Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031694 Bacillus velezensis strain SRCM101368 chromosome, complete genome 1 crisprs csa3,cas3,DEDDh,DinG,RT 0 1 11 0

Results visualization

1. NZ_CP031694
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031694_1 247610-247692 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031694_1 1.1|247633|37|NZ_CP031694|CRISPRCasFinder 247633-247669 37 CP003950 Rhodococcus opacus PD630 plasmid 1, complete sequence 117646-117682 10 0.73

1. spacer 1.1|247633|37|NZ_CP031694|CRISPRCasFinder matches to CP003950 (Rhodococcus opacus PD630 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.73

atatcctccgaagccgccgtagccgccaaaaccgccg	CRISPR spacer
atatcctccgatgccgccgaagccgcgcagtccctac	Protospacer
*********** ******* ******  *. ** .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 282264 : 292155 9 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 1185627 : 1227552 47 Bacillus_phage(50.0%) lysis,holin,coat NA
DBSCAN-SWA_3 2581359 : 2587612 9 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_4 2757412 : 2794885 35 Bacillus_phage(92.31%) integrase,holin,tail attL 2748749:2748764|attR 2802460:2802475
DBSCAN-SWA_5 2800189 : 2812186 13 Bacillus_phage(44.44%) NA NA
DBSCAN-SWA_6 2822160 : 2876226 83 Bacillus_phage(94.64%) integrase attL 2813099:2813121|attR 2850375:2850397
DBSCAN-SWA_7 2881857 : 2889255 14 Bacillus_phage(88.89%) NA NA
DBSCAN-SWA_8 3160131 : 3166344 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_9 3720780 : 3752589 42 Bacillus_phage(32.26%) portal,tail,plate,terminase,holin NA
DBSCAN-SWA_10 3808337 : 3857853 63 Bacillus_phage(44.19%) capsid,portal,tail,protease,plate,terminase,integrase,holin attL 3814467:3814486|attR 3846865:3846884
DBSCAN-SWA_11 3867618 : 3893192 33 Bacillus_phage(53.85%) integrase,coat attL 3876963:3876978|attR 3878457:3878472
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage