Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048641 Streptomyces aureoverticillatus strain HN6 chromosome, complete genome 10 crisprs csa3,DEDDh,DinG,WYL,cas3,Cas9_archaeal,Cas14u_CAS-V,cas4,casR 0 3 0 0
NZ_CP048642 Streptomyces aureoverticillatus strain HN6 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP048641
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048641_1 1630575-1630675 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048641_2 1661705-1661804 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048641_3 1854723-1854828 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048641_4 2121742-2121865 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048641_5 3609076-3609170 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048641_6 4448409-4448504 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048641_7 5552698-5552768 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048641_8 5748143-5748264 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048641_9 6435485-6435593 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048641_10 6951055-6951153 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048641_8 8.1|5748169|22|NZ_CP048641|CRISPRCasFinder 5748169-5748190 22 NZ_CP031650 Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence 288156-288177 2 0.909
NZ_CP048641_8 8.2|5748217|22|NZ_CP048641|CRISPRCasFinder 5748217-5748238 22 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 304781-304802 2 0.909
NZ_CP048641_8 8.2|5748217|22|NZ_CP048641|CRISPRCasFinder 5748217-5748238 22 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 743777-743798 2 0.909
NZ_CP048641_7 7.1|5552721|25|NZ_CP048641|CRISPRCasFinder 5552721-5552745 25 NZ_CP023712 Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence 77713-77737 3 0.88

1. spacer 8.1|5748169|22|NZ_CP048641|CRISPRCasFinder matches to NZ_CP031650 (Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

ctgagtctggccctggtcctga	CRISPR spacer
ctgagtctggccctggccctgt	Protospacer
****************.**** 

2. spacer 8.2|5748217|22|NZ_CP048641|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 2, identity: 0.909

ctggtcctgacctccggtcggt	CRISPR spacer
ctggtcctgatctccggtcggc	Protospacer
**********.**********.

3. spacer 8.2|5748217|22|NZ_CP048641|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 2, identity: 0.909

ctggtcctgacctccggtcggt	CRISPR spacer
ctggtcctgatctccggtcggc	Protospacer
**********.**********.

4. spacer 7.1|5552721|25|NZ_CP048641|CRISPRCasFinder matches to NZ_CP023712 (Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgggaggggggccggacgcccgtcc	CRISPR spacer
ggggaggggggccggacgccccgcc	Protospacer
 ********************  **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage