Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048280 Rhizobium leguminosarum bv. viciae 248 chromosome, complete genome 4 crisprs cas3,csa3,WYL,DEDDh 0 3 7 0
NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 0 crisprs csa3,DEDDh 0 0 42 0
NZ_CP048284 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248b, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP048285 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248a, complete sequence 0 crisprs PD-DExK 0 0 0 0
NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. NZ_CP048280
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048280_1 595977-596064 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048280_2 1066190-1066303 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048280_3 1757698-1757789 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048280_4 1888484-1888570 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048280_2 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder 1066224-1066269 46 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 273153-273198 2 0.957
NZ_CP048280_2 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder 1066224-1066269 46 NZ_CP018233 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence 81357-81402 2 0.957
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 248459-248485 2 0.926
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 399782-399808 2 0.926
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 27034-27060 2 0.926
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 151128-151154 2 0.926
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 261043-261069 2 0.926
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 344232-344258 2 0.926
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 249323-249349 2 0.926
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 344234-344260 2 0.926
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1970543-1970569 2 0.926
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 388329-388355 2 0.926
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 249334-249360 2 0.926
NZ_CP048280_1 1.1|596008|26|NZ_CP048280|CRISPRCasFinder 596008-596033 26 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 457581-457606 3 0.885
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 63347-63373 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 74561-74587 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 331454-331480 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 73412-73438 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 426399-426425 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1243338-1243364 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 820856-820882 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 149442-149468 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 820404-820430 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 334183-334209 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 149438-149464 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 204189-204215 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 213691-213717 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 524789-524815 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 7465-7491 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 328736-328762 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 161098-161124 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 488440-488466 3 0.889
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 236294-236320 3 0.889
NZ_CP048280_1 1.1|596008|26|NZ_CP048280|CRISPRCasFinder 596008-596033 26 NC_007766 Rhizobium etli CFN 42 plasmid p42f, complete sequence 212758-212783 4 0.846
NZ_CP048280_1 1.1|596008|26|NZ_CP048280|CRISPRCasFinder 596008-596033 26 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 335255-335280 4 0.846
NZ_CP048280_1 1.1|596008|26|NZ_CP048280|CRISPRCasFinder 596008-596033 26 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 335690-335715 4 0.846
NZ_CP048280_1 1.1|596008|26|NZ_CP048280|CRISPRCasFinder 596008-596033 26 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 341696-341721 4 0.846
NZ_CP048280_2 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder 1066224-1066269 46 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 86407-86452 4 0.913
NZ_CP048280_2 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder 1066224-1066269 46 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 86281-86326 4 0.913
NZ_CP048280_2 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder 1066224-1066269 46 NZ_CP007050 Rhizobium leguminosarum bv. trifolii WSM1689 plasmid unnamed, complete sequence 228891-228936 4 0.913
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 203886-203912 4 0.852
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1142099-1142125 4 0.852
NZ_CP048280_2 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder 1066224-1066269 46 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 245089-245134 5 0.891
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 388896-388922 5 0.815
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 490411-490437 5 0.815
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 424680-424706 5 0.815
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP054025 Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence 90809-90835 5 0.815
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP054034 Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence 53686-53712 5 0.815
NZ_CP048280_2 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder 1066224-1066269 46 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 168265-168310 6 0.87
NZ_CP048280_4 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder 1888514-1888540 27 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 298202-298228 6 0.778
NZ_CP048280_2 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder 1066224-1066269 46 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 315613-315658 7 0.848

1. spacer 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 2, identity: 0.957

gttcggcgcagccgaagcaatcgatccagtgaatcgattgcagctg	CRISPR spacer
gttcggcgcagccgaagcaatcgatccagtgaatcgattgcagcga	Protospacer
******************************************** .

2. spacer 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 2, identity: 0.957

gttcggcgcagccgaagcaatcgatccagtgaatcgattgcagctg	CRISPR spacer
gttcggcgcagccgaagcaatcgatccagtgaatcgattgcagcga	Protospacer
******************************************** .

3. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 2, identity: 0.926

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgcggaaacaaa	Protospacer
******************.*******.

4. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 2, identity: 0.926

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgcggaaacaaa	Protospacer
******************.*******.

5. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 2, identity: 0.926

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcggagaaacaaa	Protospacer
***************** ********.

6. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttacgtccggaattgcgcagaaacaaa	Protospacer
**.***********************.

7. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 2, identity: 0.926

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttacgtccggaattgcgcagaaacaaa	Protospacer
**.***********************.

8. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 2, identity: 0.926

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtggaaacaag	Protospacer
*****************..********

9. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 2, identity: 0.926

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtggaaacaag	Protospacer
*****************..********

10. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 2, identity: 0.926

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtggaaacaag	Protospacer
*****************..********

11. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 2, identity: 0.926

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgcaaaaactag	Protospacer
*******************.**** **

12. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 2, identity: 0.926

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtggaaacaag	Protospacer
*****************..********

13. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 2, identity: 0.926

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtggaaacaag	Protospacer
*****************..********

14. spacer 1.1|596008|26|NZ_CP048280|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 3, identity: 0.885

ccgggataaaggcatgcataaaataa	CRISPR spacer
ccgggataacggcatgcataaaaaca	Protospacer
********* *************  *

15. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtaaaaacaaa	Protospacer
*****************.*.******.

16. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtaaaaacaaa	Protospacer
*****************.*.******.

17. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtaaaaacaaa	Protospacer
*****************.*.******.

18. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtaaaaacaaa	Protospacer
*****************.*.******.

19. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaactgcgtagaaacaaa	Protospacer
************.****.********.

20. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttccgtccggaattgcgcagaaacata	Protospacer
** ********************** .

21. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttccgtccggaattgcgtagaaacaaa	Protospacer
** **************.********.

22. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtaaaaacaaa	Protospacer
*****************.*.******.

23. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttccgtccggaattgcgtagaaacaaa	Protospacer
** **************.********.

24. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
tcgcgtccggaattgcgcggaaacaaa	Protospacer
*.****************.*******.

25. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaatttcgcaaaaacaaa	Protospacer
************** ****.******.

26. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgcggcaacaaa	Protospacer
******************.* *****.

27. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtaaaaacaaa	Protospacer
*****************.*.******.

28. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtaaaaacaaa	Protospacer
*****************.*.******.

29. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgcggaaaccaa	Protospacer
******************.***** *.

30. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtaaaaacaaa	Protospacer
*****************.*.******.

31. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgcggaaaccaa	Protospacer
******************.***** *.

32. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtaaaaacaaa	Protospacer
*****************.*.******.

33. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 3, identity: 0.889

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtaaaaacaaa	Protospacer
*****************.*.******.

34. spacer 1.1|596008|26|NZ_CP048280|CRISPRCasFinder matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 4, identity: 0.846

ccgggataaaggcatgcataaaataa	CRISPR spacer
ccgggataacgacatgcataaaaaca	Protospacer
********* *.***********  *

35. spacer 1.1|596008|26|NZ_CP048280|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 4, identity: 0.846

ccgggataaaggcatgcataaaataa	CRISPR spacer
ccgggatgaaggcatgcatgaaaaca	Protospacer
*******.***********.***  *

36. spacer 1.1|596008|26|NZ_CP048280|CRISPRCasFinder matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 4, identity: 0.846

ccgggataaaggcatgcataaaataa	CRISPR spacer
ccgggatgaaggcatgcatgaaaaca	Protospacer
*******.***********.***  *

37. spacer 1.1|596008|26|NZ_CP048280|CRISPRCasFinder matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 4, identity: 0.846

ccgggataaaggcatgcataaaataa	CRISPR spacer
ccgggatgaaggcatgcatgaaaaca	Protospacer
*******.***********.***  *

38. spacer 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 4, identity: 0.913

gttcggcgcagccgaagcaatcgatccagtgaatcgattgcagctg	CRISPR spacer
tttcggcgcagccgaagcaatcgatccaatgaatcgattgcagcaa	Protospacer
 ***************************.*************** .

39. spacer 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 4, identity: 0.913

gttcggcgcagccgaagcaatcgatccagtgaatcgattgcagctg	CRISPR spacer
tttcggcgcagccgaagcaatcgatccaatgaatcgattgcagcaa	Protospacer
 ***************************.*************** .

40. spacer 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder matches to NZ_CP007050 (Rhizobium leguminosarum bv. trifolii WSM1689 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.913

gttcggcgcagccgaagcaatcgatccagtgaatcgattgcagctg	CRISPR spacer
tttcggcacagccgaagcaatcgatccagtgaatcgattgcagcga	Protospacer
 ******.************************************ .

41. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 4, identity: 0.852

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgttgaaacgaa	Protospacer
*****************. *****.*.

42. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 4, identity: 0.852

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgcaaaagctaa	Protospacer
*******************.**.* *.

43. spacer 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 5, identity: 0.891

gttcggcgcagccgaagcaatcgatccagtgaatcgattgcagctg	CRISPR spacer
gtcgggcgcagcccgagcaatcgatccagtgaatcgattgcagcgg	Protospacer
**. ********* .***************************** *

44. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 5, identity: 0.815

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtagagcaaac	Protospacer
*****************.***.  ** 

45. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 5, identity: 0.815

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtagagcaaac	Protospacer
*****************.***.  ** 

46. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 5, identity: 0.815

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
ttgcgtccggaattgcgtagagcaaac	Protospacer
*****************.***.  ** 

47. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP054025 (Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence) position: , mismatch: 5, identity: 0.815

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
tcccgtccggaattgcgtaaaaacaaa	Protospacer
*. **************.*.******.

48. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 5, identity: 0.815

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
tcccgtccggaattgcgtaaaaacaaa	Protospacer
*. **************.*.******.

49. spacer 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 6, identity: 0.87

gttcggcgcagccgaagcaatcgatccagtgaatcgattgcagctg	CRISPR spacer
gtcgggcgcagcccgagcaatcgatccagtgaatcgattgcagcga	Protospacer
**. ********* .***************************** .

50. spacer 4.1|1888514|27|NZ_CP048280|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 6, identity: 0.778

ttgcgtccggaattgcgcagaaacaag	CRISPR spacer
caccgtccggaattgcgtaaaaacaaa	Protospacer
.  **************.*.******.

51. spacer 2.1|1066224|46|NZ_CP048280|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.848

gttcggcgcagccgaagcaatcgatccagtgaatcgattgcagctg	CRISPR spacer
atcgggcgcagcccgagcaatcgatccagtgaatcgattgcagcga	Protospacer
.*. ********* .***************************** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1735969 : 1749349 13 uncultured_Mediterranean_phage(90.91%) tRNA NA
DBSCAN-SWA_2 2006974 : 2017200 8 uncultured_Mediterranean_phage(83.33%) NA NA
DBSCAN-SWA_3 3080519 : 3117668 47 Ochrobactrum_phage(29.03%) transposase,head,integrase,tail attL 3085712:3085726|attR 3122535:3122549
DBSCAN-SWA_4 3257631 : 3280367 23 Rhodobacter_phage(53.85%) NA NA
DBSCAN-SWA_5 3283720 : 3295703 18 Rhodobacter_phage(33.33%) transposase,integrase attL 3282534:3282547|attR 3294068:3294081
DBSCAN-SWA_6 4070943 : 4081028 9 Mycobacterium_phage(25.0%) NA NA
DBSCAN-SWA_7 4224851 : 4236173 7 Enterobacteria_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP048282
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 3528 2 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_2 8014 : 10534 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_3 27574 : 28387 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_4 32567 : 33491 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_5 39262 : 47709 5 Indivirus(33.33%) NA NA
DBSCAN-SWA_6 55328 : 58043 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_7 66010 : 75801 8 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_8 92492 : 96027 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_9 108059 : 108686 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_10 112146 : 113682 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_11 122410 : 124671 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_12 135151 : 139013 2 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_13 151038 : 151992 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_14 158759 : 160196 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_15 168990 : 169833 1 Bordetella_phage(100.0%) NA NA
DBSCAN-SWA_16 176085 : 177753 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_17 189419 : 191218 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_18 226691 : 232735 6 Diadromus_pulchellus_ascovirus(33.33%) NA NA
DBSCAN-SWA_19 237138 : 237801 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_20 244778 : 246689 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_21 253462 : 254635 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_22 257801 : 263249 5 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_23 268017 : 274164 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_24 278398 : 279760 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_25 284332 : 290320 6 Bacillus_virus(25.0%) holin NA
DBSCAN-SWA_26 293471 : 294251 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_27 302264 : 308025 4 Amsacta_moorei_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_28 313921 : 314779 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_29 319790 : 326732 8 Catovirus(25.0%) holin NA
DBSCAN-SWA_30 356658 : 359288 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_31 369252 : 372901 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_32 380942 : 386301 5 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_33 392414 : 394043 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_34 404873 : 410788 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_35 427880 : 432195 4 Bordetella_phage(50.0%) NA NA
DBSCAN-SWA_36 441558 : 448933 9 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_37 460468 : 460678 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_38 469723 : 470608 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_39 474162 : 475071 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_40 498944 : 502641 2 Tanapox_virus(50.0%) protease NA
DBSCAN-SWA_41 518566 : 518971 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_42 528366 : 529140 1 Bacillus_virus(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage