Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048381 Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence 0 crisprs RT 0 0 2 0
NZ_CP048379 Klebsiella variicola strain 118 chromosome, complete genome 8 crisprs csa3,cas3,DEDDh,DinG,cas3HD,WYL,RT 0 1 8 0
NZ_CP048380 Klebsiella variicola strain 118 plasmid p118_A, complete sequence 0 crisprs csa3 0 0 3 0

Results visualization

1. NZ_CP048380
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3286 : 66320 51 Escherichia_phage(25.0%) transposase,integrase attL 10690:10749|attR 63809:65149
DBSCAN-SWA_2 78822 : 178060 94 uncultured_Caudovirales_phage(16.13%) transposase,protease,integrase attL 81508:81523|attR 187258:187275
DBSCAN-SWA_3 182635 : 194727 13 Enterobacteria_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP048379
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048379_1 88109-88323 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048379_2 3585836-3585941 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048379_3 4039836-4039958 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048379_4 4057061-4057357 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048379_5 4117135-4117278 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048379_6 4547475-4547610 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048379_7 4903290-4903558 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048379_8 5493074-5493172 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048379_6 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder 4547524-4547561 38 LR134132 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12 99076-99113 4 0.895
NZ_CP048379_6 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder 4547524-4547561 38 LR134132 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12 103227-103264 4 0.895
NZ_CP048379_6 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder 4547524-4547561 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 186184-186221 4 0.895
NZ_CP048379_6 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder 4547524-4547561 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 573935-573972 4 0.895
NZ_CP048379_6 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder 4547524-4547561 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 598211-598248 4 0.895
NZ_CP048379_6 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder 4547524-4547561 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 106348-106385 5 0.868
NZ_CP048379_6 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder 4547524-4547561 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 261716-261753 5 0.868
NZ_CP048379_6 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder 4547524-4547561 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 323501-323538 5 0.868
NZ_CP048379_6 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder 4547524-4547561 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 609564-609601 5 0.868
NZ_CP048379_6 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder 4547524-4547561 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 26963-27000 5 0.868
NZ_CP048379_6 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder 4547524-4547561 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 583045-583082 6 0.842
NZ_CP048379_6 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder 4547524-4547561 38 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 669532-669569 6 0.842
NZ_CP048379_6 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder 4547524-4547561 38 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447654-447691 6 0.842
NZ_CP048379_6 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder 4547524-4547561 38 NZ_CP023144 Escherichia coli strain CFSAN061770 plasmid pEGY2, complete sequence 61983-62020 6 0.842
NZ_CP048379_6 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder 4547524-4547561 38 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 406307-406344 7 0.816

1. spacer 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder matches to LR134132 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12) position: , mismatch: 4, identity: 0.895

acgctgtagccccggtaagcgctagcgccaccggggag	CRISPR spacer
agtgcgtagccccggtaagcgctagcgccaccggggag	Protospacer
*   .*********************************

2. spacer 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder matches to LR134132 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12) position: , mismatch: 4, identity: 0.895

acgctgtagccccggtaagcgctagcgccaccggggag	CRISPR spacer
gcgctgtagccccggtaagcggcagcgccaccggggat	Protospacer
.******************** .************** 

3. spacer 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.895

acgctgtagccccggtaagcgctagcgccaccggggag	CRISPR spacer
gcgctgtagccccggtaagcgagagcgccaccggggat	Protospacer
.********************  ************** 

4. spacer 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.895

acgctgtagccccggtaagcgctagcgccaccggggag	CRISPR spacer
gcgctgtagccccggtaagcgacagcgccaccggggat	Protospacer
.******************** .************** 

5. spacer 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.895

acgctgtagccccggtaagcgctagcgccaccggggag	CRISPR spacer
gcgctgtagccccggtaagcggcagcgccaccggggat	Protospacer
.******************** .************** 

6. spacer 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.868

acgctgtagccccggtaagcgctagcgccaccggggag	CRISPR spacer
gcgctgtagccccggtaagcggcagcgccaccggggga	Protospacer
.******************** .*************..

7. spacer 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.868

acgctgtagccccggtaagcgctagcgccaccggggag	CRISPR spacer
gcgctgtagccccggtaagcggcagcgccaccggggga	Protospacer
.******************** .*************..

8. spacer 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.868

acgctgtagccccggtaagcgctagcgccaccggggag	CRISPR spacer
gtgttgtagccccggtaagcggtagcgccaccggggat	Protospacer
..*.***************** *************** 

9. spacer 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.868

acgctgtagccccggtaagcgctagcgccaccggggag	CRISPR spacer
gtgccgtagccccggtaagcggtagcgccaccggggat	Protospacer
..**.**************** *************** 

10. spacer 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.868

acgctgtagccccggtaagcgctagcgccaccggggag	CRISPR spacer
gcactgtagccccggtaagcggcagcgccaccggggat	Protospacer
.*.****************** .************** 

11. spacer 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.842

acgctgtagccccggtaagcgctagcgccaccggggag	CRISPR spacer
ggttggtagccccggtaagcgttagcgccaccggggag	Protospacer
.  . ****************.****************

12. spacer 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.842

acgctgtagccccggtaagcgctagcgccaccggggag	CRISPR spacer
gcgctgtagccccggtaagcggcagcgccaccgggatt	Protospacer
.******************** .************.  

13. spacer 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 6, identity: 0.842

acgctgtagccccggtaagcgctagcgccaccggggag	CRISPR spacer
gtgctgtagccccggtaagcggcagcgccaccggggga	Protospacer
..******************* .*************..

14. spacer 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder matches to NZ_CP023144 (Escherichia coli strain CFSAN061770 plasmid pEGY2, complete sequence) position: , mismatch: 6, identity: 0.842

acgctgtagccccggtaagcgctagcgccaccggggag	CRISPR spacer
agcgagtagccccggtaagcggcagcgccaccggggag	Protospacer
*    **************** .***************

15. spacer 6.1|4547524|38|NZ_CP048379|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 7, identity: 0.816

acgctgtagccccggtaagcgctagcgccaccggggag	CRISPR spacer
ggttggtagccccggtaagcgtaagcgccaccggggag	Protospacer
.  . ****************. ***************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1303629 : 1357234 59 Salmonella_phage(40.0%) holin,integrase,tRNA,tail,capsid,terminase attL 1316283:1316309|attR 1358469:1358495
DBSCAN-SWA_2 1441699 : 1504793 69 Enterobacteria_phage(23.26%) holin,integrase,tRNA,tail,protease,portal,terminase attL 1464702:1464725|attR 1510356:1510379
DBSCAN-SWA_3 1630459 : 1697029 82 Salmonella_phage(14.29%) holin,integrase,tail,capsid,head,protease,portal,terminase,transposase attL 1639526:1639575|attR 1702649:1702698
DBSCAN-SWA_4 1806977 : 1813906 6 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_5 1856055 : 1873907 17 Enterobacteria_phage(28.57%) NA NA
DBSCAN-SWA_6 2913375 : 2922784 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_7 3428393 : 3485831 55 Klebsiella_phage(37.84%) holin,integrase,tRNA,tail,capsid,head,terminase,portal attL 3451002:3451017|attR 3495363:3495378
DBSCAN-SWA_8 3728019 : 3737467 8 Brazilian_cedratvirus(16.67%) protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP048381
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1728 : 66839 59 Escherichia_phage(24.0%) transposase,integrase NA
DBSCAN-SWA_2 78297 : 99959 17 Escherichia_phage(57.14%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage