN-SWA_13 2588146 : 2598693 9 Catovirus(16.67%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP044460
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044460_1 14985-15069 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044460_1 1.1|15013|29|NZ_CP044460|CRISPRCasFinder 15013-15041 29 NZ_CP044460 Acinetobacter indicus strain B18 plasmid pB18-5, complete sequence 15013-15041 0 1.0

1. spacer 1.1|15013|29|NZ_CP044460|CRISPRCasFinder matches to NZ_CP044460 (Acinetobacter indicus strain B18 plasmid pB18-5, complete sequence) position: , mismatch: 0, identity: 1.0

aagtaaattaaggctccatactcattaag	CRISPR spacer
aagtaaattaaggctccatactcattaag	Protospacer
*****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP044458
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044458_1 46130-46995 TypeI-F I-F
14 spacers
cas6f,cas7f,cas5f,cas8f,cas3-cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044458_1 1.1|46159|31|NZ_CP044458|CRISPRCasFinder 46159-46189 31 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46159-46189 0 1.0
NZ_CP044458_1 1.1|46159|31|NZ_CP044458|CRISPRCasFinder 46159-46189 31 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136816-136846 0 1.0
NZ_CP044458_1 1.2|46219|31|NZ_CP044458|CRISPRCasFinder 46219-46249 31 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46219-46249 0 1.0
NZ_CP044458_1 1.2|46219|31|NZ_CP044458|CRISPRCasFinder 46219-46249 31 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136756-136786 0 1.0
NZ_CP044458_1 1.3|46279|31|NZ_CP044458|CRISPRCasFinder 46279-46309 31 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46279-46309 0 1.0
NZ_CP044458_1 1.3|46279|31|NZ_CP044458|CRISPRCasFinder 46279-46309 31 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136696-136726 0 1.0
NZ_CP044458_1 1.4|46339|31|NZ_CP044458|CRISPRCasFinder 46339-46369 31 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46339-46369 0 1.0
NZ_CP044458_1 1.4|46339|31|NZ_CP044458|CRISPRCasFinder 46339-46369 31 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136636-136666 0 1.0
NZ_CP044458_1 1.5|46399|31|NZ_CP044458|CRISPRCasFinder 46399-46429 31 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46399-46429 0 1.0
NZ_CP044458_1 1.5|46399|31|NZ_CP044458|CRISPRCasFinder 46399-46429 31 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136576-136606 0 1.0
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136516-136546 0 1.0
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46459-46489 0 1.0
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46519-46549 0 1.0
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136456-136486 0 1.0
NZ_CP044458_1 1.8|46579|31|NZ_CP044458|CRISPRCasFinder 46579-46609 31 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46579-46609 0 1.0
NZ_CP044458_1 1.8|46579|31|NZ_CP044458|CRISPRCasFinder 46579-46609 31 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136396-136426 0 1.0
NZ_CP044458_1 1.9|46639|32|NZ_CP044458|CRISPRCasFinder 46639-46670 32 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46639-46670 0 1.0
NZ_CP044458_1 1.9|46639|32|NZ_CP044458|CRISPRCasFinder 46639-46670 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136335-136366 0 1.0
NZ_CP044458_1 1.10|46700|32|NZ_CP044458|CRISPRCasFinder 46700-46731 32 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46700-46731 0 1.0
NZ_CP044458_1 1.10|46700|32|NZ_CP044458|CRISPRCasFinder 46700-46731 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136274-136305 0 1.0
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46761-46791 0 1.0
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136214-136244 0 1.0
NZ_CP044458_1 1.12|46821|31|NZ_CP044458|CRISPRCasFinder 46821-46851 31 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136154-136184 0 1.0
NZ_CP044458_1 1.12|46821|31|NZ_CP044458|CRISPRCasFinder 46821-46851 31 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46821-46851 0 1.0
NZ_CP044458_1 1.13|46881|31|NZ_CP044458|CRISPRCasFinder 46881-46911 31 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46881-46911 0 1.0
NZ_CP044458_1 1.13|46881|31|NZ_CP044458|CRISPRCasFinder 46881-46911 31 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136094-136124 0 1.0
NZ_CP044458_1 1.14|46941|26|NZ_CP044458|CRISPRCasFinder 46941-46966 26 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46941-46966 0 1.0
NZ_CP044458_1 1.14|46941|26|NZ_CP044458|CRISPRCasFinder 46941-46966 26 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136039-136064 0 1.0
NZ_CP044458_1 1.15|46159|32|NZ_CP044458|PILER-CR,CRT 46159-46190 32 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46159-46190 0 1.0
NZ_CP044458_1 1.15|46159|32|NZ_CP044458|PILER-CR,CRT 46159-46190 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136815-136846 0 1.0
NZ_CP044458_1 1.16|46219|32|NZ_CP044458|PILER-CR,CRT 46219-46250 32 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46219-46250 0 1.0
NZ_CP044458_1 1.16|46219|32|NZ_CP044458|PILER-CR,CRT 46219-46250 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136755-136786 0 1.0
NZ_CP044458_1 1.17|46279|32|NZ_CP044458|PILER-CR,CRT 46279-46310 32 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46279-46310 0 1.0
NZ_CP044458_1 1.17|46279|32|NZ_CP044458|PILER-CR,CRT 46279-46310 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136695-136726 0 1.0
NZ_CP044458_1 1.18|46339|32|NZ_CP044458|PILER-CR,CRT 46339-46370 32 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46339-46370 0 1.0
NZ_CP044458_1 1.18|46339|32|NZ_CP044458|PILER-CR,CRT 46339-46370 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136635-136666 0 1.0
NZ_CP044458_1 1.19|46399|32|NZ_CP044458|PILER-CR,CRT 46399-46430 32 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46399-46430 0 1.0
NZ_CP044458_1 1.19|46399|32|NZ_CP044458|PILER-CR,CRT 46399-46430 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136575-136606 0 1.0
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46459-46490 0 1.0
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136515-136546 0 1.0
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46519-46550 0 1.0
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136455-136486 0 1.0
NZ_CP044458_1 1.22|46579|32|NZ_CP044458|PILER-CR,CRT 46579-46610 32 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46579-46610 0 1.0
NZ_CP044458_1 1.22|46579|32|NZ_CP044458|PILER-CR,CRT 46579-46610 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136395-136426 0 1.0
NZ_CP044458_1 1.23|46639|33|NZ_CP044458|PILER-CR,CRT 46639-46671 33 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46639-46671 0 1.0
NZ_CP044458_1 1.23|46639|33|NZ_CP044458|PILER-CR,CRT 46639-46671 33 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136334-136366 0 1.0
NZ_CP044458_1 1.24|46700|33|NZ_CP044458|PILER-CR,CRT 46700-46732 33 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46700-46732 0 1.0
NZ_CP044458_1 1.24|46700|33|NZ_CP044458|PILER-CR,CRT 46700-46732 33 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136273-136305 0 1.0
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46761-46792 0 1.0
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136213-136244 0 1.0
NZ_CP044458_1 1.26|46821|32|NZ_CP044458|PILER-CR,CRT 46821-46852 32 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46821-46852 0 1.0
NZ_CP044458_1 1.26|46821|32|NZ_CP044458|PILER-CR,CRT 46821-46852 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136153-136184 0 1.0
NZ_CP044458_1 1.27|46881|32|NZ_CP044458|PILER-CR,CRT 46881-46912 32 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46881-46912 0 1.0
NZ_CP044458_1 1.27|46881|32|NZ_CP044458|PILER-CR,CRT 46881-46912 32 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136093-136124 0 1.0
NZ_CP044458_1 1.28|46941|27|NZ_CP044458|CRT 46941-46967 27 NZ_CP044458 Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence 46941-46967 0 1.0
NZ_CP044458_1 1.28|46941|27|NZ_CP044458|CRT 46941-46967 27 NZ_CP039144 Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence 136038-136064 0 1.0
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP034096 Acinetobacter baumannii strain A52 plasmid pA52-4, complete sequence 3359-3389 1 0.968
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_KX118105 Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence 105-135 1 0.968
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_KX118105 Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence 41391-41421 1 0.968
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_KX118105 Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence 41551-41581 1 0.968
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_KX118105 Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence 41749-41779 1 0.968
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_KX118105 Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence 51224-51254 1 0.968
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_KX118105 Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence 53879-53909 1 0.968
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP037425 Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence 4139-4169 1 0.968
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP037425 Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence 4336-4366 1 0.968
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP037425 Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence 4533-4563 1 0.968
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP037425 Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence 4730-4760 1 0.968
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP037425 Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence 4927-4957 1 0.968
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP037425 Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence 5124-5154 1 0.968
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP037425 Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence 5321-5351 1 0.968
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 42561-42591 1 0.968
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP034096 Acinetobacter baumannii strain A52 plasmid pA52-4, complete sequence 3359-3390 1 0.969
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_KX118105 Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence 105-136 1 0.969
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_KX118105 Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence 41391-41422 1 0.969
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_KX118105 Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence 41551-41582 1 0.969
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_KX118105 Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence 41749-41780 1 0.969
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_KX118105 Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence 51224-51255 1 0.969
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_KX118105 Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence 53879-53910 1 0.969
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP037425 Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence 4139-4170 1 0.969
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP037425 Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence 4336-4367 1 0.969
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP037425 Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence 4533-4564 1 0.969
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP037425 Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence 4730-4761 1 0.969
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP037425 Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence 4927-4958 1 0.969
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP037425 Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence 5124-5155 1 0.969
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP037425 Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence 5321-5352 1 0.969
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 42561-42592 1 0.969
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 70-100 2 0.935
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 267-297 2 0.935
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 464-494 2 0.935
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 661-691 2 0.935
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 858-888 2 0.935
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 1055-1085 2 0.935
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 1252-1282 2 0.935
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 1449-1479 2 0.935
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 1646-1676 2 0.935
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 1843-1873 2 0.935
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 2040-2070 2 0.935
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 2237-2267 2 0.935
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 2434-2464 2 0.935
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 70-101 2 0.938
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 267-298 2 0.938
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 464-495 2 0.938
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 661-692 2 0.938
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 858-889 2 0.938
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 1055-1086 2 0.938
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 1252-1283 2 0.938
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 1449-1480 2 0.938
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 1646-1677 2 0.938
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 1843-1874 2 0.938
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 2040-2071 2 0.938
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 2237-2268 2 0.938
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_CP032117 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence 2434-2465 2 0.938
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP030107 Acinetobacter baumannii strain DA33382 plasmid pDA33382-2-2, complete sequence 289-319 3 0.903
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP016903 Acinetobacter soli strain GFJ2 plasmid pGFJ7, complete sequence 3743-3773 3 0.903
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP030107 Acinetobacter baumannii strain DA33382 plasmid pDA33382-2-2, complete sequence 288-319 3 0.906
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP016903 Acinetobacter soli strain GFJ2 plasmid pGFJ7, complete sequence 3742-3773 3 0.906
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 AP013736 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S46-C31, *** SEQUENCING IN PROGRESS *** 34237-34268 6 0.812
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 AP013728 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S24-C174, *** SEQUENCING IN PROGRESS *** 2413-2444 6 0.812
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 AP013730 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S30-C21, *** SEQUENCING IN PROGRESS *** 431-462 6 0.812
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 AP013733 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S37-C24, *** SEQUENCING IN PROGRESS *** 7782-7813 6 0.812
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 AP013735 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S43-C92, *** SEQUENCING IN PROGRESS *** 9213-9244 6 0.812
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 AP013444 Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-C32A-MedDCM-OCT-S40-C23 30779-30810 6 0.812
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 AP013734 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S39-C27, *** SEQUENCING IN PROGRESS *** 24278-24309 6 0.812
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 AP013731 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S32-C100, *** SEQUENCING IN PROGRESS *** 19835-19866 6 0.812
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 AP013729 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S27-C31, *** SEQUENCING IN PROGRESS *** 28424-28455 6 0.812
NZ_CP044458_1 1.3|46279|31|NZ_CP044458|CRISPRCasFinder 46279-46309 31 NZ_CP045822 Bacillus subtilis strain MB8_B7 plasmid pBs001, complete sequence 19647-19677 7 0.774
NZ_CP044458_1 1.3|46279|31|NZ_CP044458|CRISPRCasFinder 46279-46309 31 NZ_CP045813 Bacillus subtilis strain P8_B3 plasmid pBs005, complete sequence 10921-10951 7 0.774
NZ_CP044458_1 1.3|46279|31|NZ_CP044458|CRISPRCasFinder 46279-46309 31 NZ_CP041758 Bacillus sp. KBS0812 plasmid unnamed, complete sequence 43199-43229 7 0.774
NZ_CP044458_1 1.3|46279|31|NZ_CP044458|CRISPRCasFinder 46279-46309 31 NC_021809 Bacillus subtilis subsp. subtilis str. NCIB 3610 plasmid pBS32, complete sequence 13998-14028 7 0.774
NZ_CP044458_1 1.3|46279|31|NZ_CP044458|CRISPRCasFinder 46279-46309 31 NZ_CP020103 Bacillus subtilis strain NCIB 3610 plasmid pBS32, complete sequence 5409-5439 7 0.774
NZ_CP044458_1 1.3|46279|31|NZ_CP044458|CRISPRCasFinder 46279-46309 31 NZ_CP034485 Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 strain NCIB 3610 plasmid unnamed, complete sequence 53780-53810 7 0.774
NZ_CP044458_1 1.3|46279|31|NZ_CP044458|CRISPRCasFinder 46279-46309 31 NZ_CP045923 Bacillus subtilis strain P8_B1 plasmid pBs003, complete sequence 11020-11050 7 0.774
NZ_CP044458_1 1.3|46279|31|NZ_CP044458|CRISPRCasFinder 46279-46309 31 NZ_AP019715 Bacillus subtilis subsp. subtilis strain NBRC 13719 plasmid pBSU1, complete sequence 65213-65243 7 0.774
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_MK275621 Clostridium perfringens strain JXJA17 plasmid p3, complete sequence 29131-29161 7 0.774
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP013041 Clostridium perfringens strain JP55 plasmid pJFP55F, complete sequence 45555-45585 7 0.774
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 MN693353 Marine virus AFVG_25M425, complete genome 19044-19074 7 0.774
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 MN693547 Marine virus AFVG_25M424, complete genome 11685-11715 7 0.774
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 MN693598 Marine virus AFVG_25M403, complete genome 8685-8715 7 0.774
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 MN693297 Marine virus AFVG_25M423, complete genome 7779-7809 7 0.774
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 NZ_CP028874 Borreliella bavariensis PBi plasmid lp25_cp32-3, complete sequence 18259-18289 7 0.774
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 NC_017225 Borreliella afzelii PKo plasmid cp32-12, complete sequence 27000-27030 7 0.774
NZ_CP044458_1 1.10|46700|32|NZ_CP044458|CRISPRCasFinder 46700-46731 32 NZ_CP044485 Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence 15099-15130 7 0.781
NZ_CP044458_1 1.10|46700|32|NZ_CP044458|CRISPRCasFinder 46700-46731 32 KT325596 Uncultured bacterium plasmid pFK2-7, complete sequence 4578-4609 7 0.781
NZ_CP044458_1 1.10|46700|32|NZ_CP044458|CRISPRCasFinder 46700-46731 32 NZ_CP038024 Acinetobacter radioresistens strain DD78 plasmid pAR2, complete sequence 31558-31589 7 0.781
NZ_CP044458_1 1.10|46700|32|NZ_CP044458|CRISPRCasFinder 46700-46731 32 NZ_CP010903 Acinetobacter nosocomialis strain 6411 plasmid p6411-66.409kb, complete sequence 27366-27397 7 0.781
NZ_CP044458_1 1.10|46700|32|NZ_CP044458|CRISPRCasFinder 46700-46731 32 MK978162 Acinetobacter lwoffii strain M2a plasmid pAVAci14, complete sequence 31669-31700 7 0.781
NZ_CP044458_1 1.10|46700|32|NZ_CP044458|CRISPRCasFinder 46700-46731 32 NZ_CP051870 Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_1, complete sequence 29567-29598 7 0.781
NZ_CP044458_1 1.10|46700|32|NZ_CP044458|CRISPRCasFinder 46700-46731 32 NC_019217 Uncultured bacterium HHV216 plasmid pHHV216, complete sequence 4551-4582 7 0.781
NZ_CP044458_1 1.10|46700|32|NZ_CP044458|CRISPRCasFinder 46700-46731 32 NC_019218 Uncultured bacterium HHV35 plasmid pHHV35, complete sequence 4749-4780 7 0.781
NZ_CP044458_1 1.10|46700|32|NZ_CP044458|CRISPRCasFinder 46700-46731 32 NC_019299 Uncultured bacterium HH1107 plasmid pHH1107, complete sequence 4551-4582 7 0.781
NZ_CP044458_1 1.10|46700|32|NZ_CP044458|CRISPRCasFinder 46700-46731 32 NZ_CP044465 Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-2, complete sequence 8125-8156 7 0.781
NZ_CP044458_1 1.10|46700|32|NZ_CP044458|CRISPRCasFinder 46700-46731 32 NZ_CP041290 Acinetobacter indicus strain 94-2 plasmid p94-2-tetX3, complete sequence 1751-1782 7 0.781
NZ_CP044458_1 1.13|46881|31|NZ_CP044458|CRISPRCasFinder 46881-46911 31 MT188223 Acinetobacter phage vB_AbaM_D22, complete genome 92045-92075 7 0.774
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_MK275621 Clostridium perfringens strain JXJA17 plasmid p3, complete sequence 29131-29162 7 0.781
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP013041 Clostridium perfringens strain JP55 plasmid pJFP55F, complete sequence 45555-45586 7 0.781
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP009059 Borreliella afzelii K78 plasmid lp54, complete sequence 45560-45591 7 0.781
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP009214 Borreliella afzelii Tom3107 plasmid lp54, complete sequence 12704-12735 7 0.781
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NC_017241 Borreliella afzelii PKo plasmid lp54, complete sequence 45418-45449 7 0.781
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 NZ_CP028874 Borreliella bavariensis PBi plasmid lp25_cp32-3, complete sequence 18258-18289 7 0.781
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 NC_017225 Borreliella afzelii PKo plasmid cp32-12, complete sequence 27000-27031 7 0.781
NZ_CP044458_1 1.4|46339|31|NZ_CP044458|CRISPRCasFinder 46339-46369 31 NZ_CP046704 Nostoc sp. ATCC 53789 plasmid pNsp_a, complete sequence 331618-331648 8 0.742
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP013040 Clostridium perfringens strain JP838 plasmid pJFP838C, complete sequence 54857-54887 8 0.742
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP029156 Clostridioides difficile strain CD161 plasmid unnamed2, complete sequence 17130-17160 8 0.742
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP029153 Clostridioides difficile strain CDT4 plasmid unnamed1, complete sequence 11174-11204 8 0.742
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP015841 Chlamydia gallinacea 08-1274/3 plasmid p1274, complete sequence 3899-3929 8 0.742
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP020425 Clostridioides difficile strain FDAARGOS_267 plasmid unnamed1, complete sequence 29617-29647 8 0.742
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 FN668942 Clostridium difficile BI1 plasmid pCDBI1, complete sequence 28261-28291 8 0.742
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP033574 Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence 119828-119858 8 0.742
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP019793 Chlamydia gallinacea strain JX-1 plasmid pJX1, complete sequence 4839-4869 8 0.742
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP011969 Clostridioides difficile ATCC 9689 = DSM 1296 plasmid unnamed, complete sequence 24939-24969 8 0.742
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 AP014358 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C94, *** SEQUENCING IN PROGRESS *** 28868-28898 8 0.742
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 NZ_KX832926 Providencia rettgeri strain 16pre36 plasmid p16Pre36-1, complete sequence 21905-21935 8 0.742
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 NZ_CP026061 Proteus mirabilis strain FDAARGOS_80 plasmid unnamed2, complete sequence 17429-17459 8 0.742
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 NC_010555 Proteus mirabilis HI4320 plasmid pHI4320, complete sequence 15848-15878 8 0.742
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 NZ_CP021855 Proteus mirabilis strain AR_0156 plasmid unitig_3, complete sequence 16183-16213 8 0.742
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 NZ_MK941846 Proteus mirabilis strain PM1157 plasmid pOXA-23, complete sequence 51543-51573 8 0.742
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 NZ_MF150117 Proteus mirabilis strain A64421 plasmid pPM64421b, complete sequence 14992-15022 8 0.742
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 MN693756 Marine virus AFVG_250M718, complete genome 29702-29732 8 0.742
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 MN694439 Marine virus AFVG_250M296, complete genome 29296-29326 8 0.742
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 MN693803 Marine virus AFVG_250M716, complete genome 7503-7533 8 0.742
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 MN694282 Marine virus AFVG_250M297, complete genome 29308-29338 8 0.742
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 MN694541 Marine virus AFVG_250M717, complete genome 29711-29741 8 0.742
NZ_CP044458_1 1.8|46579|31|NZ_CP044458|CRISPRCasFinder 46579-46609 31 MK759884 Salmonella phage vB_SenM_SB18, complete genome 69601-69631 8 0.742
NZ_CP044458_1 1.8|46579|31|NZ_CP044458|CRISPRCasFinder 46579-46609 31 NC_015292 Erwinia phage phiEa104, complete genome 69346-69376 8 0.742
NZ_CP044458_1 1.8|46579|31|NZ_CP044458|CRISPRCasFinder 46579-46609 31 MH426725 Erwinia phage SunLIRen, complete genome 69342-69372 8 0.742
NZ_CP044458_1 1.8|46579|31|NZ_CP044458|CRISPRCasFinder 46579-46609 31 FQ482083 Erwinia amylovora phage phiEa104 complete genome 69346-69376 8 0.742
NZ_CP044458_1 1.8|46579|31|NZ_CP044458|CRISPRCasFinder 46579-46609 31 HQ728263 Erwinia phage vB_EamM-M7, complete genome 52322-52352 8 0.742
NZ_CP044458_1 1.8|46579|31|NZ_CP044458|CRISPRCasFinder 46579-46609 31 NC_011811 Erwinia phage phiEa21-4, complete genome 69359-69389 8 0.742
NZ_CP044458_1 1.8|46579|31|NZ_CP044458|CRISPRCasFinder 46579-46609 31 MN604407 Salmonella phage ST-3, complete genome 43189-43219 8 0.742
NZ_CP044458_1 1.8|46579|31|NZ_CP044458|CRISPRCasFinder 46579-46609 31 MK770412 Salmonella phage SE5, complete genome 15441-15471 8 0.742
NZ_CP044458_1 1.9|46639|32|NZ_CP044458|CRISPRCasFinder 46639-46670 32 MN694484 Marine virus AFVG_250M1201, complete genome 16742-16773 8 0.75
NZ_CP044458_1 1.12|46821|31|NZ_CP044458|CRISPRCasFinder 46821-46851 31 NZ_AP017978 Neochlamydia sp. S13 plasmid pS13, complete sequence 227429-227459 8 0.742
NZ_CP044458_1 1.15|46159|32|NZ_CP044458|PILER-CR,CRT 46159-46190 32 AP018320 Nostoc sp. HK-01 plasmid plasmid2 DNA, complete genome 130534-130565 8 0.75
NZ_CP044458_1 1.15|46159|32|NZ_CP044458|PILER-CR,CRT 46159-46190 32 MN180251 UNVERIFIED: Wolbachia phage WO isolate Seq2wOMel_KL2 genomic sequence 81265-81296 8 0.75
NZ_CP044458_1 1.17|46279|32|NZ_CP044458|PILER-CR,CRT 46279-46310 32 NZ_CP045822 Bacillus subtilis strain MB8_B7 plasmid pBs001, complete sequence 19647-19678 8 0.75
NZ_CP044458_1 1.17|46279|32|NZ_CP044458|PILER-CR,CRT 46279-46310 32 NZ_CP045813 Bacillus subtilis strain P8_B3 plasmid pBs005, complete sequence 10921-10952 8 0.75
NZ_CP044458_1 1.17|46279|32|NZ_CP044458|PILER-CR,CRT 46279-46310 32 NZ_CP041758 Bacillus sp. KBS0812 plasmid unnamed, complete sequence 43199-43230 8 0.75
NZ_CP044458_1 1.17|46279|32|NZ_CP044458|PILER-CR,CRT 46279-46310 32 NC_021809 Bacillus subtilis subsp. subtilis str. NCIB 3610 plasmid pBS32, complete sequence 13998-14029 8 0.75
NZ_CP044458_1 1.17|46279|32|NZ_CP044458|PILER-CR,CRT 46279-46310 32 NZ_CP020103 Bacillus subtilis strain NCIB 3610 plasmid pBS32, complete sequence 5409-5440 8 0.75
NZ_CP044458_1 1.17|46279|32|NZ_CP044458|PILER-CR,CRT 46279-46310 32 NZ_AP019715 Bacillus subtilis subsp. subtilis strain NBRC 13719 plasmid pBSU1, complete sequence 65212-65243 8 0.75
NZ_CP044458_1 1.17|46279|32|NZ_CP044458|PILER-CR,CRT 46279-46310 32 NZ_CP034485 Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 strain NCIB 3610 plasmid unnamed, complete sequence 53780-53811 8 0.75
NZ_CP044458_1 1.17|46279|32|NZ_CP044458|PILER-CR,CRT 46279-46310 32 NZ_CP045923 Bacillus subtilis strain P8_B1 plasmid pBs003, complete sequence 11020-11051 8 0.75
NZ_CP044458_1 1.18|46339|32|NZ_CP044458|PILER-CR,CRT 46339-46370 32 NZ_CP046704 Nostoc sp. ATCC 53789 plasmid pNsp_a, complete sequence 331618-331649 8 0.75
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP013040 Clostridium perfringens strain JP838 plasmid pJFP838C, complete sequence 54856-54887 8 0.75
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP033574 Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence 119828-119859 8 0.75
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP019793 Chlamydia gallinacea strain JX-1 plasmid pJX1, complete sequence 4839-4870 8 0.75
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP015841 Chlamydia gallinacea 08-1274/3 plasmid p1274, complete sequence 3898-3929 8 0.75
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 MN693547 Marine virus AFVG_25M424, complete genome 11685-11716 8 0.75
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 MK387309 Pseudoalteromonas phage C7, complete genome 32705-32736 8 0.75
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 MN693598 Marine virus AFVG_25M403, complete genome 8685-8716 8 0.75
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 MN693297 Marine virus AFVG_25M423, complete genome 7779-7810 8 0.75
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 MN693353 Marine virus AFVG_25M425, complete genome 19043-19074 8 0.75
NZ_CP044458_1 1.22|46579|32|NZ_CP044458|PILER-CR,CRT 46579-46610 32 MK759884 Salmonella phage vB_SenM_SB18, complete genome 69600-69631 8 0.75
NZ_CP044458_1 1.22|46579|32|NZ_CP044458|PILER-CR,CRT 46579-46610 32 NC_015292 Erwinia phage phiEa104, complete genome 69345-69376 8 0.75
NZ_CP044458_1 1.22|46579|32|NZ_CP044458|PILER-CR,CRT 46579-46610 32 MH426725 Erwinia phage SunLIRen, complete genome 69341-69372 8 0.75
NZ_CP044458_1 1.22|46579|32|NZ_CP044458|PILER-CR,CRT 46579-46610 32 FQ482083 Erwinia amylovora phage phiEa104 complete genome 69345-69376 8 0.75
NZ_CP044458_1 1.22|46579|32|NZ_CP044458|PILER-CR,CRT 46579-46610 32 HQ728263 Erwinia phage vB_EamM-M7, complete genome 52321-52352 8 0.75
NZ_CP044458_1 1.22|46579|32|NZ_CP044458|PILER-CR,CRT 46579-46610 32 NC_011811 Erwinia phage phiEa21-4, complete genome 69358-69389 8 0.75
NZ_CP044458_1 1.22|46579|32|NZ_CP044458|PILER-CR,CRT 46579-46610 32 MN604407 Salmonella phage ST-3, complete genome 43188-43219 8 0.75
NZ_CP044458_1 1.22|46579|32|NZ_CP044458|PILER-CR,CRT 46579-46610 32 MK770412 Salmonella phage SE5, complete genome 15440-15471 8 0.75
NZ_CP044458_1 1.27|46881|32|NZ_CP044458|PILER-CR,CRT 46881-46912 32 MT188223 Acinetobacter phage vB_AbaM_D22, complete genome 92045-92076 8 0.75
NZ_CP044458_1 1.3|46279|31|NZ_CP044458|CRISPRCasFinder 46279-46309 31 MF360958 Salicola phage SCTP-2, complete genome 96486-96516 9 0.71
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 LC425518 Uncultured phage DNA, contig: NODE577 3862-3892 9 0.71
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP045351 Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence 365616-365646 9 0.71
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 MK387309 Pseudoalteromonas phage C7, complete genome 32706-32736 9 0.71
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 KY065496 Streptococcus phage IPP60, complete genome 3617-3647 9 0.71
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 KY065466 Streptococcus phage IPP25, complete genome 3780-3810 9 0.71
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 KY065476 Streptococcus phage IPP36, complete genome 3880-3910 9 0.71
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 KY065475 Streptococcus phage IPP35, complete genome 3481-3511 9 0.71
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 KY065472 Streptococcus phage IPP31, complete genome 3617-3647 9 0.71
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 KT337353 Streptococcus phage phiARI0460-2, partial genome 38047-38077 9 0.71
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 KY065474 Streptococcus phage IPP34, complete genome 3619-3649 9 0.71
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 KY065477 Streptococcus phage IPP37, partial genome 3481-3511 9 0.71
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 KT337349 Streptococcus phage phiARI0399, partial genome 36521-36551 9 0.71
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 KY065452 Streptococcus phage IPP10, complete genome 3617-3647 9 0.71
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 KY065499 Streptococcus phage IPP63, complete genome 4692-4722 9 0.71
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 KY065473 Streptococcus phage IPP32, complete genome 4642-4672 9 0.71
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 KT337356 Streptococcus phage phiARI0468-2, complete genome 38187-38217 9 0.71
NZ_CP044458_1 1.7|46519|31|NZ_CP044458|CRISPRCasFinder 46519-46549 31 KY065450 Streptococcus phage IPP8, complete genome 3619-3649 9 0.71
NZ_CP044458_1 1.8|46579|31|NZ_CP044458|CRISPRCasFinder 46579-46609 31 NC_014838 Pantoea sp. At-9b plasmid pPAT9B01, complete sequence 299165-299195 9 0.71
NZ_CP044458_1 1.10|46700|32|NZ_CP044458|CRISPRCasFinder 46700-46731 32 NC_007410 Trichormus variabilis ATCC 29413 plasmid A, complete sequence 139650-139681 9 0.719
NZ_CP044458_1 1.10|46700|32|NZ_CP044458|CRISPRCasFinder 46700-46731 32 NZ_CP047243 Trichormus variabilis 0441 plasmid unnamed1, complete sequence 145687-145718 9 0.719
NZ_CP044458_1 1.17|46279|32|NZ_CP044458|PILER-CR,CRT 46279-46310 32 MF360958 Salicola phage SCTP-2, complete genome 96486-96517 9 0.719
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP020425 Clostridioides difficile strain FDAARGOS_267 plasmid unnamed1, complete sequence 29617-29648 9 0.719
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP029156 Clostridioides difficile strain CD161 plasmid unnamed2, complete sequence 17129-17160 9 0.719
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP029153 Clostridioides difficile strain CDT4 plasmid unnamed1, complete sequence 11173-11204 9 0.719
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 FN668942 Clostridium difficile BI1 plasmid pCDBI1, complete sequence 28261-28292 9 0.719
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP011969 Clostridioides difficile ATCC 9689 = DSM 1296 plasmid unnamed, complete sequence 24939-24970 9 0.719
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP045351 Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence 365616-365647 9 0.719
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 AP014358 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C94, *** SEQUENCING IN PROGRESS *** 28867-28898 9 0.719
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 655574-655605 9 0.719
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 NZ_KX832926 Providencia rettgeri strain 16pre36 plasmid p16Pre36-1, complete sequence 21904-21935 9 0.719
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 NZ_CP026061 Proteus mirabilis strain FDAARGOS_80 plasmid unnamed2, complete sequence 17428-17459 9 0.719
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 NC_010555 Proteus mirabilis HI4320 plasmid pHI4320, complete sequence 15848-15879 9 0.719
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 NZ_CP021855 Proteus mirabilis strain AR_0156 plasmid unitig_3, complete sequence 16183-16214 9 0.719
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 NZ_MK941846 Proteus mirabilis strain PM1157 plasmid pOXA-23, complete sequence 51542-51573 9 0.719
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 NZ_MF150117 Proteus mirabilis strain A64421 plasmid pPM64421b, complete sequence 14991-15022 9 0.719
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 MN693756 Marine virus AFVG_250M718, complete genome 29701-29732 9 0.719
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 MN694439 Marine virus AFVG_250M296, complete genome 29295-29326 9 0.719
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 MN693803 Marine virus AFVG_250M716, complete genome 7503-7534 9 0.719
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 MN694282 Marine virus AFVG_250M297, complete genome 29307-29338 9 0.719
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 MN694541 Marine virus AFVG_250M717, complete genome 29710-29741 9 0.719
NZ_CP044458_1 1.26|46821|32|NZ_CP044458|PILER-CR,CRT 46821-46852 32 NZ_AP017978 Neochlamydia sp. S13 plasmid pS13, complete sequence 227428-227459 9 0.719
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP045351 Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence 898363-898393 10 0.677
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 KC465899 Pelagibacter phage HTVC008M, complete genome 145762-145792 10 0.677
NZ_CP044458_1 1.11|46761|31|NZ_CP044458|CRISPRCasFinder 46761-46791 31 NZ_MF078634 Acinetobacter pittii strain HGSA488 plasmid pLS488, complete sequence 1-22 10 0.677
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 KY065496 Streptococcus phage IPP60, complete genome 3617-3648 10 0.688
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 KY065466 Streptococcus phage IPP25, complete genome 3780-3811 10 0.688
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 KY065476 Streptococcus phage IPP36, complete genome 3880-3911 10 0.688
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 KY065475 Streptococcus phage IPP35, complete genome 3481-3512 10 0.688
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 KY065472 Streptococcus phage IPP31, complete genome 3617-3648 10 0.688
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 KT337353 Streptococcus phage phiARI0460-2, partial genome 38046-38077 10 0.688
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 KY065474 Streptococcus phage IPP34, complete genome 3619-3650 10 0.688
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 KY065477 Streptococcus phage IPP37, partial genome 3481-3512 10 0.688
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 KT337349 Streptococcus phage phiARI0399, partial genome 36520-36551 10 0.688
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 KY065452 Streptococcus phage IPP10, complete genome 3617-3648 10 0.688
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 KY065499 Streptococcus phage IPP63, complete genome 4692-4723 10 0.688
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 KY065473 Streptococcus phage IPP32, complete genome 4642-4673 10 0.688
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 KT337356 Streptococcus phage phiARI0468-2, complete genome 38186-38217 10 0.688
NZ_CP044458_1 1.21|46519|32|NZ_CP044458|PILER-CR,CRT 46519-46550 32 KY065450 Streptococcus phage IPP8, complete genome 3619-3650 10 0.688
NZ_CP044458_1 1.22|46579|32|NZ_CP044458|PILER-CR,CRT 46579-46610 32 NC_014838 Pantoea sp. At-9b plasmid pPAT9B01, complete sequence 299164-299195 10 0.688
NZ_CP044458_1 1.25|46761|32|NZ_CP044458|PILER-CR,CRT 46761-46792 32 NZ_MF078634 Acinetobacter pittii strain HGSA488 plasmid pLS488, complete sequence 1-23 10 0.688
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NC_025097 Uncultured bacterium AST2 plasmid pAST2, complete sequence 11868-11898 11 0.645
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 MN657042 Psychrobacter sp. strain ANT_P18B plasmid pA18BP1, complete sequence 71-101 11 0.645
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 MN657064 Psychrobacter sp. strain ANT_P27 plasmid pA27P4, complete sequence 63-93 11 0.645
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 MN657067 Psychrobacter sp. strain ANT_P28 plasmid pA28P3, complete sequence 170-200 11 0.645
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 MN657076 Psychrobacter sp. strain ANT_P39B plasmid pA39BP2, complete sequence 71-101 11 0.645
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 MN657088 Psychrobacter sp. strain ANT_H3 plasmid pA3H8, complete sequence 71-101 11 0.645
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 MN657111 Psychrobacter sp. strain ANT_P52 plasmid pA52P3, complete sequence 72-102 11 0.645
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NC_021158 Psychrobacter maritimus plasmid pKLH80, strain MR29-12, complete sequence 1050-1080 11 0.645
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP012537 Psychrobacter sp. P11G5 plasmid pPspP11G5d, complete sequence 37-67 11 0.645
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NZ_CP012540 Psychrobacter sp. P11G5 plasmid pPspP11G5g, complete sequence 44-74 11 0.645
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NZ_CP045351 Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence 898362-898393 11 0.656
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 KC465899 Pelagibacter phage HTVC008M, complete genome 145761-145792 11 0.656
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 MN657102 Psychrobacter sp. strain ANT_P46 plasmid pA46P4, complete sequence 71-101 12 0.613
NZ_CP044458_1 1.6|46459|31|NZ_CP044458|CRISPRCasFinder 46459-46489 31 NC_015979 Lactobacillus sanfranciscensis TMW 1.1304 plasmid pLS1, complete sequence 49832-49862 14 0.548
NZ_CP044458_1 1.20|46459|32|NZ_CP044458|PILER-CR,CRT 46459-46490 32 NC_015979 Lactobacillus sanfranciscensis TMW 1.1304 plasmid pLS1, complete sequence 49832-49863 14 0.562

1. spacer 1.1|46159|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

gactaaacgtagattttttaagtaatattca	CRISPR spacer
gactaaacgtagattttttaagtaatattca	Protospacer
*******************************

2. spacer 1.1|46159|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

gactaaacgtagattttttaagtaatattca	CRISPR spacer
gactaaacgtagattttttaagtaatattca	Protospacer
*******************************

3. spacer 1.2|46219|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaacatgcaatttgagggcttctgcgcgc	CRISPR spacer
cgaaacatgcaatttgagggcttctgcgcgc	Protospacer
*******************************

4. spacer 1.2|46219|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaacatgcaatttgagggcttctgcgcgc	CRISPR spacer
cgaaacatgcaatttgagggcttctgcgcgc	Protospacer
*******************************

5. spacer 1.3|46279|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

atgaaaatttgatggctgtttgatgattggg	CRISPR spacer
atgaaaatttgatggctgtttgatgattggg	Protospacer
*******************************

6. spacer 1.3|46279|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

atgaaaatttgatggctgtttgatgattggg	CRISPR spacer
atgaaaatttgatggctgtttgatgattggg	Protospacer
*******************************

7. spacer 1.4|46339|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggatgaacaaacatgcttttcaattactgca	CRISPR spacer
ggatgaacaaacatgcttttcaattactgca	Protospacer
*******************************

8. spacer 1.4|46339|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggatgaacaaacatgcttttcaattactgca	CRISPR spacer
ggatgaacaaacatgcttttcaattactgca	Protospacer
*******************************

9. spacer 1.5|46399|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

catatgattgtttatatcgttccgtttgacg	CRISPR spacer
catatgattgtttatatcgttccgtttgacg	Protospacer
*******************************

10. spacer 1.5|46399|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

catatgattgtttatatcgttccgtttgacg	CRISPR spacer
catatgattgtttatatcgttccgtttgacg	Protospacer
*******************************

11. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaagcttttcttttatta	Protospacer
*******************************

12. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaagcttttcttttatta	Protospacer
*******************************

13. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagcagaaaggaaaatagcacta	Protospacer
*******************************

14. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagcagaaaggaaaatagcacta	Protospacer
*******************************

15. spacer 1.8|46579|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

ccccctttctgcaacgtcacccccttttgtc	CRISPR spacer
ccccctttctgcaacgtcacccccttttgtc	Protospacer
*******************************

16. spacer 1.8|46579|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccccctttctgcaacgtcacccccttttgtc	CRISPR spacer
ccccctttctgcaacgtcacccccttttgtc	Protospacer
*******************************

17. spacer 1.9|46639|32|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

atgcaattattaattcatacaaacggattgca	CRISPR spacer
atgcaattattaattcatacaaacggattgca	Protospacer
********************************

18. spacer 1.9|46639|32|NZ_CP044458|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

atgcaattattaattcatacaaacggattgca	CRISPR spacer
atgcaattattaattcatacaaacggattgca	Protospacer
********************************

19. spacer 1.10|46700|32|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

ttatgcttggtggacagcaatttgttttactt	CRISPR spacer
ttatgcttggtggacagcaatttgttttactt	Protospacer
********************************

20. spacer 1.10|46700|32|NZ_CP044458|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttatgcttggtggacagcaatttgttttactt	CRISPR spacer
ttatgcttggtggacagcaatttgttttactt	Protospacer
********************************

21. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatacttaacctgggcc	Protospacer
*******************************

22. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatacttaacctgggcc	Protospacer
*******************************

23. spacer 1.12|46821|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggggccagccgaacaaattaaattagcaag	CRISPR spacer
aggggccagccgaacaaattaaattagcaag	Protospacer
*******************************

24. spacer 1.12|46821|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

aggggccagccgaacaaattaaattagcaag	CRISPR spacer
aggggccagccgaacaaattaaattagcaag	Protospacer
*******************************

25. spacer 1.13|46881|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtcaaaagttatggaaaagttttgaagcttg	CRISPR spacer
gtcaaaagttatggaaaagttttgaagcttg	Protospacer
*******************************

26. spacer 1.13|46881|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcaaaagttatggaaaagttttgaagcttg	CRISPR spacer
gtcaaaagttatggaaaagttttgaagcttg	Protospacer
*******************************

27. spacer 1.14|46941|26|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtaaaacaagttgactgttactt	CRISPR spacer
tttgtaaaacaagttgactgttactt	Protospacer
**************************

28. spacer 1.14|46941|26|NZ_CP044458|CRISPRCasFinder matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtaaaacaagttgactgttactt	CRISPR spacer
tttgtaaaacaagttgactgttactt	Protospacer
**************************

29. spacer 1.15|46159|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

gactaaacgtagattttttaagtaatattcaa	CRISPR spacer
gactaaacgtagattttttaagtaatattcaa	Protospacer
********************************

30. spacer 1.15|46159|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

gactaaacgtagattttttaagtaatattcaa	CRISPR spacer
gactaaacgtagattttttaagtaatattcaa	Protospacer
********************************

31. spacer 1.16|46219|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaacatgcaatttgagggcttctgcgcgca	CRISPR spacer
cgaaacatgcaatttgagggcttctgcgcgca	Protospacer
********************************

32. spacer 1.16|46219|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaacatgcaatttgagggcttctgcgcgca	CRISPR spacer
cgaaacatgcaatttgagggcttctgcgcgca	Protospacer
********************************

33. spacer 1.17|46279|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

atgaaaatttgatggctgtttgatgattggga	CRISPR spacer
atgaaaatttgatggctgtttgatgattggga	Protospacer
********************************

34. spacer 1.17|46279|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

atgaaaatttgatggctgtttgatgattggga	CRISPR spacer
atgaaaatttgatggctgtttgatgattggga	Protospacer
********************************

35. spacer 1.18|46339|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggatgaacaaacatgcttttcaattactgcaa	CRISPR spacer
ggatgaacaaacatgcttttcaattactgcaa	Protospacer
********************************

36. spacer 1.18|46339|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggatgaacaaacatgcttttcaattactgcaa	CRISPR spacer
ggatgaacaaacatgcttttcaattactgcaa	Protospacer
********************************

37. spacer 1.19|46399|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

catatgattgtttatatcgttccgtttgacga	CRISPR spacer
catatgattgtttatatcgttccgtttgacga	Protospacer
********************************

38. spacer 1.19|46399|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

catatgattgtttatatcgttccgtttgacga	CRISPR spacer
catatgattgtttatatcgttccgtttgacga	Protospacer
********************************

39. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
ttaaaagcatttaaaagcttttcttttattaa	Protospacer
********************************

40. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
ttaaaagcatttaaaagcttttcttttattaa	Protospacer
********************************

41. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagcagaaaggaaaatagcactag	Protospacer
********************************

42. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagcagaaaggaaaatagcactag	Protospacer
********************************

43. spacer 1.22|46579|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

ccccctttctgcaacgtcacccccttttgtct	CRISPR spacer
ccccctttctgcaacgtcacccccttttgtct	Protospacer
********************************

44. spacer 1.22|46579|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccccctttctgcaacgtcacccccttttgtct	CRISPR spacer
ccccctttctgcaacgtcacccccttttgtct	Protospacer
********************************

45. spacer 1.23|46639|33|NZ_CP044458|PILER-CR,CRT matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

atgcaattattaattcatacaaacggattgcat	CRISPR spacer
atgcaattattaattcatacaaacggattgcat	Protospacer
*********************************

46. spacer 1.23|46639|33|NZ_CP044458|PILER-CR,CRT matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

atgcaattattaattcatacaaacggattgcat	CRISPR spacer
atgcaattattaattcatacaaacggattgcat	Protospacer
*********************************

47. spacer 1.24|46700|33|NZ_CP044458|PILER-CR,CRT matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

ttatgcttggtggacagcaatttgttttacttg	CRISPR spacer
ttatgcttggtggacagcaatttgttttacttg	Protospacer
*********************************

48. spacer 1.24|46700|33|NZ_CP044458|PILER-CR,CRT matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttatgcttggtggacagcaatttgttttacttg	CRISPR spacer
ttatgcttggtggacagcaatttgttttacttg	Protospacer
*********************************

49. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatacttaacctgggcca	Protospacer
********************************

50. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatacttaacctgggcca	Protospacer
********************************

51. spacer 1.26|46821|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

aggggccagccgaacaaattaaattagcaaga	CRISPR spacer
aggggccagccgaacaaattaaattagcaaga	Protospacer
********************************

52. spacer 1.26|46821|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggggccagccgaacaaattaaattagcaaga	CRISPR spacer
aggggccagccgaacaaattaaattagcaaga	Protospacer
********************************

53. spacer 1.27|46881|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtcaaaagttatggaaaagttttgaagcttgg	CRISPR spacer
gtcaaaagttatggaaaagttttgaagcttgg	Protospacer
********************************

54. spacer 1.27|46881|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtcaaaagttatggaaaagttttgaagcttgg	CRISPR spacer
gtcaaaagttatggaaaagttttgaagcttgg	Protospacer
********************************

55. spacer 1.28|46941|27|NZ_CP044458|CRT matches to NZ_CP044458 (Acinetobacter indicus strain B18 plasmid pB18-3, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtaaaacaagttgactgttacttc	CRISPR spacer
tttgtaaaacaagttgactgttacttc	Protospacer
***************************

56. spacer 1.28|46941|27|NZ_CP044458|CRT matches to NZ_CP039144 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtaaaacaagttgactgttacttc	CRISPR spacer
tttgtaaaacaagttgactgttacttc	Protospacer
***************************

57. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP034096 (Acinetobacter baumannii strain A52 plasmid pA52-4, complete sequence) position: , mismatch: 1, identity: 0.968

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ctaaaagcatttaaaagcttttcttttatta	Protospacer
.******************************

58. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_KX118105 (Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence) position: , mismatch: 1, identity: 0.968

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcc	Protospacer
*****************.*************

59. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_KX118105 (Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence) position: , mismatch: 1, identity: 0.968

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcc	Protospacer
*****************.*************

60. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_KX118105 (Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence) position: , mismatch: 1, identity: 0.968

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcc	Protospacer
*****************.*************

61. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_KX118105 (Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence) position: , mismatch: 1, identity: 0.968

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcc	Protospacer
*****************.*************

62. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_KX118105 (Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence) position: , mismatch: 1, identity: 0.968

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcc	Protospacer
*****************.*************

63. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_KX118105 (Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence) position: , mismatch: 1, identity: 0.968

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcc	Protospacer
*****************.*************

64. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP037425 (Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence) position: , mismatch: 1, identity: 0.968

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcc	Protospacer
*****************.*************

65. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP037425 (Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence) position: , mismatch: 1, identity: 0.968

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcc	Protospacer
*****************.*************

66. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP037425 (Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence) position: , mismatch: 1, identity: 0.968

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcc	Protospacer
*****************.*************

67. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP037425 (Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence) position: , mismatch: 1, identity: 0.968

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcc	Protospacer
*****************.*************

68. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP037425 (Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence) position: , mismatch: 1, identity: 0.968

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcc	Protospacer
*****************.*************

69. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP037425 (Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence) position: , mismatch: 1, identity: 0.968

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcc	Protospacer
*****************.*************

70. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP037425 (Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence) position: , mismatch: 1, identity: 0.968

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcc	Protospacer
*****************.*************

71. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 1, identity: 0.968

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatacttaacctgagcc	Protospacer
***************************.***

72. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP034096 (Acinetobacter baumannii strain A52 plasmid pA52-4, complete sequence) position: , mismatch: 1, identity: 0.969

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
ctaaaagcatttaaaagcttttcttttattaa	Protospacer
.*******************************

73. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_KX118105 (Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence) position: , mismatch: 1, identity: 0.969

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcca	Protospacer
*****************.**************

74. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_KX118105 (Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence) position: , mismatch: 1, identity: 0.969

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcca	Protospacer
*****************.**************

75. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_KX118105 (Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence) position: , mismatch: 1, identity: 0.969

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcca	Protospacer
*****************.**************

76. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_KX118105 (Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence) position: , mismatch: 1, identity: 0.969

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcca	Protospacer
*****************.**************

77. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_KX118105 (Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence) position: , mismatch: 1, identity: 0.969

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcca	Protospacer
*****************.**************

78. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_KX118105 (Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence) position: , mismatch: 1, identity: 0.969

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcca	Protospacer
*****************.**************

79. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP037425 (Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence) position: , mismatch: 1, identity: 0.969

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcca	Protospacer
*****************.**************

80. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP037425 (Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence) position: , mismatch: 1, identity: 0.969

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcca	Protospacer
*****************.**************

81. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP037425 (Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence) position: , mismatch: 1, identity: 0.969

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcca	Protospacer
*****************.**************

82. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP037425 (Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence) position: , mismatch: 1, identity: 0.969

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcca	Protospacer
*****************.**************

83. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP037425 (Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence) position: , mismatch: 1, identity: 0.969

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcca	Protospacer
*****************.**************

84. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP037425 (Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence) position: , mismatch: 1, identity: 0.969

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcca	Protospacer
*****************.**************

85. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP037425 (Acinetobacter johnsonii strain M19 plasmid pFM-M19, complete sequence) position: , mismatch: 1, identity: 0.969

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcca	Protospacer
*****************.**************

86. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 1, identity: 0.969

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatacttaacctgagcca	Protospacer
***************************.****

87. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.935

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggct	Protospacer
*****************.************.

88. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.935

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggct	Protospacer
*****************.************.

89. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.935

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggct	Protospacer
*****************.************.

90. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.935

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggct	Protospacer
*****************.************.

91. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.935

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggct	Protospacer
*****************.************.

92. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.935

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggct	Protospacer
*****************.************.

93. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.935

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggct	Protospacer
*****************.************.

94. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.935

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggct	Protospacer
*****************.************.

95. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.935

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggct	Protospacer
*****************.************.

96. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.935

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggct	Protospacer
*****************.************.

97. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.935

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggct	Protospacer
*****************.************.

98. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.935

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatncttaacctgggct	Protospacer
***************** ************.

99. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.935

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
ttttgcctggtacacatgcttaacctgggct	Protospacer
*****************.************.

100. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.938

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcta	Protospacer
*****************.************.*

101. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.938

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcta	Protospacer
*****************.************.*

102. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.938

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcta	Protospacer
*****************.************.*

103. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.938

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcta	Protospacer
*****************.************.*

104. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.938

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcta	Protospacer
*****************.************.*

105. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.938

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcta	Protospacer
*****************.************.*

106. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.938

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcta	Protospacer
*****************.************.*

107. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.938

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcta	Protospacer
*****************.************.*

108. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.938

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcta	Protospacer
*****************.************.*

109. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.938

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcta	Protospacer
*****************.************.*

110. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.938

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcta	Protospacer
*****************.************.*

111. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.938

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatncttaacctgggcta	Protospacer
***************** ************.*

112. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP032117 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.2, complete sequence) position: , mismatch: 2, identity: 0.938

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
ttttgcctggtacacatgcttaacctgggcta	Protospacer
*****************.************.*

113. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP030107 (Acinetobacter baumannii strain DA33382 plasmid pDA33382-2-2, complete sequence) position: , mismatch: 3, identity: 0.903

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ctaaaagcatttaaaagcttttttattatta	Protospacer
.*********************.* ******

114. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP016903 (Acinetobacter soli strain GFJ2 plasmid pGFJ7, complete sequence) position: , mismatch: 3, identity: 0.903

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ctaaaagcatttaaaagcttttttattatta	Protospacer
.*********************.* ******

115. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP030107 (Acinetobacter baumannii strain DA33382 plasmid pDA33382-2-2, complete sequence) position: , mismatch: 3, identity: 0.906

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
ctaaaagcatttaaaagcttttttattattaa	Protospacer
.*********************.* *******

116. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP016903 (Acinetobacter soli strain GFJ2 plasmid pGFJ7, complete sequence) position: , mismatch: 3, identity: 0.906

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
ctaaaagcatttaaaagcttttttattattaa	Protospacer
.*********************.* *******

117. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to AP013736 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S46-C31, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.812

ttaaaagca--tttaaaagcttttcttttattaa	CRISPR spacer
--aacaccatctttaaaaacttttcttttataaa	Protospacer
  ** * **  *******.************ **

118. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to AP013728 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S24-C174, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.812

ttaaaagca--tttaaaagcttttcttttattaa	CRISPR spacer
--aacaccatctttaaaaacttttcttttataaa	Protospacer
  ** * **  *******.************ **

119. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to AP013730 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S30-C21, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.812

ttaaaagca--tttaaaagcttttcttttattaa	CRISPR spacer
--aacaccatctttaaaaacttttcttttataaa	Protospacer
  ** * **  *******.************ **

120. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to AP013733 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S37-C24, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.812

ttaaaagca--tttaaaagcttttcttttattaa	CRISPR spacer
--aacaccatctttaaaaacttttcttttataaa	Protospacer
  ** * **  *******.************ **

121. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to AP013735 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S43-C92, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.812

ttaaaagca--tttaaaagcttttcttttattaa	CRISPR spacer
--aacaccatctttaaaaacttttcttttataaa	Protospacer
  ** * **  *******.************ **

122. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to AP013444 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-C32A-MedDCM-OCT-S40-C23) position: , mismatch: 6, identity: 0.812

ttaaaagca--tttaaaagcttttcttttattaa	CRISPR spacer
--aacaccatctttaaaaacttttcttttataaa	Protospacer
  ** * **  *******.************ **

123. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to AP013734 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S39-C27, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.812

ttaaaagca--tttaaaagcttttcttttattaa	CRISPR spacer
--aacaccatctttaaaaacttttcttttataaa	Protospacer
  ** * **  *******.************ **

124. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to AP013731 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S32-C100, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.812

ttaaaagca--tttaaaagcttttcttttattaa	CRISPR spacer
--aacaccatctttaaaaacttttcttttataaa	Protospacer
  ** * **  *******.************ **

125. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to AP013729 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C32A-MedDCM-OCT-S27-C31, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.812

ttaaaagca--tttaaaagcttttcttttattaa	CRISPR spacer
--aacaccatctttaaaaacttttcttttataaa	Protospacer
  ** * **  *******.************ **

126. spacer 1.3|46279|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP045822 (Bacillus subtilis strain MB8_B7 plasmid pBs001, complete sequence) position: , mismatch: 7, identity: 0.774

atgaaaatttgatggctgtttgatgattggg	CRISPR spacer
attgaaattttatgtctgtttgatgatccag	Protospacer
** .****** *** ************. .*

127. spacer 1.3|46279|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP045813 (Bacillus subtilis strain P8_B3 plasmid pBs005, complete sequence) position: , mismatch: 7, identity: 0.774

atgaaaatttgatggctgtttgatgattggg	CRISPR spacer
attgaaattttatgtctgtttgatgatccag	Protospacer
** .****** *** ************. .*

128. spacer 1.3|46279|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP041758 (Bacillus sp. KBS0812 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

atgaaaatttgatggctgtttgatgattggg	CRISPR spacer
attgaaattttatgtctgtttgatgatccag	Protospacer
** .****** *** ************. .*

129. spacer 1.3|46279|31|NZ_CP044458|CRISPRCasFinder matches to NC_021809 (Bacillus subtilis subsp. subtilis str. NCIB 3610 plasmid pBS32, complete sequence) position: , mismatch: 7, identity: 0.774

atgaaaatttgatggctgtttgatgattggg	CRISPR spacer
attgaaattttatgtctgtttgatgatccag	Protospacer
** .****** *** ************. .*

130. spacer 1.3|46279|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP020103 (Bacillus subtilis strain NCIB 3610 plasmid pBS32, complete sequence) position: , mismatch: 7, identity: 0.774

atgaaaatttgatggctgtttgatgattggg	CRISPR spacer
attgaaattttatgtctgtttgatgatccag	Protospacer
** .****** *** ************. .*

131. spacer 1.3|46279|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP034485 (Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 strain NCIB 3610 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

atgaaaatttgatggctgtttgatgattggg	CRISPR spacer
attgaaattttatgtctgtttgatgatccag	Protospacer
** .****** *** ************. .*

132. spacer 1.3|46279|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP045923 (Bacillus subtilis strain P8_B1 plasmid pBs003, complete sequence) position: , mismatch: 7, identity: 0.774

atgaaaatttgatggctgtttgatgattggg	CRISPR spacer
attgaaattttatgtctgtttgatgatccag	Protospacer
** .****** *** ************. .*

133. spacer 1.3|46279|31|NZ_CP044458|CRISPRCasFinder matches to NZ_AP019715 (Bacillus subtilis subsp. subtilis strain NBRC 13719 plasmid pBSU1, complete sequence) position: , mismatch: 7, identity: 0.774

atgaaaatttgatggctgtttgatgattggg	CRISPR spacer
attgaaattttatgtctgtttgatgatccag	Protospacer
** .****** *** ************. .*

134. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_MK275621 (Clostridium perfringens strain JXJA17 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774

ttaaa---agcatttaaaagcttttcttttatta	CRISPR spacer
---aatttattttttaaaaacttttcttttatta	Protospacer
   **   * . *******.**************

135. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP013041 (Clostridium perfringens strain JP55 plasmid pJFP55F, complete sequence) position: , mismatch: 7, identity: 0.774

ttaaa---agcatttaaaagcttttcttttatta	CRISPR spacer
---aatttattttttaaaatcttttcttttatta	Protospacer
   **   * . ******* **************

136. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to MN693353 (Marine virus AFVG_25M425, complete genome) position: , mismatch: 7, identity: 0.774

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
aaaagaacatttaaaagcttttcttggttta	Protospacer
  **.*.******************   ***

137. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to MN693547 (Marine virus AFVG_25M424, complete genome) position: , mismatch: 7, identity: 0.774

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
aaaagaacatttaaaagcttttcttggttta	Protospacer
  **.*.******************   ***

138. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to MN693598 (Marine virus AFVG_25M403, complete genome) position: , mismatch: 7, identity: 0.774

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
aaaagaacatttaaaagcttttcttggttta	Protospacer
  **.*.******************   ***

139. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to MN693297 (Marine virus AFVG_25M423, complete genome) position: , mismatch: 7, identity: 0.774

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
aaaagaacatttaaaagcttttcttggttta	Protospacer
  **.*.******************   ***

140. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP028874 (Borreliella bavariensis PBi plasmid lp25_cp32-3, complete sequence) position: , mismatch: 7, identity: 0.774

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaagagaagaaaggaaaaaattaaga	Protospacer
********.** *********** * .*  *

141. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to NC_017225 (Borreliella afzelii PKo plasmid cp32-12, complete sequence) position: , mismatch: 7, identity: 0.774

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaagagaagaaaggaaaaaattaaga	Protospacer
********.** *********** * .*  *

142. spacer 1.10|46700|32|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044485 (Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-2, complete sequence) position: , mismatch: 7, identity: 0.781

ttatgcttggtggacagcaatttgttttactt	CRISPR spacer
taatgcttggcggtcagcaatttgtacttctg	Protospacer
* ********.** *********** .* ** 

143. spacer 1.10|46700|32|NZ_CP044458|CRISPRCasFinder matches to KT325596 (Uncultured bacterium plasmid pFK2-7, complete sequence) position: , mismatch: 7, identity: 0.781

ttatgcttggtggacagcaatttgttttactt	CRISPR spacer
taatgcttggcggtcagcaatttgtacttctg	Protospacer
* ********.** *********** .* ** 

144. spacer 1.10|46700|32|NZ_CP044458|CRISPRCasFinder matches to NZ_CP038024 (Acinetobacter radioresistens strain DD78 plasmid pAR2, complete sequence) position: , mismatch: 7, identity: 0.781

ttatgcttggtggacagcaatttgttttactt	CRISPR spacer
taatgcttggcggtcagcaatttgtacttctg	Protospacer
* ********.** *********** .* ** 

145. spacer 1.10|46700|32|NZ_CP044458|CRISPRCasFinder matches to NZ_CP010903 (Acinetobacter nosocomialis strain 6411 plasmid p6411-66.409kb, complete sequence) position: , mismatch: 7, identity: 0.781

ttatgcttggtggacagcaatttgttttactt	CRISPR spacer
taatgcttggcggtcagcaatttgtacttctg	Protospacer
* ********.** *********** .* ** 

146. spacer 1.10|46700|32|NZ_CP044458|CRISPRCasFinder matches to MK978162 (Acinetobacter lwoffii strain M2a plasmid pAVAci14, complete sequence) position: , mismatch: 7, identity: 0.781

ttatgcttggtggacagcaatttgttttactt	CRISPR spacer
taatgcttggcggtcagcaatttgtacttctg	Protospacer
* ********.** *********** .* ** 

147. spacer 1.10|46700|32|NZ_CP044458|CRISPRCasFinder matches to NZ_CP051870 (Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_1, complete sequence) position: , mismatch: 7, identity: 0.781

ttatgcttggtggacagcaatttgttttactt	CRISPR spacer
taatgcttggcggtcagcaatttgtacttctg	Protospacer
* ********.** *********** .* ** 

148. spacer 1.10|46700|32|NZ_CP044458|CRISPRCasFinder matches to NC_019217 (Uncultured bacterium HHV216 plasmid pHHV216, complete sequence) position: , mismatch: 7, identity: 0.781

ttatgcttggtggacagcaatttgttttactt	CRISPR spacer
taatgcttggcggtcagcaatttgtacttctg	Protospacer
* ********.** *********** .* ** 

149. spacer 1.10|46700|32|NZ_CP044458|CRISPRCasFinder matches to NC_019218 (Uncultured bacterium HHV35 plasmid pHHV35, complete sequence) position: , mismatch: 7, identity: 0.781

ttatgcttggtggacagcaatttgttttactt	CRISPR spacer
taatgcttggcggtcagcaatttgtacttctg	Protospacer
* ********.** *********** .* ** 

150. spacer 1.10|46700|32|NZ_CP044458|CRISPRCasFinder matches to NC_019299 (Uncultured bacterium HH1107 plasmid pHH1107, complete sequence) position: , mismatch: 7, identity: 0.781

ttatgcttggtggacagcaatttgttttactt	CRISPR spacer
taatgcttggcggtcagcaatttgtacttctg	Protospacer
* ********.** *********** .* ** 

151. spacer 1.10|46700|32|NZ_CP044458|CRISPRCasFinder matches to NZ_CP044465 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-2, complete sequence) position: , mismatch: 7, identity: 0.781

ttatgcttggtggacagcaatttgttttactt	CRISPR spacer
taatgcttggcggtcagcaatttgtacttctg	Protospacer
* ********.** *********** .* ** 

152. spacer 1.10|46700|32|NZ_CP044458|CRISPRCasFinder matches to NZ_CP041290 (Acinetobacter indicus strain 94-2 plasmid p94-2-tetX3, complete sequence) position: , mismatch: 7, identity: 0.781

ttatgcttggtggacagcaatttgttttactt	CRISPR spacer
taatgcttggcggtcagcaatttgtacttctg	Protospacer
* ********.** *********** .* ** 

153. spacer 1.13|46881|31|NZ_CP044458|CRISPRCasFinder matches to MT188223 (Acinetobacter phage vB_AbaM_D22, complete genome) position: , mismatch: 7, identity: 0.774

gtcaaaagttatggaaaagttttgaagcttg	CRISPR spacer
gcaaaaagttttgaaaaagttttgaaagttt	Protospacer
*. ******* **.************. ** 

154. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_MK275621 (Clostridium perfringens strain JXJA17 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781

ttaaa---agcatttaaaagcttttcttttattaa	CRISPR spacer
---aatttattttttaaaaacttttcttttattaa	Protospacer
   **   * . *******.***************

155. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP013041 (Clostridium perfringens strain JP55 plasmid pJFP55F, complete sequence) position: , mismatch: 7, identity: 0.781

ttaaa---agcatttaaaagcttttcttttattaa	CRISPR spacer
---aatttattttttaaaatcttttcttttattaa	Protospacer
   **   * . ******* ***************

156. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP009059 (Borreliella afzelii K78 plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
tttaatttttttaaaaacttttctattattaa	Protospacer
** **  . *******.******* *******

157. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP009214 (Borreliella afzelii Tom3107 plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
tttaatttttttaaaaacttttctattattaa	Protospacer
** **  . *******.******* *******

158. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NC_017241 (Borreliella afzelii PKo plasmid lp54, complete sequence) position: , mismatch: 7, identity: 0.781

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
tttaatttttttaaaaacttttctattattaa	Protospacer
** **  . *******.******* *******

159. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP028874 (Borreliella bavariensis PBi plasmid lp25_cp32-3, complete sequence) position: , mismatch: 7, identity: 0.781

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaagagaagaaaggaaaaaattaagag	Protospacer
********.** *********** * .*  **

160. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to NC_017225 (Borreliella afzelii PKo plasmid cp32-12, complete sequence) position: , mismatch: 7, identity: 0.781

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaagagaagaaaggaaaaaattaagag	Protospacer
********.** *********** * .*  **

161. spacer 1.4|46339|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP046704 (Nostoc sp. ATCC 53789 plasmid pNsp_a, complete sequence) position: , mismatch: 8, identity: 0.742

ggatgaacaaacatgcttttcaattactgca	CRISPR spacer
taaataacaaatatgcttatcaattactggg	Protospacer
 .*  ******.****** ********** .

162. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP013040 (Clostridium perfringens strain JP838 plasmid pJFP838C, complete sequence) position: , mismatch: 8, identity: 0.742

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
atttatttttttaaaatcttttcttttatta	Protospacer
 *  *  . ******* **************

163. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP029156 (Clostridioides difficile strain CD161 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaggcttgtctgacacgt	Protospacer
***************.**** ***  .*.  

164. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP029153 (Clostridioides difficile strain CDT4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaggcttgtctgacacgt	Protospacer
***************.**** ***  .*.  

165. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP015841 (Chlamydia gallinacea 08-1274/3 plasmid p1274, complete sequence) position: , mismatch: 8, identity: 0.742

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
acaaaagcatttaaacacttttctttgtcaa	Protospacer
 .************* .*********  . *

166. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP020425 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaggcttgtctgacgtgt	Protospacer
***************.**** ***  ..*  

167. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to FN668942 (Clostridium difficile BI1 plasmid pCDBI1, complete sequence) position: , mismatch: 8, identity: 0.742

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaggcttgtctgacgtgt	Protospacer
***************.**** ***  ..*  

168. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP033574 (Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence) position: , mismatch: 8, identity: 0.742

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
gtcaaagcattcaaaagctcttcttttgagt	Protospacer
 * ********.*******.*******.   

169. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP019793 (Chlamydia gallinacea strain JX-1 plasmid pJX1, complete sequence) position: , mismatch: 8, identity: 0.742

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
acaaaagcatttaaacacttttctttgtcaa	Protospacer
 .************* .*********  . *

170. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP011969 (Clostridioides difficile ATCC 9689 = DSM 1296 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaggcttgtctgacgtgt	Protospacer
***************.**** ***  ..*  

171. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to AP014358 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C94, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.742

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
tctatgtcatttaaaagctgatcttttattg	Protospacer
*. * . ************  *********.

172. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to NZ_KX832926 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-1, complete sequence) position: , mismatch: 8, identity: 0.742

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
aatagaaaaatcaaaaaggaaaatagagttt	Protospacer
*..******* **.************ ..* 

173. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP026061 (Proteus mirabilis strain FDAARGOS_80 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
aatagaaaaatcaaaaaggaaaatagagttt	Protospacer
*..******* **.************ ..* 

174. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to NC_010555 (Proteus mirabilis HI4320 plasmid pHI4320, complete sequence) position: , mismatch: 8, identity: 0.742

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
aatagaaaaatcaaaaaggaaaatagagttt	Protospacer
*..******* **.************ ..* 

175. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP021855 (Proteus mirabilis strain AR_0156 plasmid unitig_3, complete sequence) position: , mismatch: 8, identity: 0.742

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
aatagaaaaatcaaaaaggaaaatagagttt	Protospacer
*..******* **.************ ..* 

176. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to NZ_MK941846 (Proteus mirabilis strain PM1157 plasmid pOXA-23, complete sequence) position: , mismatch: 8, identity: 0.742

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
aatagaaaaatcaaaaaggaaaatagagttt	Protospacer
*..******* **.************ ..* 

177. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to NZ_MF150117 (Proteus mirabilis strain A64421 plasmid pPM64421b, complete sequence) position: , mismatch: 8, identity: 0.742

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
aatagaaaaatcaaaaaggaaaatagagttt	Protospacer
*..******* **.************ ..* 

178. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to MN693756 (Marine virus AFVG_250M718, complete genome) position: , mismatch: 8, identity: 0.742

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
attgaaaaaatcagaaaggaaaaaagcatga	Protospacer
* ...***** ************ ****. *

179. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to MN694439 (Marine virus AFVG_250M296, complete genome) position: , mismatch: 8, identity: 0.742

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
attgaaaaaatcagaaaggaaaaaagcatga	Protospacer
* ...***** ************ ****. *

180. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to MN693803 (Marine virus AFVG_250M716, complete genome) position: , mismatch: 8, identity: 0.742

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
attgaaaaaatcagaaaggaaaaaagcatga	Protospacer
* ...***** ************ ****. *

181. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to MN694282 (Marine virus AFVG_250M297, complete genome) position: , mismatch: 8, identity: 0.742

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
attgaaaaaatcagaaaggaaaaaagcatga	Protospacer
* ...***** ************ ****. *

182. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to MN694541 (Marine virus AFVG_250M717, complete genome) position: , mismatch: 8, identity: 0.742

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
attgaaaaaatcagaaaggaaaaaagcatga	Protospacer
* ...***** ************ ****. *

183. spacer 1.8|46579|31|NZ_CP044458|CRISPRCasFinder matches to MK759884 (Salmonella phage vB_SenM_SB18, complete genome) position: , mismatch: 8, identity: 0.742

ccccctttctgcaacgtcacccccttttgtc	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgag	Protospacer
 .**..*************** ****.**  

184. spacer 1.8|46579|31|NZ_CP044458|CRISPRCasFinder matches to NC_015292 (Erwinia phage phiEa104, complete genome) position: , mismatch: 8, identity: 0.742

ccccctttctgcaacgtcacccccttttgtc	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgag	Protospacer
 .**..*************** ****.**  

185. spacer 1.8|46579|31|NZ_CP044458|CRISPRCasFinder matches to MH426725 (Erwinia phage SunLIRen, complete genome) position: , mismatch: 8, identity: 0.742

ccccctttctgcaacgtcacccccttttgtc	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgag	Protospacer
 .**..*************** ****.**  

186. spacer 1.8|46579|31|NZ_CP044458|CRISPRCasFinder matches to FQ482083 (Erwinia amylovora phage phiEa104 complete genome) position: , mismatch: 8, identity: 0.742

ccccctttctgcaacgtcacccccttttgtc	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgag	Protospacer
 .**..*************** ****.**  

187. spacer 1.8|46579|31|NZ_CP044458|CRISPRCasFinder matches to HQ728263 (Erwinia phage vB_EamM-M7, complete genome) position: , mismatch: 8, identity: 0.742

ccccctttctgcaacgtcacccccttttgtc	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgag	Protospacer
 .**..*************** ****.**  

188. spacer 1.8|46579|31|NZ_CP044458|CRISPRCasFinder matches to NC_011811 (Erwinia phage phiEa21-4, complete genome) position: , mismatch: 8, identity: 0.742

ccccctttctgcaacgtcacccccttttgtc	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgag	Protospacer
 .**..*************** ****.**  

189. spacer 1.8|46579|31|NZ_CP044458|CRISPRCasFinder matches to MN604407 (Salmonella phage ST-3, complete genome) position: , mismatch: 8, identity: 0.742

ccccctttctgcaacgtcacccccttttgtc	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgag	Protospacer
 .**..*************** ****.**  

190. spacer 1.8|46579|31|NZ_CP044458|CRISPRCasFinder matches to MK770412 (Salmonella phage SE5, complete genome) position: , mismatch: 8, identity: 0.742

ccccctttctgcaacgtcacccccttttgtc	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgag	Protospacer
 .**..*************** ****.**  

191. spacer 1.9|46639|32|NZ_CP044458|CRISPRCasFinder matches to MN694484 (Marine virus AFVG_250M1201, complete genome) position: , mismatch: 8, identity: 0.75

atgc-aattattaattcatacaaacggattgca	CRISPR spacer
-tacaaattattaattgatacaaaaggaaaact	Protospacer
 *.* *********** ******* ***  .* 

192. spacer 1.12|46821|31|NZ_CP044458|CRISPRCasFinder matches to NZ_AP017978 (Neochlamydia sp. S13 plasmid pS13, complete sequence) position: , mismatch: 8, identity: 0.742

aggggc-----cagccgaacaaattaaattagcaag	CRISPR spacer
-----cttttgcagccgaacaaattgaaatagcaat	Protospacer
     *     **************.** ****** 

193. spacer 1.15|46159|32|NZ_CP044458|PILER-CR,CRT matches to AP018320 (Nostoc sp. HK-01 plasmid plasmid2 DNA, complete genome) position: , mismatch: 8, identity: 0.75

gactaaacgtagattttttaagtaatattcaa	CRISPR spacer
ctctatcattagattttttaaataagattcaa	Protospacer
  ***    ************.*** ******

194. spacer 1.15|46159|32|NZ_CP044458|PILER-CR,CRT matches to MN180251 (UNVERIFIED: Wolbachia phage WO isolate Seq2wOMel_KL2 genomic sequence) position: , mismatch: 8, identity: 0.75

gactaaacgtagattttttaagtaatattcaa	CRISPR spacer
tacaggatatagagtttttaagtactattcaa	Protospacer
 ** ..*..**** ********** *******

195. spacer 1.17|46279|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP045822 (Bacillus subtilis strain MB8_B7 plasmid pBs001, complete sequence) position: , mismatch: 8, identity: 0.75

atgaaaatttgatggctgtttgatgattggga	CRISPR spacer
attgaaattttatgtctgtttgatgatccagg	Protospacer
** .****** *** ************. .*.

196. spacer 1.17|46279|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP045813 (Bacillus subtilis strain P8_B3 plasmid pBs005, complete sequence) position: , mismatch: 8, identity: 0.75

atgaaaatttgatggctgtttgatgattggga	CRISPR spacer
attgaaattttatgtctgtttgatgatccagg	Protospacer
** .****** *** ************. .*.

197. spacer 1.17|46279|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP041758 (Bacillus sp. KBS0812 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

atgaaaatttgatggctgtttgatgattggga	CRISPR spacer
attgaaattttatgtctgtttgatgatccagg	Protospacer
** .****** *** ************. .*.

198. spacer 1.17|46279|32|NZ_CP044458|PILER-CR,CRT matches to NC_021809 (Bacillus subtilis subsp. subtilis str. NCIB 3610 plasmid pBS32, complete sequence) position: , mismatch: 8, identity: 0.75

atgaaaatttgatggctgtttgatgattggga	CRISPR spacer
attgaaattttatgtctgtttgatgatccagg	Protospacer
** .****** *** ************. .*.

199. spacer 1.17|46279|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP020103 (Bacillus subtilis strain NCIB 3610 plasmid pBS32, complete sequence) position: , mismatch: 8, identity: 0.75

atgaaaatttgatggctgtttgatgattggga	CRISPR spacer
attgaaattttatgtctgtttgatgatccagg	Protospacer
** .****** *** ************. .*.

200. spacer 1.17|46279|32|NZ_CP044458|PILER-CR,CRT matches to NZ_AP019715 (Bacillus subtilis subsp. subtilis strain NBRC 13719 plasmid pBSU1, complete sequence) position: , mismatch: 8, identity: 0.75

atgaaaatttgatggctgtttgatgattggga	CRISPR spacer
attgaaattttatgtctgtttgatgatccagg	Protospacer
** .****** *** ************. .*.

201. spacer 1.17|46279|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP034485 (Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 strain NCIB 3610 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

atgaaaatttgatggctgtttgatgattggga	CRISPR spacer
attgaaattttatgtctgtttgatgatccagg	Protospacer
** .****** *** ************. .*.

202. spacer 1.17|46279|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP045923 (Bacillus subtilis strain P8_B1 plasmid pBs003, complete sequence) position: , mismatch: 8, identity: 0.75

atgaaaatttgatggctgtttgatgattggga	CRISPR spacer
attgaaattttatgtctgtttgatgatccagg	Protospacer
** .****** *** ************. .*.

203. spacer 1.18|46339|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP046704 (Nostoc sp. ATCC 53789 plasmid pNsp_a, complete sequence) position: , mismatch: 8, identity: 0.75

ggatgaacaaacatgcttttcaattactgcaa	CRISPR spacer
taaataacaaatatgcttatcaattactggga	Protospacer
 .*  ******.****** ********** .*

204. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP013040 (Clostridium perfringens strain JP838 plasmid pJFP838C, complete sequence) position: , mismatch: 8, identity: 0.75

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
atttatttttttaaaatcttttcttttattaa	Protospacer
 *  *  . ******* ***************

205. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP033574 (Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence) position: , mismatch: 8, identity: 0.75

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
gtcaaagcattcaaaagctcttcttttgagta	Protospacer
 * ********.*******.*******.   *

206. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP019793 (Chlamydia gallinacea strain JX-1 plasmid pJX1, complete sequence) position: , mismatch: 8, identity: 0.75

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
acaaaagcatttaaacacttttctttgtcaaa	Protospacer
 .************* .*********  . **

207. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP015841 (Chlamydia gallinacea 08-1274/3 plasmid p1274, complete sequence) position: , mismatch: 8, identity: 0.75

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
acaaaagcatttaaacacttttctttgtcaaa	Protospacer
 .************* .*********  . **

208. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to MN693547 (Marine virus AFVG_25M424, complete genome) position: , mismatch: 8, identity: 0.75

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
aaaagaacatttaaaagcttttcttggtttat	Protospacer
  **.*.******************   *** 

209. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to MK387309 (Pseudoalteromonas phage C7, complete genome) position: , mismatch: 8, identity: 0.75

ttaaaagcatttaaaagcttttc-----ttttattaa	CRISPR spacer
ttaaaatcatttataagcttttcacgctcttt-----	Protospacer
****** ****** *********     .***     

210. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to MN693598 (Marine virus AFVG_25M403, complete genome) position: , mismatch: 8, identity: 0.75

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
aaaagaacatttaaaagcttttcttggtttat	Protospacer
  **.*.******************   *** 

211. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to MN693297 (Marine virus AFVG_25M423, complete genome) position: , mismatch: 8, identity: 0.75

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
aaaagaacatttaaaagcttttcttggtttat	Protospacer
  **.*.******************   *** 

212. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to MN693353 (Marine virus AFVG_25M425, complete genome) position: , mismatch: 8, identity: 0.75

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
aaaagaacatttaaaagcttttcttggtttat	Protospacer
  **.*.******************   *** 

213. spacer 1.22|46579|32|NZ_CP044458|PILER-CR,CRT matches to MK759884 (Salmonella phage vB_SenM_SB18, complete genome) position: , mismatch: 8, identity: 0.75

ccccctttctgcaacgtcacccccttttgtct	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgagt	Protospacer
 .**..*************** ****.**  *

214. spacer 1.22|46579|32|NZ_CP044458|PILER-CR,CRT matches to NC_015292 (Erwinia phage phiEa104, complete genome) position: , mismatch: 8, identity: 0.75

ccccctttctgcaacgtcacccccttttgtct	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgagt	Protospacer
 .**..*************** ****.**  *

215. spacer 1.22|46579|32|NZ_CP044458|PILER-CR,CRT matches to MH426725 (Erwinia phage SunLIRen, complete genome) position: , mismatch: 8, identity: 0.75

ccccctttctgcaacgtcacccccttttgtct	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgagt	Protospacer
 .**..*************** ****.**  *

216. spacer 1.22|46579|32|NZ_CP044458|PILER-CR,CRT matches to FQ482083 (Erwinia amylovora phage phiEa104 complete genome) position: , mismatch: 8, identity: 0.75

ccccctttctgcaacgtcacccccttttgtct	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgagt	Protospacer
 .**..*************** ****.**  *

217. spacer 1.22|46579|32|NZ_CP044458|PILER-CR,CRT matches to HQ728263 (Erwinia phage vB_EamM-M7, complete genome) position: , mismatch: 8, identity: 0.75

ccccctttctgcaacgtcacccccttttgtct	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgagt	Protospacer
 .**..*************** ****.**  *

218. spacer 1.22|46579|32|NZ_CP044458|PILER-CR,CRT matches to NC_011811 (Erwinia phage phiEa21-4, complete genome) position: , mismatch: 8, identity: 0.75

ccccctttctgcaacgtcacccccttttgtct	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgagt	Protospacer
 .**..*************** ****.**  *

219. spacer 1.22|46579|32|NZ_CP044458|PILER-CR,CRT matches to MN604407 (Salmonella phage ST-3, complete genome) position: , mismatch: 8, identity: 0.75

ccccctttctgcaacgtcacccccttttgtct	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgagt	Protospacer
 .**..*************** ****.**  *

220. spacer 1.22|46579|32|NZ_CP044458|PILER-CR,CRT matches to MK770412 (Salmonella phage SE5, complete genome) position: , mismatch: 8, identity: 0.75

ccccctttctgcaacgtcacccccttttgtct	CRISPR spacer
atcctcttctgcaacgtcaccaccttctgagt	Protospacer
 .**..*************** ****.**  *

221. spacer 1.27|46881|32|NZ_CP044458|PILER-CR,CRT matches to MT188223 (Acinetobacter phage vB_AbaM_D22, complete genome) position: , mismatch: 8, identity: 0.75

gtcaaaagttatggaaaagttttgaagcttgg	CRISPR spacer
gcaaaaagttttgaaaaagttttgaaagtttt	Protospacer
*. ******* **.************. **  

222. spacer 1.3|46279|31|NZ_CP044458|CRISPRCasFinder matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 9, identity: 0.71

atgaaaatttgatggctgtttgatgattggg	CRISPR spacer
ttgaaaatttgataactgtttgattgtctta	Protospacer
 ************..********* .*.  .

223. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to LC425518 (Uncultured phage DNA, contig: NODE577) position: , mismatch: 9, identity: 0.71

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
tgtggcagattcaaaagcttttcttttattg	Protospacer
*  .. . ***.******************.

224. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 9, identity: 0.71

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
cttggcacattgaaaagcttttcttttgttc	Protospacer
.* .. .**** ***************.** 

225. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to MK387309 (Pseudoalteromonas phage C7, complete genome) position: , mismatch: 9, identity: 0.71

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaatcatttataagcttttcacgctctt	Protospacer
****** ****** ********* . . .* 

226. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to KY065496 (Streptococcus phage IPP60, complete genome) position: , mismatch: 9, identity: 0.71

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggag	Protospacer
*********** ******.**** *. .  .

227. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to KY065466 (Streptococcus phage IPP25, complete genome) position: , mismatch: 9, identity: 0.71

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggag	Protospacer
*********** ******.**** *. .  .

228. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to KY065476 (Streptococcus phage IPP36, complete genome) position: , mismatch: 9, identity: 0.71

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggag	Protospacer
*********** ******.**** *. .  .

229. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to KY065475 (Streptococcus phage IPP35, complete genome) position: , mismatch: 9, identity: 0.71

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggag	Protospacer
*********** ******.**** *. .  .

230. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to KY065472 (Streptococcus phage IPP31, complete genome) position: , mismatch: 9, identity: 0.71

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggag	Protospacer
*********** ******.**** *. .  .

231. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to KT337353 (Streptococcus phage phiARI0460-2, partial genome) position: , mismatch: 9, identity: 0.71

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggag	Protospacer
*********** ******.**** *. .  .

232. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to KY065474 (Streptococcus phage IPP34, complete genome) position: , mismatch: 9, identity: 0.71

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggag	Protospacer
*********** ******.**** *. .  .

233. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to KY065477 (Streptococcus phage IPP37, partial genome) position: , mismatch: 9, identity: 0.71

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggag	Protospacer
*********** ******.**** *. .  .

234. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to KT337349 (Streptococcus phage phiARI0399, partial genome) position: , mismatch: 9, identity: 0.71

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggag	Protospacer
*********** ******.**** *. .  .

235. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to KY065452 (Streptococcus phage IPP10, complete genome) position: , mismatch: 9, identity: 0.71

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggag	Protospacer
*********** ******.**** *. .  .

236. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to KY065499 (Streptococcus phage IPP63, complete genome) position: , mismatch: 9, identity: 0.71

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggag	Protospacer
*********** ******.**** *. .  .

237. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to KY065473 (Streptococcus phage IPP32, complete genome) position: , mismatch: 9, identity: 0.71

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggag	Protospacer
*********** ******.**** *. .  .

238. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to KT337356 (Streptococcus phage phiARI0468-2, complete genome) position: , mismatch: 9, identity: 0.71

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggag	Protospacer
*********** ******.**** *. .  .

239. spacer 1.7|46519|31|NZ_CP044458|CRISPRCasFinder matches to KY065450 (Streptococcus phage IPP8, complete genome) position: , mismatch: 9, identity: 0.71

agcagaaaaagcagaaaggaaaatagcacta	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggag	Protospacer
*********** ******.**** *. .  .

240. spacer 1.8|46579|31|NZ_CP044458|CRISPRCasFinder matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 9, identity: 0.71

ccccctttctgcaacgtcacccccttttgtc	CRISPR spacer
gcaagttcctgcaacgtcaccgcctttttct	Protospacer
 *   **.************* ****** ..

241. spacer 1.10|46700|32|NZ_CP044458|CRISPRCasFinder matches to NC_007410 (Trichormus variabilis ATCC 29413 plasmid A, complete sequence) position: , mismatch: 9, identity: 0.719

ttatgcttggtggacagcaatttgttttactt	CRISPR spacer
tcttttgaggcggaaagcaatttgttttactg	Protospacer
*. * .  **.*** **************** 

242. spacer 1.10|46700|32|NZ_CP044458|CRISPRCasFinder matches to NZ_CP047243 (Trichormus variabilis 0441 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ttatgcttggtggacagcaatttgttttactt	CRISPR spacer
tcttttgaggcggaaagcaatttgttttactg	Protospacer
*. * .  **.*** **************** 

243. spacer 1.17|46279|32|NZ_CP044458|PILER-CR,CRT matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 9, identity: 0.719

atgaaaatttgatggctgtttgatgattggga	CRISPR spacer
ttgaaaatttgataactgtttgattgtcttaa	Protospacer
 ************..********* .*.  .*

244. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP020425 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
ttaaaagcatttaaaggcttgtctgacgtgtt	Protospacer
***************.**** ***  ..*   

245. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP029156 (Clostridioides difficile strain CD161 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
ttaaaagcatttaaaggcttgtctgacacgtt	Protospacer
***************.**** ***  .*.   

246. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP029153 (Clostridioides difficile strain CDT4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
ttaaaagcatttaaaggcttgtctgacacgtt	Protospacer
***************.**** ***  .*.   

247. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to FN668942 (Clostridium difficile BI1 plasmid pCDBI1, complete sequence) position: , mismatch: 9, identity: 0.719

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
ttaaaagcatttaaaggcttgtctgacgtgtt	Protospacer
***************.**** ***  ..*   

248. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP011969 (Clostridioides difficile ATCC 9689 = DSM 1296 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
ttaaaagcatttaaaggcttgtctgacgtgtt	Protospacer
***************.**** ***  ..*   

249. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 9, identity: 0.719

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
cttggcacattgaaaagcttttcttttgttca	Protospacer
.* .. .**** ***************.** *

250. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to AP014358 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C94, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
tctatgtcatttaaaagctgatcttttattgt	Protospacer
*. * . ************  *********. 

251. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 9, identity: 0.719

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
ctaatgcgaagcagaaaggaaaatcgcacaag	Protospacer
   * . .**************** **** **

252. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to NZ_KX832926 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-1, complete sequence) position: , mismatch: 9, identity: 0.719

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
aatagaaaaatcaaaaaggaaaatagagttta	Protospacer
*..******* **.************ ..* .

253. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP026061 (Proteus mirabilis strain FDAARGOS_80 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
aatagaaaaatcaaaaaggaaaatagagttta	Protospacer
*..******* **.************ ..* .

254. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to NC_010555 (Proteus mirabilis HI4320 plasmid pHI4320, complete sequence) position: , mismatch: 9, identity: 0.719

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
aatagaaaaatcaaaaaggaaaatagagttta	Protospacer
*..******* **.************ ..* .

255. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP021855 (Proteus mirabilis strain AR_0156 plasmid unitig_3, complete sequence) position: , mismatch: 9, identity: 0.719

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
aatagaaaaatcaaaaaggaaaatagagttta	Protospacer
*..******* **.************ ..* .

256. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to NZ_MK941846 (Proteus mirabilis strain PM1157 plasmid pOXA-23, complete sequence) position: , mismatch: 9, identity: 0.719

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
aatagaaaaatcaaaaaggaaaatagagttta	Protospacer
*..******* **.************ ..* .

257. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to NZ_MF150117 (Proteus mirabilis strain A64421 plasmid pPM64421b, complete sequence) position: , mismatch: 9, identity: 0.719

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
aatagaaaaatcaaaaaggaaaatagagttta	Protospacer
*..******* **.************ ..* .

258. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to MN693756 (Marine virus AFVG_250M718, complete genome) position: , mismatch: 9, identity: 0.719

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
attgaaaaaatcagaaaggaaaaaagcatgat	Protospacer
* ...***** ************ ****. * 

259. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to MN694439 (Marine virus AFVG_250M296, complete genome) position: , mismatch: 9, identity: 0.719

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
attgaaaaaatcagaaaggaaaaaagcatgat	Protospacer
* ...***** ************ ****. * 

260. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to MN693803 (Marine virus AFVG_250M716, complete genome) position: , mismatch: 9, identity: 0.719

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
attgaaaaaatcagaaaggaaaaaagcatgat	Protospacer
* ...***** ************ ****. * 

261. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to MN694282 (Marine virus AFVG_250M297, complete genome) position: , mismatch: 9, identity: 0.719

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
attgaaaaaatcagaaaggaaaaaagcatgat	Protospacer
* ...***** ************ ****. * 

262. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to MN694541 (Marine virus AFVG_250M717, complete genome) position: , mismatch: 9, identity: 0.719

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
attgaaaaaatcagaaaggaaaaaagcatgat	Protospacer
* ...***** ************ ****. * 

263. spacer 1.26|46821|32|NZ_CP044458|PILER-CR,CRT matches to NZ_AP017978 (Neochlamydia sp. S13 plasmid pS13, complete sequence) position: , mismatch: 9, identity: 0.719

aggggc-----cagccgaacaaattaaattagcaaga	CRISPR spacer
-----cttttgcagccgaacaaattgaaatagcaatc	Protospacer
     *     **************.** ******  

264. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 10, identity: 0.677

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
acggaaccatttaaaaacttttcttttgggg	Protospacer
 ...** *********.**********.  .

265. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to KC465899 (Pelagibacter phage HTVC008M, complete genome) position: , mismatch: 10, identity: 0.677

ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ccttgtgcatttaaaaacttttctgttatat	Protospacer
..  . **********.******* ****  

266. spacer 1.11|46761|31|NZ_CP044458|CRISPRCasFinder matches to NZ_MF078634 (Acinetobacter pittii strain HGSA488 plasmid pLS488, complete sequence) position: , mismatch: 10, identity: 0.677

ttttgcctggtacacatacttaacctgggcc	CRISPR spacer
---------gtacacatgcttaacctgggcc	Protospacer
         ********.*************

267. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to KY065496 (Streptococcus phage IPP60, complete genome) position: , mismatch: 10, identity: 0.688

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggaga	Protospacer
*********** ******.**** *. .  ..

268. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to KY065466 (Streptococcus phage IPP25, complete genome) position: , mismatch: 10, identity: 0.688

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggaga	Protospacer
*********** ******.**** *. .  ..

269. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to KY065476 (Streptococcus phage IPP36, complete genome) position: , mismatch: 10, identity: 0.688

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggaga	Protospacer
*********** ******.**** *. .  ..

270. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to KY065475 (Streptococcus phage IPP35, complete genome) position: , mismatch: 10, identity: 0.688

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggaga	Protospacer
*********** ******.**** *. .  ..

271. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to KY065472 (Streptococcus phage IPP31, complete genome) position: , mismatch: 10, identity: 0.688

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggaga	Protospacer
*********** ******.**** *. .  ..

272. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to KT337353 (Streptococcus phage phiARI0460-2, partial genome) position: , mismatch: 10, identity: 0.688

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggaga	Protospacer
*********** ******.**** *. .  ..

273. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to KY065474 (Streptococcus phage IPP34, complete genome) position: , mismatch: 10, identity: 0.688

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggaga	Protospacer
*********** ******.**** *. .  ..

274. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to KY065477 (Streptococcus phage IPP37, partial genome) position: , mismatch: 10, identity: 0.688

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggaga	Protospacer
*********** ******.**** *. .  ..

275. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to KT337349 (Streptococcus phage phiARI0399, partial genome) position: , mismatch: 10, identity: 0.688

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggaga	Protospacer
*********** ******.**** *. .  ..

276. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to KY065452 (Streptococcus phage IPP10, complete genome) position: , mismatch: 10, identity: 0.688

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggaga	Protospacer
*********** ******.**** *. .  ..

277. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to KY065499 (Streptococcus phage IPP63, complete genome) position: , mismatch: 10, identity: 0.688

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggaga	Protospacer
*********** ******.**** *. .  ..

278. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to KY065473 (Streptococcus phage IPP32, complete genome) position: , mismatch: 10, identity: 0.688

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggaga	Protospacer
*********** ******.**** *. .  ..

279. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to KT337356 (Streptococcus phage phiARI0468-2, complete genome) position: , mismatch: 10, identity: 0.688

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggaga	Protospacer
*********** ******.**** *. .  ..

280. spacer 1.21|46519|32|NZ_CP044458|PILER-CR,CRT matches to KY065450 (Streptococcus phage IPP8, complete genome) position: , mismatch: 10, identity: 0.688

agcagaaaaagcagaaaggaaaatagcactag	CRISPR spacer
agcagaaaaagaagaaagaaaaagaaaggaga	Protospacer
*********** ******.**** *. .  ..

281. spacer 1.22|46579|32|NZ_CP044458|PILER-CR,CRT matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 10, identity: 0.688

ccccctttctgcaacgtcacccccttttgtct	CRISPR spacer
gcaagttcctgcaacgtcaccgcctttttctg	Protospacer
 *   **.************* ****** .. 

282. spacer 1.25|46761|32|NZ_CP044458|PILER-CR,CRT matches to NZ_MF078634 (Acinetobacter pittii strain HGSA488 plasmid pLS488, complete sequence) position: , mismatch: 10, identity: 0.688

ttttgcctggtacacatacttaacctgggcca	CRISPR spacer
---------gtacacatgcttaacctgggcca	Protospacer
         ********.**************

283. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NC_025097 (Uncultured bacterium AST2 plasmid pAST2, complete sequence) position: , mismatch: 11, identity: 0.645

----------ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaagcatttaaaagcatt----------	Protospacer
          ****************** **          

284. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to MN657042 (Psychrobacter sp. strain ANT_P18B plasmid pA18BP1, complete sequence) position: , mismatch: 11, identity: 0.645

----------ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaagcatttaaaagcatt----------	Protospacer
          ****************** **          

285. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to MN657064 (Psychrobacter sp. strain ANT_P27 plasmid pA27P4, complete sequence) position: , mismatch: 11, identity: 0.645

----------ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaagcatttaaaagcatt----------	Protospacer
          ****************** **          

286. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to MN657067 (Psychrobacter sp. strain ANT_P28 plasmid pA28P3, complete sequence) position: , mismatch: 11, identity: 0.645

----------ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaagcatttaaaagcatt----------	Protospacer
          ****************** **          

287. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to MN657076 (Psychrobacter sp. strain ANT_P39B plasmid pA39BP2, complete sequence) position: , mismatch: 11, identity: 0.645

----------ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaagcatttaaaagcatt----------	Protospacer
          ****************** **          

288. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to MN657088 (Psychrobacter sp. strain ANT_H3 plasmid pA3H8, complete sequence) position: , mismatch: 11, identity: 0.645

----------ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaagcatttaaaagcatt----------	Protospacer
          ****************** **          

289. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to MN657111 (Psychrobacter sp. strain ANT_P52 plasmid pA52P3, complete sequence) position: , mismatch: 11, identity: 0.645

----------ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaagcatttaaaagcatt----------	Protospacer
          ****************** **          

290. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NC_021158 (Psychrobacter maritimus plasmid pKLH80, strain MR29-12, complete sequence) position: , mismatch: 11, identity: 0.645

----------ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaagcatttaaaagcatt----------	Protospacer
          ****************** **          

291. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP012537 (Psychrobacter sp. P11G5 plasmid pPspP11G5d, complete sequence) position: , mismatch: 11, identity: 0.645

----------ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaagcatttaaaagcatt----------	Protospacer
          ****************** **          

292. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NZ_CP012540 (Psychrobacter sp. P11G5 plasmid pPspP11G5g, complete sequence) position: , mismatch: 11, identity: 0.645

----------ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaagcatttaaaagcatt----------	Protospacer
          ****************** **          

293. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 11, identity: 0.656

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
acggaaccatttaaaaacttttcttttggggt	Protospacer
 ...** *********.**********.  . 

294. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to KC465899 (Pelagibacter phage HTVC008M, complete genome) position: , mismatch: 11, identity: 0.656

ttaaaagcatttaaaagcttttcttttattaa	CRISPR spacer
ccttgtgcatttaaaaacttttctgttatatc	Protospacer
..  . **********.******* ****   

295. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to MN657102 (Psychrobacter sp. strain ANT_P46 plasmid pA46P4, complete sequence) position: , mismatch: 12, identity: 0.613

----------ttaaaagcatttaaaagcttttcttttatta	CRISPR spacer
ttaaaagcatttaaaagcatttaaaaacatt----------	Protospacer
          ****************.* **          

296. spacer 1.6|46459|31|NZ_CP044458|CRISPRCasFinder matches to NC_015979 (Lactobacillus sanfranciscensis TMW 1.1304 plasmid pLS1, complete sequence) position: , mismatch: 14, identity: 0.548

-------ttaaaagcatttaaaagcttttcttttatta----	CRISPR spacer
taataatagaaaagcatttaaa-----------tataaaacg	Protospacer
         *************           *** *    

297. spacer 1.20|46459|32|NZ_CP044458|PILER-CR,CRT matches to NC_015979 (Lactobacillus sanfranciscensis TMW 1.1304 plasmid pLS1, complete sequence) position: , mismatch: 14, identity: 0.562

--------ttaaaagcatttaaaagcttttcttttattaa---	CRISPR spacer
ataataatagaaaagcatttaaa-----------tataaaacg	Protospacer
          *************           *** **   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP044457
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 20 : 66184 55 Escherichia_phage(47.06%) integrase,transposase attL 39348:39407|attR 75043:75863
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CP044462
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044462_1 3586-3682 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP044476 Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence 6019-6049 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP044476 Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence 6040-6070 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_LR026972 Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence 14314-14344 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_LR026972 Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence 14335-14365 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP023027 Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence 2706-2736 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP023027 Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence 2727-2757 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP020587 Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence 1572-1602 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP020587 Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence 1593-1623 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP021348 Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence 15134-15164 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP021348 Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence 15155-15185 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP023021 Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence 4058-4088 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP023021 Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence 4079-4109 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_KY499579 Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence 6032-6062 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_KY499579 Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence 6053-6083 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP027248 Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence 13480-13510 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP027248 Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence 13501-13531 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP028570 Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence 3685-3715 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP028570 Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence 3706-3736 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP031994 Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence 2308-2338 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP031994 Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence 2329-2359 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP044462 Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence 3598-3628 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP044462 Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence 3619-3649 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NC_010481 Acinetobacter baumannii plasmid pABIR, complete sequence 228-258 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NC_010481 Acinetobacter baumannii plasmid pABIR, complete sequence 249-279 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 CP033542 Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence 59-89 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 CP033542 Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence 80-110 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP038648 Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence 1818-1848 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP038648 Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence 1839-1869 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 CP033571 Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence 6655-6685 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 CP033571 Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence 6676-6706 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP033132 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence 8645-8675 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP033132 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence 8666-8696 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP033752 Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence 9523-9553 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP033752 Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence 9544-9574 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP027252 Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence 8103-8133 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP027252 Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence 8124-8154 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_LT984691 Acinetobacter baumannii isolate K50 plasmid II, complete sequence 9414-9444 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_LT984691 Acinetobacter baumannii isolate K50 plasmid II, complete sequence 9435-9465 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP029572 Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence 6928-6958 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP029572 Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence 6949-6979 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 MN461228 Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence 3638-3668 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 MN461228 Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence 3659-3689 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 MN481286 Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence 2719-2749 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 MN481286 Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence 2740-2770 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 MN495625 Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence 8319-8349 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 MN495625 Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence 8340-8370 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 MN495626 Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence 8319-8349 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 MN495626 Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence 8340-8370 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP051871 Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence 2123-2153 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP051871 Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence 2144-2174 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NC_013506 Acinetobacter baumannii plasmid pMMCU2, complete sequence 8538-8568 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NC_013506 Acinetobacter baumannii plasmid pMMCU2, complete sequence 8559-8589 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 MK978160 Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence 2818-2848 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 MK978160 Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence 2839-2869 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NC_013056 Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence 7752-7782 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NC_013056 Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence 7773-7803 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 CP042207 Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence 8144-8174 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 CP042207 Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence 8165-8195 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP042367 Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence 10198-10228 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP042367 Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence 10219-10249 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP018141 Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence 4129-4159 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP018141 Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence 4150-4180 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP038260 Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence 10479-10509 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP038260 Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence 10500-10530 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP049810 Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence 7569-7599 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP049810 Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence 7590-7620 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP015146 Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence 247-277 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP015146 Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence 268-298 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP051877 Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence 1390-1420 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP051877 Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence 1411-1441 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP031981 Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence 759-789 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP031981 Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence 780-810 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP026427 Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence 6953-6983 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP026427 Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence 6974-7004 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP014479 Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence 17984-18014 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP014479 Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence 18005-18035 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP016899 Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence 2196-2226 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP016899 Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence 2217-2247 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP051868 Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence 7687-7717 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP051868 Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence 7708-7738 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NC_019280 Acinetobacter baumannii plasmid pMMD, complete sequence 7703-7733 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NC_019280 Acinetobacter baumannii plasmid pMMD, complete sequence 7724-7754 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP023035 Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence 2972-3002 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP023035 Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence 2993-3023 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_KT022421 Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence 4251-4281 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_KT022421 Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence 4272-4302 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP032127 Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence 18027-18057 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP032127 Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence 18048-18078 0 1.0
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP015112 Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence 7418-7448 1 0.968
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP015112 Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence 7439-7469 1 0.968
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP032275 Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence 4788-4818 1 0.968
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP032275 Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence 4809-4839 1 0.968
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP010354 Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence 8559-8589 1 0.968
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP010354 Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence 8580-8610 1 0.968
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP050406 Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence 9451-9481 1 0.968
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP050406 Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence 9472-9502 1 0.968
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP035940 Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence 3221-3251 1 0.968
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP035940 Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence 3242-3272 1 0.968
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP032275 Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence 4767-4797 8 0.742
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP050406 Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence 9493-9523 8 0.742
NZ_CP044462_1 1.1|3619|31|NZ_CP044462|CRISPRCasFinder 3619-3649 31 NZ_CP035940 Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence 3200-3230 8 0.742

1. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP044476 (Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

2. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP044476 (Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

3. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_LR026972 (Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

4. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_LR026972 (Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

5. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP023027 (Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

6. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP023027 (Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

7. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP020587 (Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

8. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP020587 (Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

9. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP021348 (Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

10. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP021348 (Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

11. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP023021 (Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

12. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP023021 (Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

13. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_KY499579 (Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

14. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_KY499579 (Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

15. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP027248 (Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

16. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP027248 (Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

17. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP028570 (Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

18. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP028570 (Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

19. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP031994 (Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

20. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP031994 (Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

21. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP044462 (Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

22. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP044462 (Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

23. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NC_010481 (Acinetobacter baumannii plasmid pABIR, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

24. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NC_010481 (Acinetobacter baumannii plasmid pABIR, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

25. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to CP033542 (Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

26. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to CP033542 (Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

27. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP038648 (Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

28. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP038648 (Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

29. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to CP033571 (Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

30. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to CP033571 (Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

31. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP033132 (Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

32. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP033132 (Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

33. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP033752 (Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

34. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP033752 (Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

35. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP027252 (Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

36. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP027252 (Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

37. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_LT984691 (Acinetobacter baumannii isolate K50 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

38. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_LT984691 (Acinetobacter baumannii isolate K50 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

39. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP029572 (Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

40. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP029572 (Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

41. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to MN461228 (Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

42. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to MN461228 (Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

43. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to MN481286 (Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

44. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to MN481286 (Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

45. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to MN495625 (Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

46. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to MN495625 (Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

47. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to MN495626 (Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

48. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to MN495626 (Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

49. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP051871 (Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

50. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP051871 (Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

51. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NC_013506 (Acinetobacter baumannii plasmid pMMCU2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

52. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NC_013506 (Acinetobacter baumannii plasmid pMMCU2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

53. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to MK978160 (Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

54. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to MK978160 (Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

55. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NC_013056 (Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

56. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NC_013056 (Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

57. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to CP042207 (Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

58. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to CP042207 (Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

59. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP042367 (Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

60. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP042367 (Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

61. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP018141 (Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

62. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP018141 (Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

63. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP038260 (Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

64. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP038260 (Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

65. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP049810 (Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

66. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP049810 (Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

67. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP015146 (Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

68. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP015146 (Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

69. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP051877 (Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

70. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP051877 (Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

71. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP031981 (Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

72. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP031981 (Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

73. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP026427 (Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

74. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP026427 (Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

75. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP014479 (Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

76. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP014479 (Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

77. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP016899 (Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

78. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP016899 (Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

79. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP051868 (Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

80. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP051868 (Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

81. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NC_019280 (Acinetobacter baumannii plasmid pMMD, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

82. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NC_019280 (Acinetobacter baumannii plasmid pMMD, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

83. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP023035 (Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

84. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP023035 (Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

85. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_KT022421 (Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

86. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_KT022421 (Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

87. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP032127 (Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

88. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP032127 (Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgacggattgacta	Protospacer
*******************************

89. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP015112 (Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.968

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactaccaactatgacggattgacta	Protospacer
***********.*******************

90. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP015112 (Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.968

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactaccaactatgacggattgacta	Protospacer
***********.*******************

91. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP032275 (Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence) position: , mismatch: 1, identity: 0.968

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgagggattgacta	Protospacer
******************** **********

92. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP032275 (Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence) position: , mismatch: 1, identity: 0.968

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgagggattgacta	Protospacer
******************** **********

93. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP010354 (Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence) position: , mismatch: 1, identity: 0.968

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgagggattgacta	Protospacer
******************** **********

94. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP010354 (Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence) position: , mismatch: 1, identity: 0.968

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgagggattgacta	Protospacer
******************** **********

95. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP050406 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence) position: , mismatch: 1, identity: 0.968

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgagggattgacta	Protospacer
******************** **********

96. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP050406 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence) position: , mismatch: 1, identity: 0.968

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgagggattgacta	Protospacer
******************** **********

97. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP035940 (Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence) position: , mismatch: 1, identity: 0.968

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgagggattgacta	Protospacer
******************** **********

98. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP035940 (Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence) position: , mismatch: 1, identity: 0.968

ggattgactactaactatgacggattgacta	CRISPR spacer
ggattgactactaactatgagggattgacta	Protospacer
******************** **********

99. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP032275 (Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence) position: , mismatch: 8, identity: 0.742

ggattgactactaactatgacggattgacta	CRISPR spacer
ctttcagctcctaactatgagggattgacta	Protospacer
   *...** ********** **********

100. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP050406 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence) position: , mismatch: 8, identity: 0.742

ggattgactactaactatgacggattgacta	CRISPR spacer
ctttcagctcctaactatgagggattgacta	Protospacer
   *...** ********** **********

101. spacer 1.1|3619|31|NZ_CP044462|CRISPRCasFinder matches to NZ_CP035940 (Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence) position: , mismatch: 8, identity: 0.742

ggattgactactaactatgacggattgacta	CRISPR spacer
ctttcagctcctaactatgagggattgacta	Protospacer
   *...** ********** **********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage