Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048375 Escherichia coli strain 164 plasmid pC-F-163_D, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP048372 Escherichia coli strain 164 plasmid pC-F-163_A, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP048374 Escherichia coli strain 164 plasmid pC-F-163_C, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP048371 Escherichia coli strain 164 chromosome, complete genome 10 crisprs csa3,PD-DExK,RT,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,DinG,c2c9_V-U4 0 15 7 0
NZ_CP048373 Escherichia coli strain 164 plasmid pC-F-163_B, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP048372
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 67011 : 86234 22 Escherichia_phage(42.86%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP048371
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048371_1 1084946-1085280 Unclear I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048371_2 1110829-1111468 TypeI-E I-E
10 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048371_3 1607253-1607370 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048371_4 2243730-2243853 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048371_5 2911417-2911508 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048371_6 3172913-3173057 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048371_7 3423038-3423134 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048371_8 3563176-3563320 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048371_9 3991918-3992053 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048371_10 4171871-4172020 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048371_5 5.1|2911443|40|NZ_CP048371|CRISPRCasFinder 2911443-2911482 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP048371_9 9.1|3991938|43|NZ_CP048371|PILER-CR 3991938-3991980 43 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141084-141126 0 1.0
NZ_CP048371_4 4.1|2243773|38|NZ_CP048371|CRISPRCasFinder 2243773-2243810 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP048371_2 2.4|1111042|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1111042-1111073 32 NC_021229 Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919 65474-65505 5 0.844
NZ_CP048371_1 1.7|1085037|31|NZ_CP048371|CRISPRCasFinder 1085037-1085067 31 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755174-755204 6 0.806
NZ_CP048371_1 1.7|1085037|31|NZ_CP048371|CRISPRCasFinder 1085037-1085067 31 MH067970 Arthrobacter sp. strain ANT_H40 plasmid pA40H1, complete sequence 47826-47856 6 0.806
NZ_CP048371_2 2.4|1111042|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1111042-1111073 32 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 208287-208318 6 0.812
NZ_CP048371_1 1.10|1085220|31|NZ_CP048371|CRISPRCasFinder 1085220-1085250 31 MG945629 UNVERIFIED: Microviridae sp. isolate 6200-1602, complete genome 4209-4239 7 0.774
NZ_CP048371_1 1.10|1085220|31|NZ_CP048371|CRISPRCasFinder 1085220-1085250 31 MK814759 Gordonia phage Reyja, complete genome 4468-4498 7 0.774
NZ_CP048371_2 2.5|1111103|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1111103-1111134 32 MK416018 Klebsiella phage ST147-VIM1phi7.1, complete genome 24790-24821 7 0.781
NZ_CP048371_2 2.6|1111164|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1111164-1111195 32 MF351863 Synechococcus phage Bellamy, complete genome 123998-124029 7 0.781
NZ_CP048371_1 1.2|1085035|33|NZ_CP048371|PILER-CR,CRT 1085035-1085067 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755172-755204 8 0.758
NZ_CP048371_1 1.7|1085037|31|NZ_CP048371|CRISPRCasFinder 1085037-1085067 31 NZ_CP007070 Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence 191920-191950 8 0.742
NZ_CP048371_1 1.9|1085159|31|NZ_CP048371|CRISPRCasFinder 1085159-1085189 31 NZ_CP033579 Vibrio mediterranei strain 117-T6 plasmid unnamed, complete sequence 47369-47399 8 0.742
NZ_CP048371_2 2.4|1111042|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1111042-1111073 32 MK113951 Phage 5P_3, complete genome 11967-11998 8 0.75
NZ_CP048371_2 2.4|1111042|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1111042-1111073 32 AP017924 Ralstonia phage RP12 DNA, complete genome 11643-11674 8 0.75
NZ_CP048371_2 2.10|1111408|32|NZ_CP048371|CRISPRCasFinder,CRT 1111408-1111439 32 NZ_AP018516 Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence 48296-48327 8 0.75
NZ_CP048371_1 1.6|1084976|31|NZ_CP048371|CRISPRCasFinder 1084976-1085006 31 MF158039 Shigella phage Sf12, complete genome 4976-5006 9 0.71
NZ_CP048371_1 1.6|1084976|31|NZ_CP048371|CRISPRCasFinder 1084976-1085006 31 MF158042 Shigella phage Sd1, complete genome 939-969 9 0.71
NZ_CP048371_2 2.5|1111103|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1111103-1111134 32 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 1143591-1143622 9 0.719
NZ_CP048371_2 2.5|1111103|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1111103-1111134 32 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 891493-891524 9 0.719
NZ_CP048371_2 2.5|1111103|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1111103-1111134 32 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 1143594-1143625 9 0.719
NZ_CP048371_2 2.5|1111103|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1111103-1111134 32 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 315030-315061 9 0.719
NZ_CP048371_2 2.5|1111103|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1111103-1111134 32 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 1123532-1123563 9 0.719
NZ_CP048371_1 1.6|1084976|31|NZ_CP048371|CRISPRCasFinder 1084976-1085006 31 MT840185 Bacteriophage sp. Joined_contig_19 genomic sequence 64310-64340 10 0.677
NZ_CP048371_1 1.6|1084976|31|NZ_CP048371|CRISPRCasFinder 1084976-1085006 31 KF356199 Microcystis phage MaMV-DC, complete genome 50157-50187 10 0.677
NZ_CP048371_1 1.6|1084976|31|NZ_CP048371|CRISPRCasFinder 1084976-1085006 31 NC_008562 Microcystis phage Ma-LMM01 DNA, complete genome 44744-44774 10 0.677
NZ_CP048371_2 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1110981-1111012 32 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 156123-156154 10 0.688
NZ_CP048371_2 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1110981-1111012 32 NZ_CP053984 Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence 21888-21919 10 0.688
NZ_CP048371_2 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1110981-1111012 32 NC_010935 Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence 28766-28797 10 0.688
NZ_CP048371_2 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1110981-1111012 32 JX469826 Uncultured bacterium plasmid pB12, complete sequence 11283-11314 10 0.688
NZ_CP048371_2 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1110981-1111012 32 JN106171 Uncultured bacterium plasmid pAKD26, complete sequence 11289-11320 10 0.688
NZ_CP048371_2 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1110981-1111012 32 NC_016968 Comamonas testosteroni plasmid pTB30, complete sequence 11287-11318 10 0.688
NZ_CP048371_2 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1110981-1111012 32 NC_016978 Comamonas testosteroni plasmid pI2, complete sequence 11272-11303 10 0.688
NZ_CP048371_2 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1110981-1111012 32 NZ_CP017760 Cupriavidus necator strain NH9 plasmid pENH91, complete sequence 67078-67109 10 0.688
NZ_CP048371_2 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1110981-1111012 32 NZ_CP053554 Diaphorobacter sp. JS3050 plasmid pDCNB, complete sequence 4235-4266 10 0.688
NZ_CP048371_2 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1110981-1111012 32 NC_019263 Delftia acidovorans plasmid pLME1, complete sequence 11288-11319 10 0.688
NZ_CP048371_2 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1110981-1111012 32 NC_019264 Delftia acidovorans plasmid pNB8c, complete sequence 11288-11319 10 0.688
NZ_CP048371_2 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1110981-1111012 32 NC_019283 Delftia acidovorans plasmid pC1-1, complete sequence 11288-11319 10 0.688
NZ_CP048371_2 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1110981-1111012 32 NC_006830 Achromobacter xylosoxidans A8 plasmid pA81, complete sequence 11350-11381 10 0.688
NZ_CP048371_2 2.4|1111042|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT 1111042-1111073 32 NC_002580 Propionibacterium freudenreichii plasmid p545, complete sequence 2898-2929 10 0.688
NZ_CP048371_8 8.1|3563219|59|NZ_CP048371|CRISPRCasFinder 3563219-3563277 59 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 97-155 10 0.831
NZ_CP048371_1 1.1|1084974|33|NZ_CP048371|PILER-CR,CRT 1084974-1085006 33 MF158039 Shigella phage Sf12, complete genome 4974-5006 11 0.667
NZ_CP048371_1 1.1|1084974|33|NZ_CP048371|PILER-CR,CRT 1084974-1085006 33 MF158042 Shigella phage Sd1, complete genome 937-969 11 0.667
NZ_CP048371_8 8.1|3563219|59|NZ_CP048371|CRISPRCasFinder 3563219-3563277 59 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40375-40433 11 0.814

1. spacer 5.1|2911443|40|NZ_CP048371|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 9.1|3991938|43|NZ_CP048371|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcacacgcagataaatccaactttcaatattgttaagttcc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttcc	Protospacer
*******************************************

3. spacer 4.1|2243773|38|NZ_CP048371|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

4. spacer 2.4|1111042|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NC_021229 (Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919) position: , mismatch: 5, identity: 0.844

-ctgctggagctggctgcaaggcaagccgccca	CRISPR spacer
tccgctcg-gcaggctgcaacgcaagccgccca	Protospacer
 *.*** * ** ******** ************

5. spacer 1.7|1085037|31|NZ_CP048371|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.806

cgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
cgtggtcgtgggtgctgctgttgctggagcg	Protospacer
*******.**************** *.. *.

6. spacer 1.7|1085037|31|NZ_CP048371|CRISPRCasFinder matches to MH067970 (Arthrobacter sp. strain ANT_H40 plasmid pA40H1, complete sequence) position: , mismatch: 6, identity: 0.806

cgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
cgtggtcaagggtgctgctgttcccacgcct	Protospacer
******** ************* * . *** 

7. spacer 2.4|1111042|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 6, identity: 0.812

-ctgctggagctggctgcaaggcaagccgccca	CRISPR spacer
tccgctcg-gcaggctgcaacgcaagccgcccc	Protospacer
 *.*** * ** ******** *********** 

8. spacer 1.10|1085220|31|NZ_CP048371|CRISPRCasFinder matches to MG945629 (UNVERIFIED: Microviridae sp. isolate 6200-1602, complete genome) position: , mismatch: 7, identity: 0.774

agcctgacgagactactgaggccgttctgtc	CRISPR spacer
aaaaggccaagactactgaggccgttcagtc	Protospacer
*.   * *.****************** ***

9. spacer 1.10|1085220|31|NZ_CP048371|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 7, identity: 0.774

agcctgacgagactactgaggccgttctgtc-	CRISPR spacer
agcctgacgaggctactggggcca-gcggtgg	Protospacer
***********.******.****.  * **  

10. spacer 2.5|1111103|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to MK416018 (Klebsiella phage ST147-VIM1phi7.1, complete genome) position: , mismatch: 7, identity: 0.781

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
cccatcagcgcgttttttggcggtgtgatgga	Protospacer
****.************** *** *. **.* 

11. spacer 2.6|1111164|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to MF351863 (Synechococcus phage Bellamy, complete genome) position: , mismatch: 7, identity: 0.781

ttgaactcaccacgattgttaatatggacgat	CRISPR spacer
aaggtatcaccacgattgttgatatgggcgat	Protospacer
  *.  **************.******.****

12. spacer 1.2|1085035|33|NZ_CP048371|PILER-CR,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

gacgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
tccgtggtcgtgggtgctgctgttgctggagcg	Protospacer
  *******.**************** *.. *.

13. spacer 1.7|1085037|31|NZ_CP048371|CRISPRCasFinder matches to NZ_CP007070 (Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

cgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
tgcggtcatggatgctgatgttgcagtgatg	Protospacer
.*.********.***** ******** * ..

14. spacer 1.9|1085159|31|NZ_CP048371|CRISPRCasFinder matches to NZ_CP033579 (Vibrio mediterranei strain 117-T6 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

atagcaatagtccatagatttgcgaaaacag	CRISPR spacer
aggtttgtagtccattgatttgcgaaaactg	Protospacer
* . . .******** ************* *

15. spacer 2.4|1111042|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to MK113951 (Phage 5P_3, complete genome) position: , mismatch: 8, identity: 0.75

ctgctggagctggctgcaaggcaagccgccca	CRISPR spacer
gagcatcggctggctgcaaggcaagctgcccc	Protospacer
  **   .******************.**** 

16. spacer 2.4|1111042|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to AP017924 (Ralstonia phage RP12 DNA, complete genome) position: , mismatch: 8, identity: 0.75

ctgctggagctggctgcaaggcaagccgccca	CRISPR spacer
gcggaagcgctggctgcacggcaagcggccca	Protospacer
 .*  .* ********** ******* *****

17. spacer 2.10|1111408|32|NZ_CP048371|CRISPRCasFinder,CRT matches to NZ_AP018516 (Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence) position: , mismatch: 8, identity: 0.75

gcaacgacggtgagatttcacgcctgacgctg	CRISPR spacer
tcaacgacggtaagatgtcacgcctaaagaat	Protospacer
 **********.**** ********.* *   

18. spacer 1.6|1084976|31|NZ_CP048371|CRISPRCasFinder matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 9, identity: 0.71

tgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
tgtttgcagcattaacgctccccaagtgccg	Protospacer
*******.************ ***.   .. 

19. spacer 1.6|1084976|31|NZ_CP048371|CRISPRCasFinder matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 9, identity: 0.71

tgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
tgtttgcagcattaacgctctccaagtgccg	Protospacer
*******.************ ***.   .. 

20. spacer 2.5|1111103|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 9, identity: 0.719

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
gccacccgcgctttttttgccgggccggatat	Protospacer
 ***** **** ************ * .  .*

21. spacer 2.5|1111103|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 9, identity: 0.719

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
gccacccgcgctttttttgccgggccggatat	Protospacer
 ***** **** ************ * .  .*

22. spacer 2.5|1111103|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 9, identity: 0.719

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
gccacccgcgctttttttgccgggccggatat	Protospacer
 ***** **** ************ * .  .*

23. spacer 2.5|1111103|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 9, identity: 0.719

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
gccacccgcgctttttttgccgggccggatat	Protospacer
 ***** **** ************ * .  .*

24. spacer 2.5|1111103|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 9, identity: 0.719

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
gccacccgcgctttttttgccgggccggatat	Protospacer
 ***** **** ************ * .  .*

25. spacer 1.6|1084976|31|NZ_CP048371|CRISPRCasFinder matches to MT840185 (Bacteriophage sp. Joined_contig_19 genomic sequence) position: , mismatch: 10, identity: 0.677

tgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
gtgcggcggcattaatgctcacaagtatggt	Protospacer
   . **********.****** *****  .

26. spacer 1.6|1084976|31|NZ_CP048371|CRISPRCasFinder matches to KF356199 (Microcystis phage MaMV-DC, complete genome) position: , mismatch: 10, identity: 0.677

tgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
gtgcggcggcattaatgctcacaagtatggt	Protospacer
   . **********.****** *****  .

27. spacer 1.6|1084976|31|NZ_CP048371|CRISPRCasFinder matches to NC_008562 (Microcystis phage Ma-LMM01 DNA, complete genome) position: , mismatch: 10, identity: 0.677

tgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
gtgcggcggcattaatgctcacaagtatggt	Protospacer
   . **********.****** *****  .

28. spacer 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
acgtcaccccggaagcgattgccagcacacgc	Protospacer
.  ********.*** **********  .* .

29. spacer 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053984 (Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

30. spacer 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NC_010935 (Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

31. spacer 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to JX469826 (Uncultured bacterium plasmid pB12, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

32. spacer 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to JN106171 (Uncultured bacterium plasmid pAKD26, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

33. spacer 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NC_016968 (Comamonas testosteroni plasmid pTB30, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

34. spacer 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NC_016978 (Comamonas testosteroni plasmid pI2, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

35. spacer 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017760 (Cupriavidus necator strain NH9 plasmid pENH91, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

36. spacer 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053554 (Diaphorobacter sp. JS3050 plasmid pDCNB, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

37. spacer 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NC_019263 (Delftia acidovorans plasmid pLME1, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

38. spacer 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NC_019264 (Delftia acidovorans plasmid pNB8c, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

39. spacer 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NC_019283 (Delftia acidovorans plasmid pC1-1, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

40. spacer 2.3|1110981|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NC_006830 (Achromobacter xylosoxidans A8 plasmid pA81, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

41. spacer 2.4|1111042|32|NZ_CP048371|PILER-CR,CRISPRCasFinder,CRT matches to NC_002580 (Propionibacterium freudenreichii plasmid p545, complete sequence) position: , mismatch: 10, identity: 0.688

ctgctggagctggctgcaaggcaagccgccca	CRISPR spacer
ccctgagagctggctgccacgcaagccgctgg	Protospacer
*. . .*********** * *********. .

42. spacer 8.1|3563219|59|NZ_CP048371|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 10, identity: 0.831

-cggagcacttattgccggatgcggcgtgaacgccttatccggcctacggttctggcacc	CRISPR spacer
tcagtgcac-gatcgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctc	Protospacer
 *.* ****  **.**************************** ************   .*

43. spacer 1.1|1084974|33|NZ_CP048371|PILER-CR,CRT matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 11, identity: 0.667

tgtgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
attgtttgcagcattaacgctccccaagtgccg	Protospacer
  *******.************ ***.   .. 

44. spacer 1.1|1084974|33|NZ_CP048371|PILER-CR,CRT matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 11, identity: 0.667

tgtgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
attgtttgcagcattaacgctctccaagtgccg	Protospacer
  *******.************ ***.   .. 

45. spacer 8.1|3563219|59|NZ_CP048371|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.814

cggagcacttattgccggatgcggcgtgaacgccttatccggcctacggttctggcacc-	CRISPR spacer
ggtacggctttttgccggatgcggcgtaaacgccttatccggcctacggtt-tggtgcga	Protospacer
 * *  .*** ****************.*********************** ***..*  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1118894 : 1132077 12 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_2 1734960 : 1744403 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_3 1810543 : 1873890 55 Stx2-converting_phage(26.67%) transposase,integrase attL 1806298:1806313|attR 1829170:1829185
DBSCAN-SWA_4 2739213 : 2795255 64 Escherichia_phage(45.65%) tRNA,tail,integrase,head,terminase,capsid,holin,portal attL 2747405:2747419|attR 2795357:2795371
DBSCAN-SWA_5 3712221 : 3756558 34 Enterobacteria_phage(20.0%) head,transposase,tail,integrase attL 3730174:3730189|attR 3750892:3750907
DBSCAN-SWA_6 3764816 : 3837659 58 uncultured_Caudovirales_phage(20.0%) transposase,protease,plate,tRNA NA
DBSCAN-SWA_7 4511416 : 4623997 113 Escherichia_phage(47.73%) tRNA,tail,protease,integrase,plate,transposase attL 4521116:4521151|attR 4606295:4606330
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage