Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP048022 Lactobacillus plantarum strain CACC 558 chromosome, complete genome 1 crisprs DEDDh,cas3,DinG,csa3,WYL 0 0 7 0
NZ_CP048023 Lactobacillus plantarum strain CACC 558 plasmid p1CACC558, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 1 crisprs csa3 3 1 5 1

Results visualization

1. NZ_CP048022
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048022_1 651720-651876 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 616811 : 623878 6 Escherichia_phage(50.0%) integrase attL 612859:612872|attR 629307:629320
DBSCAN-SWA_2 829828 : 839667 8 Lactobacillus_phage(87.5%) NA NA
DBSCAN-SWA_3 1357337 : 1442529 88 Lactobacillus_phage(78.57%) tRNA,tail,portal,head,capsid,integrase,holin,protease,terminase attL 1382919:1382936|attR 1449466:1449483
DBSCAN-SWA_4 1724599 : 1769410 54 Lactobacillus_phage(75.68%) portal,tail,capsid,holin,terminase NA
DBSCAN-SWA_5 1971378 : 1979892 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 2823382 : 2883844 49 Streptococcus_phage(18.75%) portal,tRNA,head,capsid,integrase,terminase attL 2871673:2871712|attR 2876686:2876725
DBSCAN-SWA_7 3177351 : 3226501 49 Bacillus_virus(50.0%) bacteriocin,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP048023
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 25925 : 33628 7 Enterococcus_phage(28.57%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP048024
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP048024_1 5302-5439 Orphan NA
3 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP048024_1 1.3|5404|18|NZ_CP048024|CRT 5404-5421 18 NZ_CP048024.1 5296-5313 0 1.0
NZ_CP048024_1 1.3|5404|18|NZ_CP048024|CRT 5404-5421 18 NZ_CP048024.1 5428-5445 0 1.0
NZ_CP048024_1 1.1|5320|18|NZ_CP048024|CRT 5320-5337 18 NZ_CP048024.1 5296-5313 1 0.944
NZ_CP048024_1 1.1|5320|18|NZ_CP048024|CRT 5320-5337 18 NZ_CP048024.1 5428-5445 1 0.944
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP048024.1 5296-5325 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP048024.1 5416-5445 1 0.967

1. spacer 1.3|5404|18|NZ_CP048024|CRT matches to position: 5296-5313, mismatch: 0, identity: 1.0

ggctgtattactggctgt	CRISPR spacer
ggctgtattactggctgt	Protospacer
******************

2. spacer 1.3|5404|18|NZ_CP048024|CRT matches to position: 5428-5445, mismatch: 0, identity: 1.0

ggctgtattactggctgt	CRISPR spacer
ggctgtattactggctgt	Protospacer
******************

3. spacer 1.1|5320|18|NZ_CP048024|CRT matches to position: 5296-5313, mismatch: 1, identity: 0.944

ggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgt	Protospacer
*************.****

4. spacer 1.1|5320|18|NZ_CP048024|CRT matches to position: 5428-5445, mismatch: 1, identity: 0.944

ggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgt	Protospacer
*************.****

5. spacer 1.2|5356|30|NZ_CP048024|CRT matches to position: 5296-5325, mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

6. spacer 1.2|5356|30|NZ_CP048024|CRT matches to position: 5416-5445, mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47187-47216 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26602-26631 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36733-36762 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 340-369 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9557-9586 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45395-45424 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35286-35315 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 79-108 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 127-156 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58157-58186 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 801-830 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16156-16185 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16204-16233 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76611-76640 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76659-76688 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21645-21674 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21717-21746 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5308-5337 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5356-5385 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 61350-61379 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48802-48831 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37917-37946 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 23050-23079 0 1.0
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47163-47192 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47175-47204 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47223-47252 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47235-47264 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47247-47276 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47259-47288 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47271-47300 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47283-47312 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47295-47324 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47307-47336 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26590-26619 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26638-26667 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26650-26679 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26662-26691 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26674-26703 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26686-26715 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26698-26727 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26710-26739 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26722-26751 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36721-36750 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36769-36798 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36781-36810 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36793-36822 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36805-36834 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36817-36846 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36829-36858 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36841-36870 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36853-36882 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 292-321 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 304-333 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 352-381 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 364-393 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9436-9465 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9485-9514 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9509-9538 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9521-9550 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9569-9598 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9581-9610 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45383-45412 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45431-45460 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45443-45472 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45455-45484 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45467-45496 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45479-45508 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45491-45520 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45503-45532 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45515-45544 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35226-35255 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35238-35267 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35250-35279 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35298-35327 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35310-35339 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35322-35351 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35334-35363 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35346-35375 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 31-60 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 43-72 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 55-84 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 67-96 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 115-144 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 57989-58018 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58001-58030 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58013-58042 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58025-58054 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58037-58066 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58049-58078 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58061-58090 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58073-58102 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58085-58114 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58097-58126 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58109-58138 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58121-58150 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58169-58198 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 741-770 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 753-782 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 765-794 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 813-842 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 825-854 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 837-866 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 849-878 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 861-890 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16144-16173 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16192-16221 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76599-76628 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76647-76676 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21597-21626 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21609-21638 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21621-21650 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21633-21662 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21669-21698 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21705-21734 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21753-21782 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5296-5325 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5344-5373 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5392-5421 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5404-5433 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5416-5445 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 61362-61391 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48694-48723 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48706-48735 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48718-48747 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48730-48759 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48742-48771 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48754-48783 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48766-48795 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48814-48843 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48826-48855 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37893-37922 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37929-37958 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37941-37970 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37953-37982 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 23062-23091 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 23074-23103 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 23086-23115 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035152 Pediococcus acidilactici strain SRCM103367 plasmid unnamed1 19441-19470 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035152 Pediococcus acidilactici strain SRCM103367 plasmid unnamed1 19453-19482 1 0.967
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47151-47180 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47199-47228 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47211-47240 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26578-26607 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26614-26643 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26626-26655 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36709-36738 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36745-36774 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36757-36786 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 280-309 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 316-345 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 328-357 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 376-405 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 400-429 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9448-9477 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9497-9526 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9533-9562 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9545-9574 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45371-45400 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45407-45436 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45419-45448 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35262-35291 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35274-35303 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35358-35387 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 163-192 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 19-48 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 91-120 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 103-132 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 139-168 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 151-180 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58133-58162 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58145-58174 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58181-58210 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 777-806 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 789-818 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 873-902 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16240-16269 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76695-76724 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16108-16137 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16132-16161 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16168-16197 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16180-16209 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16216-16245 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16228-16257 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76563-76592 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76587-76616 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76623-76652 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76635-76664 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76671-76700 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76683-76712 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21585-21614 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21657-21686 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21681-21710 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21693-21722 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21729-21758 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21741-21770 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5284-5313 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5320-5349 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5332-5361 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5368-5397 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5380-5409 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 61314-61343 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 61326-61355 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 61338-61367 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 61374-61403 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48778-48807 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48790-48819 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48838-48867 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37881-37910 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37905-37934 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37965-37994 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 23038-23067 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 23098-23127 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035152 Pediococcus acidilactici strain SRCM103367 plasmid unnamed1 19429-19458 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035152 Pediococcus acidilactici strain SRCM103367 plasmid unnamed1 19405-19434 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035152 Pediococcus acidilactici strain SRCM103367 plasmid unnamed1 19417-19446 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035152 Pediococcus acidilactici strain SRCM103367 plasmid unnamed1 19465-19494 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP015919 Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence 32332-32361 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP015919 Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence 32344-32373 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP015919 Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence 32356-32385 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021471 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence 24445-24474 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021471 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence 24457-24486 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021471 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence 24481-24510 2 0.933
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47319-47348 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26734-26763 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36865-36894 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 388-417 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9424-9453 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9473-9502 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45527-45556 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35214-35243 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35370-35399 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 7-36 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 57977-58006 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 729-758 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 885-914 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16120-16149 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76575-76604 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21765-21794 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21573-21602 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5428-5457 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 61386-61415 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48682-48711 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035152 Pediococcus acidilactici strain SRCM103367 plasmid unnamed1 19393-19422 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP015919 Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence 32368-32397 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021471 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence 24433-24462 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021471 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence 24469-24498 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP021471 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence 24493-24522 3 0.9
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37869-37898 4 0.867
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 23026-23055 4 0.867
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP023040 Komagataeibacter saccharivorans strain CV1 plasmid unnamed4, complete sequence 34579-34608 7 0.767
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 KF302035 UNVERIFIED: Pseudoalteromonas phage HS6, complete genome 7303-7332 7 0.767
NZ_CP048024_1 1.2|5356|30|NZ_CP048024|CRT 5356-5385 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 1-24 9 0.7

1. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

2. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

3. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

4. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

5. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

6. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

7. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

8. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

9. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

10. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

11. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

12. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

13. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

14. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

15. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

16. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

17. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

18. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

19. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

20. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

21. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

22. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

23. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgactgt	Protospacer
******************************

24. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

25. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

26. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

27. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

28. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

29. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

30. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

31. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

32. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

33. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

34. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

35. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

36. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

37. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

38. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

39. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

40. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

41. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

42. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

43. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

44. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

45. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

46. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

47. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

48. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

49. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

50. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

51. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

52. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

53. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

54. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

55. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

56. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

57. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
gtctgtattactggctgtattactgactgt	Protospacer
* ****************************

58. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactgtctgt	Protospacer
************************* ****

59. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

60. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

61. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

62. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

63. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

64. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

65. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

66. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

67. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

68. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

69. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

70. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

71. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

72. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

73. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

74. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

75. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

76. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

77. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

78. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

79. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

80. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

81. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

82. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

83. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

84. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

85. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

86. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

87. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

88. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

89. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

90. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

91. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

92. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

93. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

94. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

95. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

96. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

97. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

98. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

99. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

100. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

101. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

102. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

103. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

104. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

105. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

106. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

107. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

108. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

109. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

110. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

111. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

112. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

113. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactgactgt	Protospacer
*.****************************

114. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

115. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

116. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

117. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

118. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

119. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

120. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

121. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

122. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

123. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

124. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

125. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

126. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

127. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

128. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

129. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

130. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

131. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactgactgt	Protospacer
*.****************************

132. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

133. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

134. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

135. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

136. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

137. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

138. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

139. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 1, identity: 0.967

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgt	Protospacer
*************************.****

140. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

141. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

142. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

143. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

144. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

145. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

146. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

147. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

148. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

149. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctga	Protospacer
*************************.*** 

150. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

151. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

152. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

153. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactgactgtattactgactgt	Protospacer
*.***********.****************

154. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
tgctgtattactggctgtattactggctgt	Protospacer
 ************************.****

155. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgtctgtattactggctgt	Protospacer
************* ***********.****

156. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

157. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

158. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

159. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

160. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

161. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

162. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

163. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

164. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctga	Protospacer
*************************.*** 

165. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

166. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

167. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

168. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

169. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

170. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

171. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

172. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

173. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

174. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

175. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

176. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctga	Protospacer
*************************.*** 

177. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctga	Protospacer
*************************.*** 

178. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactgactgtattactgactgt	Protospacer
*.***********.****************

179. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

180. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

181. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

182. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

183. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

184. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactgactgtattactgactgt	Protospacer
*.***********.****************

185. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

186. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

187. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

188. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

189. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

190. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

191. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

192. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

193. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

194. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

195. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

196. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

197. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

198. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

199. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

200. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

201. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctga	Protospacer
*************************.*** 

202. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

203. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

204. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

205. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

206. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

207. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

208. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

209. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

210. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

211. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactgactgtattactggctgt	Protospacer
*************.***********.****

212. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

213. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgc	Protospacer
*************************.***.

214. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgcattactggctgtattactggctgt	Protospacer
*****.*******************.****

215. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgcattactggctgt	Protospacer
*****************.*******.****

216. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggctgt	Protospacer
*.***********************.****

217. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP015919 (Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggctgc	Protospacer
*************************.***.

218. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP015919 (Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgcattactggctgt	Protospacer
*****************.*******.****

219. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP015919 (Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgcattactggctgtattactggctgt	Protospacer
*****.*******************.****

220. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021471 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgcattactggctgtattactggctgt	Protospacer
*****.*******************.****

221. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021471 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgcattactggctgt	Protospacer
*****************.*******.****

222. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021471 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence) position: , mismatch: 2, identity: 0.933

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgcattactggctgt	Protospacer
*****************.*******.****

223. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggatga	Protospacer
*************************. ** 

224. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggatga	Protospacer
*************************. ** 

225. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggatga	Protospacer
*************************. ** 

226. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactgactgtattactggctgt	Protospacer
*.***********.***********.****

227. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggatga	Protospacer
*************************. ** 

228. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactg-actgt	CRISPR spacer
ggctgtattactgactgtattactgtgctg-	Protospacer
*************.*********** .*** 

229. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggatga	Protospacer
*************************. ** 

230. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggatga	Protospacer
*************************. ** 

231. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactgactgtattactggctgt	Protospacer
*.***********.***********.****

232. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactgactgtattactggctgt	Protospacer
*.***********.***********.****

233. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggatga	Protospacer
*************************. ** 

234. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggatga	Protospacer
*************************. ** 

235. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactgactgtattactggctgt	Protospacer
*.***********.***********.****

236. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactgactgtattactggctgt	Protospacer
*.***********.***********.****

237. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactgactgtattactggctgt	Protospacer
*.***********.***********.****

238. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggatga	Protospacer
*************************. ** 

239. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactgactgtattactggctgt	Protospacer
*.***********.***********.****

240. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggatga	Protospacer
*************************. ** 

241. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactgactgtattactggctgt	Protospacer
*.***********.***********.****

242. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggatga	Protospacer
*************************. ** 

243. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggatga	Protospacer
*************************. ** 

244. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP015919 (Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggatga	Protospacer
*************************. ** 

245. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021471 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtattactggctgtattactggatga	Protospacer
*************************. ** 

246. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021471 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgcattactggctgtattactggctgc	Protospacer
*****.*******************.***.

247. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP021471 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence) position: , mismatch: 3, identity: 0.9

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgcattactggctgtattactggctgc	Protospacer
*****.*******************.***.

248. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.867

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggatga	Protospacer
*.***********************. ** 

249. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 4, identity: 0.867

ggctgtattactggctgtattactgactgt	CRISPR spacer
gactgtattactggctgtattactggatga	Protospacer
*.***********************. ** 

250. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP023040 (Komagataeibacter saccharivorans strain CV1 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

ggctgtattactggctgtattactgactgt	CRISPR spacer
ggctgtatgactggctgtattgcccgatgg	Protospacer
******** ************.*. . ** 

251. spacer 1.2|5356|30|NZ_CP048024|CRT matches to KF302035 (UNVERIFIED: Pseudoalteromonas phage HS6, complete genome) position: , mismatch: 7, identity: 0.767

ggctgtattactggctgtattactgactgt	CRISPR spacer
tgctgtgttactggttgtattactttgtga	Protospacer
 *****.*******.*********   ** 

252. spacer 1.2|5356|30|NZ_CP048024|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 9, identity: 0.7

ggctgtattactggctgtattactgactgt	CRISPR spacer
------ttgactgactgtattactgactgt	Protospacer
       * ****.****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5736 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_2 12327 : 13972 2 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_3 17298 : 17886 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_4 24698 : 26834 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_5 34652 : 44662 14 Enterococcus_phage(20.0%) transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP048024.1|WP_027822611.1|934_1219_-|thioredoxin-family-protein 934_1219_- 94 aa aa NA NA NA 0-5736 yes