Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023569 Enterobacter hormaechei strain BW chromosome, complete genome 1 crisprs csa3,DEDDh,WYL,RT,DinG,cas3,PD-DExK 0 5 3 0
NZ_CP023570 Enterobacter hormaechei strain BW plasmid unnamed2, complete sequence 0 crisprs csa3 0 0 3 0
NZ_CP023572 Enterobacter hormaechei strain BW plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP023571 Enterobacter hormaechei strain BW plasmid unnamed3, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP023569
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023569_1 1593927-1594139 Orphan I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023569_1 1.5|1594080|31|NZ_CP023569|CRT 1594080-1594110 31 MK972693 Salmonella phage SI23, complete genome 6397-6427 2 0.935
NZ_CP023569_1 1.5|1594080|31|NZ_CP023569|CRT 1594080-1594110 31 MK770415 Salmonella phage SF11, complete genome 15202-15232 2 0.935
NZ_CP023569_1 1.5|1594080|31|NZ_CP023569|CRT 1594080-1594110 31 MK972694 Salmonella phage SE22, complete genome 27485-27515 2 0.935
NZ_CP023569_1 1.5|1594080|31|NZ_CP023569|CRT 1594080-1594110 31 MK770414 Salmonella phage SE16, complete genome 19098-19128 2 0.935
NZ_CP023569_1 1.5|1594080|31|NZ_CP023569|CRT 1594080-1594110 31 NC_013059 Salmonella phage c341, complete genome 37506-37536 2 0.935
NZ_CP023569_1 1.5|1594080|31|NZ_CP023569|CRT 1594080-1594110 31 MK972686 Salmonella phage SF3, complete genome 38552-38582 2 0.935
NZ_CP023569_1 1.5|1594080|31|NZ_CP023569|CRT 1594080-1594110 31 MK972685 Salmonella phage SE10, complete genome 39771-39801 2 0.935
NZ_CP023569_1 1.5|1594080|31|NZ_CP023569|CRT 1594080-1594110 31 MK972687 Salmonella phage SE1 (in:P22virus), complete genome 30045-30075 2 0.935
NZ_CP023569_1 1.5|1594080|31|NZ_CP023569|CRT 1594080-1594110 31 FJ000341 Salmonella phage g341c, complete genome 37506-37536 2 0.935
NZ_CP023569_1 1.5|1594080|31|NZ_CP023569|CRT 1594080-1594110 31 EU570103 Salmonella phage epsilon34, complete genome 39547-39577 2 0.935
NZ_CP023569_1 1.5|1594080|31|NZ_CP023569|CRT 1594080-1594110 31 MK972692 Salmonella phage SE21, complete genome 26621-26651 2 0.935
NZ_CP023569_1 1.2|1594026|25|NZ_CP023569|PILER-CR 1594026-1594050 25 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 714190-714214 4 0.84
NZ_CP023569_1 1.2|1594026|25|NZ_CP023569|PILER-CR 1594026-1594050 25 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 62536-62560 4 0.84
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 JF974302 Vibrio phage VBpm10, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces 21037-21067 6 0.806
NZ_CP023569_1 1.1|1593962|29|NZ_CP023569|PILER-CR 1593962-1593990 29 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36335-36363 7 0.759
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 MG592513 Vibrio phage 1.142.O._10N.261.49.E11, partial genome 26631-26661 7 0.774
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 MG592412 Vibrio phage 1.028.O._10N.286.45.B6, partial genome 26631-26661 7 0.774
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 MG592527 Vibrio phage 1.159.O._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 MG592588 Vibrio phage 1.217.O._10N.261.45.A1, partial genome 26631-26661 7 0.774
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 MG592589 Vibrio phage 1.219.O._10N.261.45.E2, partial genome 26631-26661 7 0.774
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 MG592524 Vibrio phage 1.156.O._10N.261.45.A6, partial genome 26631-26661 7 0.774
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 MG592669 Vibrio phage 2.159.A._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 MG592670 Vibrio phage 2.159.B._10N.261.46.F12, partial genome 26631-26661 7 0.774
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 MG592507 Vibrio phage 1.136.O._10N.261.45.E11, partial genome 26631-26661 7 0.774
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1534665-1534695 7 0.774
NZ_CP023569_1 1.3|1593960|31|NZ_CP023569|CRISPRCasFinder,CRT 1593960-1593990 31 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36335-36365 8 0.742
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 62534-62564 8 0.742
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 283146-283176 8 0.742
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 22328-22358 9 0.71
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 475099-475129 9 0.71
NZ_CP023569_1 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT 1594020-1594050 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 714186-714216 10 0.677

1. spacer 1.5|1594080|31|NZ_CP023569|CRT matches to MK972693 (Salmonella phage SI23, complete genome) position: , mismatch: 2, identity: 0.935

cttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
cctgcctgatttgctcatgccattagtcacg	Protospacer
*.******************* *********

2. spacer 1.5|1594080|31|NZ_CP023569|CRT matches to MK770415 (Salmonella phage SF11, complete genome) position: , mismatch: 2, identity: 0.935

cttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
cctgcctgatttgctcatgccattagtcacg	Protospacer
*.******************* *********

3. spacer 1.5|1594080|31|NZ_CP023569|CRT matches to MK972694 (Salmonella phage SE22, complete genome) position: , mismatch: 2, identity: 0.935

cttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
cctgcctgatttgctcatgccattagtcacg	Protospacer
*.******************* *********

4. spacer 1.5|1594080|31|NZ_CP023569|CRT matches to MK770414 (Salmonella phage SE16, complete genome) position: , mismatch: 2, identity: 0.935

cttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
cctgcctgatttgctcatgccattagtcacg	Protospacer
*.******************* *********

5. spacer 1.5|1594080|31|NZ_CP023569|CRT matches to NC_013059 (Salmonella phage c341, complete genome) position: , mismatch: 2, identity: 0.935

cttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
cctgcctgatttgctcatgccattagtcacg	Protospacer
*.******************* *********

6. spacer 1.5|1594080|31|NZ_CP023569|CRT matches to MK972686 (Salmonella phage SF3, complete genome) position: , mismatch: 2, identity: 0.935

cttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
cctgcctgatttgctcatgccattagtcacg	Protospacer
*.******************* *********

7. spacer 1.5|1594080|31|NZ_CP023569|CRT matches to MK972685 (Salmonella phage SE10, complete genome) position: , mismatch: 2, identity: 0.935

cttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
cctgcctgatttgctcatgccattagtcacg	Protospacer
*.******************* *********

8. spacer 1.5|1594080|31|NZ_CP023569|CRT matches to MK972687 (Salmonella phage SE1 (in:P22virus), complete genome) position: , mismatch: 2, identity: 0.935

cttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
cctgcctgatttgctcatgccattagtcacg	Protospacer
*.******************* *********

9. spacer 1.5|1594080|31|NZ_CP023569|CRT matches to FJ000341 (Salmonella phage g341c, complete genome) position: , mismatch: 2, identity: 0.935

cttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
cctgcctgatttgctcatgccattagtcacg	Protospacer
*.******************* *********

10. spacer 1.5|1594080|31|NZ_CP023569|CRT matches to EU570103 (Salmonella phage epsilon34, complete genome) position: , mismatch: 2, identity: 0.935

cttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
cctgcctgatttgctcatgccattagtcacg	Protospacer
*.******************* *********

11. spacer 1.5|1594080|31|NZ_CP023569|CRT matches to MK972692 (Salmonella phage SE21, complete genome) position: , mismatch: 2, identity: 0.935

cttgcctgatttgctcatgcctttagtcacg	CRISPR spacer
cctgcctgatttgctcatgccattagtcacg	Protospacer
*.******************* *********

12. spacer 1.2|1594026|25|NZ_CP023569|PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.84

ggcgacaccgacacgcgccagcgtg	CRISPR spacer
ggcgactccgacccgcgccagcgcc	Protospacer
****** ***** **********. 

13. spacer 1.2|1594026|25|NZ_CP023569|PILER-CR matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 4, identity: 0.84

ggcgacaccgacacgcgccagcgtg	CRISPR spacer
ggcgacaccgacactcgcccgcgat	Protospacer
************** **** ***  

14. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to JF974302 (Vibrio phage VBpm10, *** SEQUENCING IN PROGRESS ***, 8 unordered pieces) position: , mismatch: 6, identity: 0.806

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcattgt	Protospacer
**********.** ********* *..** *

15. spacer 1.1|1593962|29|NZ_CP023569|PILER-CR matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 7, identity: 0.759

aactgccagacttcctggctttctccctc	CRISPR spacer
tgctgcccgacttcctggccttctcgccg	Protospacer
 .***** ***********.***** *. 

16. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to MG592513 (Vibrio phage 1.142.O._10N.261.49.E11, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

17. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to MG592412 (Vibrio phage 1.028.O._10N.286.45.B6, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

18. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to MG592527 (Vibrio phage 1.159.O._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

19. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to MG592588 (Vibrio phage 1.217.O._10N.261.45.A1, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

20. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to MG592589 (Vibrio phage 1.219.O._10N.261.45.E2, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

21. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to MG592524 (Vibrio phage 1.156.O._10N.261.45.A6, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

22. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to MG592669 (Vibrio phage 2.159.A._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

23. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to MG592670 (Vibrio phage 2.159.B._10N.261.46.F12, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

24. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to MG592507 (Vibrio phage 1.136.O._10N.261.45.E11, partial genome) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
acggcgacactgaaacgcgccagagcatagt	Protospacer
**********.** ********* *..*  *

25. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

acggcgacaccgacacgcgccag----cgtgtttt	CRISPR spacer
acggcgagaccgtcacgcgccaggtgccggg----	Protospacer
******* **** **********    ** *    

26. spacer 1.3|1593960|31|NZ_CP023569|CRISPRCasFinder,CRT matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

ctaactgccagacttcctggctttctccctc	CRISPR spacer
tttgctgcccgacttcctggccttctcgccg	Protospacer
.* .***** ***********.***** *. 

27. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 8, identity: 0.742

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
gcggcgacaccgacactcgcccgcgatctca	Protospacer
.*************** **** ***  .*. 

28. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 8, identity: 0.742

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
tcggcgatgccgacacgcgccagcagttcta	Protospacer
 ******..***************.  *.* 

29. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.71

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
ccggcgacatcgacacgcggcagcccaggat	Protospacer
 ********.********* **** ..   *

30. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 9, identity: 0.71

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
ccggcgacaccgacacccggcagcccaggat	Protospacer
 *************** ** **** ..   *

31. spacer 1.4|1594020|31|NZ_CP023569|CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.677

acggcgacaccgacacgcgccagcgtgtttt	CRISPR spacer
ggggcgactccgacccgcgccagcgccgcag	Protospacer
. ****** ***** **********.  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2694626 : 2745402 76 Cronobacter_phage(26.67%) integrase,head,terminase,coat attL 2696539:2696568|attR 2743188:2743217
DBSCAN-SWA_2 2934849 : 2942596 7 Bodo_saltans_virus(16.67%) NA NA
DBSCAN-SWA_3 3432500 : 3532910 90 Cronobacter_phage(63.64%) head,portal,tRNA,capsid,transposase,terminase,tail,integrase,plate,holin attL 3478660:3478675|attR 3526820:3526835
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP023570
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 54605 : 59874 6 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_2 73855 : 134730 52 Escherichia_phage(30.0%) transposase,integrase attL 77288:77347|attR 126590:127409
DBSCAN-SWA_3 145376 : 180801 38 Shigella_phage(14.29%) transposase,integrase,protease attL 150653:150712|attR 165771:167120
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP023571
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 24702 : 31731 10 Escherichia_phage(33.33%) integrase attL 18926:18938|attR 26905:26917
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage