Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP028337 Lactobacillus plantarum strain SRCM101167 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP028335 Lactobacillus plantarum strain SRCM101167 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP028338 Lactobacillus plantarum strain SRCM101167 plasmid unnamed4, complete sequence 0 crisprs NA 0 0 4 0
NZ_CP028334 Lactobacillus plantarum strain SRCM101167 chromosome, complete genome 1 crisprs cas3,DinG,csa3,csn2,cas2,cas1,cas9,WYL,DEDDh 0 2 224 0
NZ_CP028336 Lactobacillus plantarum strain SRCM101167 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP028337
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7936 : 14778 6 Enterococcus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP028338
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5501 7 Bacillus_phage(100.0%) integrase attL 130:143|attR 9740:9753
DBSCAN-SWA_2 9315 : 14327 2 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_3 17417 : 18005 1 Bacillus_phage(100.0%) integrase attL 9275:9298|attR 18807:18830
DBSCAN-SWA_4 23886 : 24339 1 Bacillus_phage(100.0%) integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP028334
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028334_1 1119364-1119795 TypeII NA
6 spacers
csa3,csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP028334_1 1.2|1119466|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder 1119466-1119495 30 JX486087 Lactobacillus phage ATCC 8014-B1, complete genome 790-819 1 0.967
NZ_CP028334_1 1.2|1119466|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder 1119466-1119495 30 JN051154 Pediococcus phage clP1, complete genome 6473-6502 1 0.967
NZ_CP028334_1 1.5|1119664|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder 1119664-1119693 30 JX486088 Lactobacillus phage ATCC 8014-B2, complete genome 12816-12845 3 0.9
NZ_CP028334_1 1.5|1119664|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder 1119664-1119693 30 NC_047764 Lactobacillus phage P1, complete genome 8195-8224 4 0.867
NZ_CP028334_1 1.5|1119664|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder 1119664-1119693 30 KY381600 Lactobacillus phage P2, complete genome 11699-11728 4 0.867
NZ_CP028334_1 1.5|1119664|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder 1119664-1119693 30 MG744354 Lactobacillus phage Satyr, complete genome 69206-69235 4 0.867
NZ_CP028334_1 1.5|1119664|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder 1119664-1119693 30 MG765274 Lactobacillus phage Maenad, complete genome 67131-67160 4 0.867
NZ_CP028334_1 1.5|1119664|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder 1119664-1119693 30 MK448823 Streptococcus phage Javan633, complete genome 14256-14285 9 0.7
NZ_CP028334_1 1.5|1119664|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder 1119664-1119693 30 MK448996 Streptococcus phage Javan628, complete genome 14256-14285 9 0.7

1. spacer 1.2|1119466|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder matches to JX486087 (Lactobacillus phage ATCC 8014-B1, complete genome) position: , mismatch: 1, identity: 0.967

cgtaaataggttgtaaacgttcaggtctga	CRISPR spacer
cgtgaataggttgtaaacgttcaggtctga	Protospacer
***.**************************

2. spacer 1.2|1119466|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder matches to JN051154 (Pediococcus phage clP1, complete genome) position: , mismatch: 1, identity: 0.967

cgtaaataggttgtaaacgttcaggtctga	CRISPR spacer
cgtgaataggttgtaaacgttcaggtctga	Protospacer
***.**************************

3. spacer 1.5|1119664|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder matches to JX486088 (Lactobacillus phage ATCC 8014-B2, complete genome) position: , mismatch: 3, identity: 0.9

cgttggagtttgtgccttaacttcttcaag	CRISPR spacer
agttggggtttgtgccttgacttcttcaag	Protospacer
 *****.***********.***********

4. spacer 1.5|1119664|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder matches to NC_047764 (Lactobacillus phage P1, complete genome) position: , mismatch: 4, identity: 0.867

cgttggagtttgtgccttaacttcttcaag	CRISPR spacer
tgatggagtttgtgcttttacttcttcaag	Protospacer
.* ************.** ***********

5. spacer 1.5|1119664|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder matches to KY381600 (Lactobacillus phage P2, complete genome) position: , mismatch: 4, identity: 0.867

cgttggagtttgtgccttaacttcttcaag	CRISPR spacer
tgatggagtttgtgcttttacttcttcaag	Protospacer
.* ************.** ***********

6. spacer 1.5|1119664|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder matches to MG744354 (Lactobacillus phage Satyr, complete genome) position: , mismatch: 4, identity: 0.867

cgttggagtttgtgccttaacttcttcaag	CRISPR spacer
tgatggagtttgtgcttttacttcttcaag	Protospacer
.* ************.** ***********

7. spacer 1.5|1119664|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder matches to MG765274 (Lactobacillus phage Maenad, complete genome) position: , mismatch: 4, identity: 0.867

cgttggagtttgtgccttaacttcttcaag	CRISPR spacer
tgatggagtttgtgcttttacttcttcaag	Protospacer
.* ************.** ***********

8. spacer 1.5|1119664|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder matches to MK448823 (Streptococcus phage Javan633, complete genome) position: , mismatch: 9, identity: 0.7

cgttggagtttgtgccttaacttcttcaag	CRISPR spacer
tcctatcaattgtgccttaactgcttcaag	Protospacer
. .*.  . ************* *******

9. spacer 1.5|1119664|30|NZ_CP028334|CRT,PILER-CR,CRISPRCasFinder matches to MK448996 (Streptococcus phage Javan628, complete genome) position: , mismatch: 9, identity: 0.7

cgttggagtttgtgccttaacttcttcaag	CRISPR spacer
tcctatcaattgtgccttaactgcttcaag	Protospacer
. .*.  . ************* *******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 41484 49 Lactobacillus_phage(94.74%) integrase,portal,transposase,tail,protease,capsid,terminase attL 25522:25535|attR 37531:37544
DBSCAN-SWA_2 51726 : 52584 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_3 57844 : 59360 2 Lactobacillus_virus(50.0%) NA NA
DBSCAN-SWA_4 62511 : 63612 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_5 69931 : 74100 3 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_6 89087 : 90275 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_7 100480 : 101368 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_8 114056 : 119332 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_9 126096 : 132157 5 Agrobacterium_phage(25.0%) integrase,protease attL 121190:121203|attR 130781:130794
DBSCAN-SWA_10 142131 : 146396 3 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_11 149457 : 149856 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_12 153176 : 153908 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_13 172543 : 173677 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_14 195305 : 202373 7 Catovirus(33.33%) integrase attL 194119:194132|attR 202855:202868
DBSCAN-SWA_15 211603 : 216211 4 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_16 225773 : 230156 5 Diachasmimorpha_longicaudata_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_17 233625 : 239993 4 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_18 244517 : 252414 6 Ralstonia_phage(33.33%) NA NA
DBSCAN-SWA_19 257456 : 260950 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_20 275043 : 276432 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_21 283957 : 284956 1 Staphylococcus_phage(100.0%) transposase NA
DBSCAN-SWA_22 296225 : 296963 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_23 315945 : 317654 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_24 339771 : 359538 11 uncultured_Mediterranean_phage(33.33%) tRNA,protease NA
DBSCAN-SWA_25 370534 : 371735 2 Lactococcus_phage(50.0%) transposase NA
DBSCAN-SWA_26 381283 : 383185 1 Phaeocystis_globosa_virus(100.0%) NA NA
DBSCAN-SWA_27 388955 : 465905 62 Lactobacillus_phage(22.22%) integrase,bacteriocin,transposase,tRNA,protease attL 428507:428528|attR 431341:431362
DBSCAN-SWA_28 477166 : 480506 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_29 491735 : 494486 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_30 498893 : 501980 5 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_31 507598 : 509581 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_32 517914 : 521329 4 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_33 541463 : 543281 1 Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_34 553046 : 559999 9 Cafeteria_roenbergensis_virus(25.0%) tRNA NA
DBSCAN-SWA_35 569776 : 572687 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_36 576422 : 577751 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_37 584588 : 591427 6 Streptococcus_phage(40.0%) NA NA
DBSCAN-SWA_38 595873 : 602865 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_39 606383 : 614153 7 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_40 618675 : 620252 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_41 623299 : 625424 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_42 632085 : 635245 3 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_43 638967 : 646639 6 uncultured_virus(50.0%) tRNA,protease NA
DBSCAN-SWA_44 649748 : 650519 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_45 654240 : 668959 17 Streptococcus_phage(40.0%) NA NA
DBSCAN-SWA_46 682384 : 683797 1 Moumouvirus(100.0%) tRNA NA
DBSCAN-SWA_47 689588 : 694334 5 Bacillus_phage(33.33%) transposase NA
DBSCAN-SWA_48 719586 : 725002 3 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_49 728005 : 729979 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_50 744177 : 752049 6 Tupanvirus(25.0%) tRNA,protease NA
DBSCAN-SWA_51 763665 : 766465 3 Pneumococcus_phage(50.0%) NA NA
DBSCAN-SWA_52 774025 : 784766 8 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_53 799976 : 903192 98 uncultured_Mediterranean_phage(15.38%) transposase,bacteriocin,tRNA,protease NA
DBSCAN-SWA_54 906385 : 907477 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_55 928617 : 930560 2 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_56 939998 : 947391 8 Bacillus_phage(25.0%) protease NA
DBSCAN-SWA_57 965036 : 967104 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_58 973920 : 974696 1 Paenibacillus_phage(100.0%) transposase NA
DBSCAN-SWA_59 979052 : 979457 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_60 988316 : 991782 3 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_61 1001843 : 1007043 7 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_62 1020428 : 1028181 9 Clostridioides_phage(25.0%) NA NA
DBSCAN-SWA_63 1035143 : 1037851 3 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_64 1062560 : 1063336 1 Paenibacillus_phage(100.0%) transposase NA
DBSCAN-SWA_65 1069379 : 1070486 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_66 1089716 : 1092351 3 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_67 1096695 : 1098396 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_68 1106872 : 1107721 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_69 1113457 : 1119299 6 Wolbachia_phage(33.33%) NA NA
DBSCAN-SWA_70 1129451 : 1129922 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_71 1140057 : 1142811 4 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_72 1146809 : 1147535 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_73 1157819 : 1158824 1 Megavirus(100.0%) NA NA
DBSCAN-SWA_74 1161829 : 1163848 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_75 1171246 : 1172263 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_76 1177792 : 1178218 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_77 1191970 : 1200375 8 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_78 1207905 : 1210302 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_79 1218364 : 1235489 14 Streptococcus_phage(37.5%) NA NA
DBSCAN-SWA_80 1254190 : 1254613 1 Staphylococcus_virus(100.0%) NA NA
DBSCAN-SWA_81 1266615 : 1267419 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_82 1278823 : 1280938 1 Cronobacter_phage(100.0%) protease NA
DBSCAN-SWA_83 1295163 : 1296846 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_84 1312368 : 1313022 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_85 1316144 : 1317119 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_86 1329707 : 1331156 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_87 1352094 : 1356127 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_88 1365886 : 1370282 3 Herpes_simplex_virus(50.0%) NA NA
DBSCAN-SWA_89 1381824 : 1382859 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_90 1393262 : 1393913 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_91 1406740 : 1419496 13 Cafeteria_roenbergensis_virus(16.67%) NA NA
DBSCAN-SWA_92 1438127 : 1438646 1 Scale_drop_disease_virus(100.0%) NA NA
DBSCAN-SWA_93 1441954 : 1442815 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_94 1446003 : 1448616 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_95 1459512 : 1462635 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_96 1474269 : 1474770 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_97 1486055 : 1490337 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_98 1493731 : 1499365 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_99 1512352 : 1512922 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_100 1517893 : 1518532 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_101 1522147 : 1530110 6 Paenibacillus_phage(50.0%) transposase NA
DBSCAN-SWA_102 1542868 : 1550122 6 Staphylococcus_virus(20.0%) bacteriocin NA
DBSCAN-SWA_103 1580588 : 1582833 2 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_104 1591961 : 1597928 6 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_105 1606853 : 1624882 19 Bacillus_phage(20.0%) transposase NA
DBSCAN-SWA_106 1634964 : 1641486 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_107 1645111 : 1646383 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_108 1654493 : 1654961 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_109 1659254 : 1660715 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_110 1665209 : 1670702 4 Tupanvirus(50.0%) transposase NA
DBSCAN-SWA_111 1682114 : 1687567 6 Chrysochromulina_ericina_virus(25.0%) NA NA
DBSCAN-SWA_112 1706284 : 1707208 1 unidentified_phage(100.0%) transposase NA
DBSCAN-SWA_113 1712060 : 1712714 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_114 1735612 : 1741958 4 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_115 1745522 : 1751569 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_116 1757543 : 1758318 1 Paenibacillus_phage(100.0%) transposase NA
DBSCAN-SWA_117 1764217 : 1765774 1 Staphylococcus_phage(100.0%) transposase NA
DBSCAN-SWA_118 1772744 : 1774265 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_119 1781133 : 1782850 2 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_120 1792173 : 1792949 1 Paenibacillus_phage(100.0%) transposase NA
DBSCAN-SWA_121 1796829 : 1798830 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_122 1810689 : 1812174 2 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_123 1819657 : 1820431 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_124 1826652 : 1828410 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_125 1856446 : 1862695 6 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_126 1869554 : 1870850 1 Shearwaterpox_virus(100.0%) NA NA
DBSCAN-SWA_127 1875023 : 1877531 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_128 1880708 : 1882331 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_129 1898460 : 1900248 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_130 1919253 : 1919955 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_131 1927538 : 1931309 3 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_132 1950411 : 1951092 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_133 1959607 : 1963301 3 Lactobacillus_virus(50.0%) tRNA NA
DBSCAN-SWA_134 1970894 : 1972646 2 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_135 1992369 : 1993044 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_136 2000991 : 2005171 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_137 2010787 : 2012139 3 Listeria_phage(50.0%) NA NA
DBSCAN-SWA_138 2027344 : 2031487 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_139 2036937 : 2049470 12 Lactobacillus_phage(22.22%) NA NA
DBSCAN-SWA_140 2055755 : 2058748 2 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_141 2062236 : 2065547 3 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_142 2076149 : 2079899 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_143 2087407 : 2092667 5 Cyanophage(50.0%) NA NA
DBSCAN-SWA_144 2099956 : 2100613 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_145 2118573 : 2120931 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_146 2138414 : 2140503 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_147 2151855 : 2152752 1 Lactobacillus_virus(100.0%) NA NA
DBSCAN-SWA_148 2160527 : 2164857 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_149 2174444 : 2175269 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_150 2184368 : 2185088 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_151 2188126 : 2190887 3 Pacmanvirus(50.0%) NA NA
DBSCAN-SWA_152 2194561 : 2195344 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_153 2199535 : 2200822 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_154 2209764 : 2212220 2 Streptococcus_phage(50.0%) transposase NA
DBSCAN-SWA_155 2224802 : 2228528 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_156 2235775 : 2237539 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_157 2246741 : 2281851 40 Lactobacillus_phage(47.37%) integrase,portal,tail,capsid,terminase attL 2239446:2239460|attR 2263149:2263163
DBSCAN-SWA_158 2285001 : 2294690 9 Lactobacillus_phage(71.43%) holin NA
DBSCAN-SWA_159 2298021 : 2299041 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_160 2302677 : 2310960 8 Enterococcus_phage(25.0%) NA NA
DBSCAN-SWA_161 2321772 : 2325335 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_162 2337248 : 2338529 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_163 2351669 : 2354339 1 Catovirus(100.0%) tRNA NA
DBSCAN-SWA_164 2361961 : 2362603 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_165 2366050 : 2367316 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_166 2371822 : 2383267 8 Bacillus_phage(25.0%) transposase NA
DBSCAN-SWA_167 2388648 : 2406232 17 Bacillus_phage(14.29%) tRNA NA
DBSCAN-SWA_168 2426043 : 2426652 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_169 2431103 : 2431688 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_170 2458755 : 2461143 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_171 2477228 : 2480027 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_172 2493556 : 2503966 9 Virus_Rctr197k(20.0%) NA NA
DBSCAN-SWA_173 2507723 : 2509136 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_174 2525839 : 2528738 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_175 2538234 : 2546852 9 Hokovirus(25.0%) protease NA
DBSCAN-SWA_176 2551530 : 2552472 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_177 2563486 : 2564242 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_178 2568769 : 2571643 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_179 2578280 : 2613269 43 Lactobacillus_phage(91.89%) portal,tail,protease,head,capsid,holin,terminase NA
DBSCAN-SWA_180 2617506 : 2621828 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_181 2625729 : 2630021 7 Phage_Wrath(50.0%) tRNA NA
DBSCAN-SWA_182 2634648 : 2635428 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_183 2639786 : 2649340 6 Bradyrhizobium_phage(50.0%) NA NA
DBSCAN-SWA_184 2661684 : 2674177 10 Tupanvirus(33.33%) integrase attL 2661646:2661661|attR 2675650:2675665
DBSCAN-SWA_185 2679663 : 2696851 16 Salmonella_phage(14.29%) tRNA NA
DBSCAN-SWA_186 2703058 : 2706127 2 Helicobacter_phage(50.0%) NA NA
DBSCAN-SWA_187 2711116 : 2712016 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_188 2715999 : 2716887 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_189 2728886 : 2729661 1 Paenibacillus_phage(100.0%) transposase NA
DBSCAN-SWA_190 2748735 : 2752369 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_191 2757932 : 2762106 3 Hokovirus(50.0%) NA NA
DBSCAN-SWA_192 2767865 : 2775038 3 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_193 2780341 : 2787378 8 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_194 2791867 : 2792143 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_195 2795626 : 2805354 10 unidentified_phage(20.0%) tRNA NA
DBSCAN-SWA_196 2810595 : 2829483 14 Bacillus_virus(25.0%) tRNA,protease NA
DBSCAN-SWA_197 2839661 : 2840993 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_198 2865724 : 2866624 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_199 2869843 : 2872228 3 unidentified_phage(50.0%) transposase NA
DBSCAN-SWA_200 2876764 : 2877688 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_201 2884591 : 2891959 6 Aureococcus_anophage(33.33%) NA NA
DBSCAN-SWA_202 2897586 : 2902335 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_203 2907298 : 2915713 7 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_204 2931106 : 2934475 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_205 2941060 : 2941836 1 Paenibacillus_phage(100.0%) transposase NA
DBSCAN-SWA_206 2945922 : 2948728 2 Apis_mellifera_filamentous_virus(50.0%) NA NA
DBSCAN-SWA_207 2979217 : 2985861 6 Acinetobacter_phage(60.0%) NA NA
DBSCAN-SWA_208 2996295 : 2996766 1 Pseudoalteromonas_phage(100.0%) NA NA
DBSCAN-SWA_209 3014560 : 3015256 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_210 3024412 : 3038331 13 Noumeavirus(20.0%) holin,tRNA NA
DBSCAN-SWA_211 3042981 : 3045178 2 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_212 3057680 : 3058415 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_213 3071053 : 3071683 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_214 3075479 : 3076526 1 Bodo_saltans_virus(100.0%) tRNA NA
DBSCAN-SWA_215 3082392 : 3092526 6 Bacillus_virus(40.0%) NA NA
DBSCAN-SWA_216 3107148 : 3120773 13 Bacillus_phage(28.57%) tRNA NA
DBSCAN-SWA_217 3124712 : 3128046 3 environmental_halophage(50.0%) NA NA
DBSCAN-SWA_218 3132358 : 3135253 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_219 3139394 : 3140132 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_220 3150194 : 3157850 9 Staphylococcus_phage(80.0%) NA NA
DBSCAN-SWA_221 3163560 : 3173398 9 Lactobacillus_phage(87.5%) NA NA
DBSCAN-SWA_222 3196555 : 3201190 3 Planktothrix_phage(50.0%) tRNA NA
DBSCAN-SWA_223 3209450 : 3211252 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_224 3222138 : 3223962 4 Lactobacillus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP028336
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3679 : 13026 10 Enterobacteria_phage(37.5%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage