Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP028275 Lactobacillus plantarum strain SRCM100995 chromosome, complete genome 2 crisprs csa3,WYL,cas9,cas1,cas2,csn2,DinG,cas3,DEDDh 0 18 6 0
NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 1 crisprs csa3 4 1 0 0
NZ_CP028277 Lactobacillus plantarum strain SRCM100995 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP028281 Lactobacillus plantarum strain SRCM100995 plasmid unnamed6, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP028279 Lactobacillus plantarum strain SRCM100995 plasmid unnamed4, complete sequence 0 crisprs NA 0 0 7 0
NZ_CP028280 Lactobacillus plantarum strain SRCM100995 plasmid unnamed5, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP028278 Lactobacillus plantarum strain SRCM100995 plasmid unnamed3, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. NZ_CP028275
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028275_1 1442249-1444264 TypeII NA
30 spacers
csn2,cas2,cas1,cas9,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028275_2 2346873-2347029 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP028275_1 1.18|1443407|30|NZ_CP028275|CRISPRCasFinder,CRT 1443407-1443436 30 JX486087 Lactobacillus phage ATCC 8014-B1, complete genome 30242-30271 3 0.9
NZ_CP028275_1 1.12|1443011|30|NZ_CP028275|CRISPRCasFinder,CRT 1443011-1443040 30 JX486087 Lactobacillus phage ATCC 8014-B1, complete genome 8954-8983 4 0.867
NZ_CP028275_1 1.18|1443407|30|NZ_CP028275|CRISPRCasFinder,CRT 1443407-1443436 30 JN051154 Pediococcus phage clP1, complete genome 15025-15054 4 0.867
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 457051-457080 5 0.833
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 MN585972 Arthrobacter phage Edmundo, complete genome 37248-37277 6 0.8
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 226094-226123 6 0.8
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 MK894437 Microbacterium phage MonChoix, complete genome 5804-5833 6 0.8
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1460937-1460966 6 0.8
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1258097-1258126 6 0.8
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1461084-1461113 6 0.8
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1211727-1211756 6 0.8
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1250630-1250659 6 0.8
NZ_CP028275_1 1.8|1442747|30|NZ_CP028275|CRISPRCasFinder,CRT 1442747-1442776 30 NZ_AP018205 Leptolyngbya boryana NIES-2135 plasmid plasmid2 DNA, complete genome 71233-71262 6 0.8
NZ_CP028275_1 1.8|1442747|30|NZ_CP028275|CRISPRCasFinder,CRT 1442747-1442776 30 NZ_AP014640 Leptolyngbya boryana IAM M-101 plasmid pLBX 434240-434269 6 0.8
NZ_CP028275_1 1.14|1443143|30|NZ_CP028275|CRISPRCasFinder,CRT 1443143-1443172 30 MN119376 Streptomyces phage Geostin, complete genome 10843-10872 6 0.8
NZ_CP028275_1 1.14|1443143|30|NZ_CP028275|CRISPRCasFinder,CRT 1443143-1443172 30 MH155868 Streptomyces phage FlowerPower, complete genome 10843-10872 6 0.8
NZ_CP028275_1 1.14|1443143|30|NZ_CP028275|CRISPRCasFinder,CRT 1443143-1443172 30 MN284894 Streptomyces phage Fabian, complete genome 10843-10872 6 0.8
NZ_CP028275_1 1.21|1443605|30|NZ_CP028275|CRISPRCasFinder,CRT 1443605-1443634 30 NZ_CP044283 Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence 239270-239299 6 0.8
NZ_CP028275_1 1.21|1443605|30|NZ_CP028275|CRISPRCasFinder,CRT 1443605-1443634 30 NZ_CP017303 Rhodococcus sp. YL-1 plasmid pYLL1 sequence 104800-104829 6 0.8
NZ_CP028275_1 1.21|1443605|30|NZ_CP028275|CRISPRCasFinder,CRT 1443605-1443634 30 NZ_CP042915 Rhodococcus qingshengii strain RL1 plasmid unnamed2 184929-184958 6 0.8
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 MK250021 Prevotella phage Lak-B2, complete genome 300362-300391 6 0.8
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 MK250024 Prevotella phage Lak-B5, complete genome 294384-294413 6 0.8
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 MK250028 Prevotella phage Lak-B9, complete genome 299274-299303 6 0.8
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 MK250023 Prevotella phage Lak-B4, complete genome 300906-300935 6 0.8
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 MK250025 Prevotella phage Lak-B6, complete genome 297576-297605 6 0.8
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 MK250022 Prevotella phage Lak-B3, complete genome 297591-297620 6 0.8
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 MK250027 Prevotella phage Lak-B8, complete genome 299598-299627 6 0.8
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 MK250026 Prevotella phage Lak-B7, complete genome 298656-298685 6 0.8
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 MK250020 Prevotella phage Lak-B1, complete genome 299257-299286 6 0.8
NZ_CP028275_1 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT 1442285-1442314 30 KX961630 Bacillus phage QCM8, complete genome 50060-50089 7 0.767
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1676275-1676304 7 0.767
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 AX955019 Sequence 1 from Patent WO03093461 24256-24285 7 0.767
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 566335-566364 7 0.767
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 265258-265287 7 0.767
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NZ_KU140623 Sinorhizobium sp. M14 plasmid pSinB, complete sequence 185121-185150 7 0.767
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 MF614628 Sinorhizobium phage phi3LM21, complete genome 5122-5151 7 0.767
NZ_CP028275_1 1.5|1442549|30|NZ_CP028275|CRISPRCasFinder,CRT 1442549-1442578 30 KX507046 Vibrio phage S4-7, complete genome 56857-56886 7 0.767
NZ_CP028275_1 1.8|1442747|30|NZ_CP028275|CRISPRCasFinder,CRT 1442747-1442776 30 MH669013 Gordonia phage Skysand, complete genome 27210-27239 7 0.767
NZ_CP028275_1 1.8|1442747|30|NZ_CP028275|CRISPRCasFinder,CRT 1442747-1442776 30 MK977699 Gordonia Phage Lollipop1437, complete genome 27754-27783 7 0.767
NZ_CP028275_1 1.17|1443341|30|NZ_CP028275|CRISPRCasFinder,CRT 1443341-1443370 30 LR215721 Staphylococcus phage Stab22 genome assembly, chromosome: I 2364-2393 7 0.767
NZ_CP028275_1 1.17|1443341|30|NZ_CP028275|CRISPRCasFinder,CRT 1443341-1443370 30 LR215721 Staphylococcus phage Stab22 genome assembly, chromosome: I 144638-144667 7 0.767
NZ_CP028275_1 1.19|1443473|30|NZ_CP028275|CRISPRCasFinder,CRT 1443473-1443502 30 NC_014389 Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence 275012-275041 7 0.767
NZ_CP028275_1 1.23|1443737|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR 1443737-1443766 30 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 173494-173523 7 0.767
NZ_CP028275_1 1.23|1443737|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR 1443737-1443766 30 NZ_LN868941 Nocardia farcinica strain NCTC11134 plasmid 4, complete sequence 83638-83667 7 0.767
NZ_CP028275_1 1.23|1443737|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR 1443737-1443766 30 NZ_CP031419 Nocardia farcinica strain W6977 plasmid unnamed1, complete sequence 25519-25548 7 0.767
NZ_CP028275_1 1.26|1443935|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR 1443935-1443964 30 NZ_CP024791 Nostoc flagelliforme CCNUN1 plasmid pNFSY06, complete sequence 197362-197391 7 0.767
NZ_CP028275_1 1.26|1443935|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR 1443935-1443964 30 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 122733-122762 7 0.767
NZ_CP028275_1 1.29|1444133|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR 1444133-1444162 30 NZ_CP015089 Pelagibaca abyssi strain JLT2014 plasmid pPABY5, complete sequence 37190-37219 7 0.767
NZ_CP028275_1 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT 1442285-1442314 30 MN013089 Bacillus phage vB_BspM_MarvelLand, complete genome 137765-137794 8 0.733
NZ_CP028275_1 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT 1442285-1442314 30 MH688040 Salmonella phage Mooltan, complete genome 70183-70212 8 0.733
NZ_CP028275_1 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT 1442285-1442314 30 NC_025446 Escherichia phage ECML-4, complete genome 125647-125676 8 0.733
NZ_CP028275_1 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT 1442285-1442314 30 MN342150 Escherichia phage vB_EcoM_3HA11, complete genome 38164-38193 8 0.733
NZ_CP028275_1 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT 1442285-1442314 30 NC_023856 Salmonella phage vB_SalM_SJ2, complete genome 146281-146310 8 0.733
NZ_CP028275_1 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT 1442285-1442314 30 MH427377 Escherichia phage vB_EcoM Sa157lw, complete genome 38644-38673 8 0.733
NZ_CP028275_1 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT 1442285-1442314 30 FQ312032 Salmonella phage Vi01 complete sequence 90217-90246 8 0.733
NZ_CP028275_1 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT 1442285-1442314 30 NC_015296 Salmonella phage Vi01, complete genome 90217-90246 8 0.733
NZ_CP028275_1 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT 1442285-1442314 30 MN066127 Salmonella phage Matapan, complete genome 70171-70200 8 0.733
NZ_CP028275_1 1.2|1442351|30|NZ_CP028275|CRISPRCasFinder,CRT 1442351-1442380 30 NC_004349 Shewanella oneidensis MR-1 megaplasmid, complete sequence 34495-34524 8 0.733
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 44384-44413 8 0.733
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 JN106173 Uncultured bacterium plasmid pAKD31, complete sequence 48838-48867 8 0.733
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 JN106174 Uncultured bacterium plasmid pAKD33, complete sequence 52672-52701 8 0.733
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 JN106165 Uncultured bacterium plasmid pAKD14, complete sequence 43322-43351 8 0.733
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 JN106166 Uncultured bacterium plasmid pAKD15, complete sequence 61248-61277 8 0.733
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 JN106168 Uncultured bacterium plasmid pAKD17, complete sequence 46452-46481 8 0.733
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NZ_CP038640 Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence 32603-32632 8 0.733
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 613932-613961 8 0.733
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NC_019320 Variovorax sp. DB1 plasmid pDB1, complete sequence 31677-31706 8 0.733
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 KY676784 Streptomyces phage ToastyFinz, complete genome 4751-4780 8 0.733
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 KY092482 Streptomyces phage Mojorita, complete genome 4976-5005 8 0.733
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 KY092480 Streptomyces phage Picard, complete genome 4976-5005 8 0.733
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NZ_LR134463 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence 98986-99015 8 0.733
NZ_CP028275_1 1.8|1442747|30|NZ_CP028275|CRISPRCasFinder,CRT 1442747-1442776 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 708167-708196 8 0.733
NZ_CP028275_1 1.9|1442813|30|NZ_CP028275|CRISPRCasFinder,CRT 1442813-1442842 30 MH617654 Caudovirales sp. isolate ctbf53, complete genome 22891-22920 8 0.733
NZ_CP028275_1 1.12|1443011|30|NZ_CP028275|CRISPRCasFinder,CRT 1443011-1443040 30 KM879463 Arthrobacter phage vB_ArtM-ArV1, complete genome 15860-15889 8 0.733
NZ_CP028275_1 1.21|1443605|30|NZ_CP028275|CRISPRCasFinder,CRT 1443605-1443634 30 MH616711 Inoviridae sp. isolate ctbe45, complete genome 1436-1465 8 0.733
NZ_CP028275_1 1.23|1443737|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR 1443737-1443766 30 NC_015729 Roseobacter litoralis Och 149 plasmid pRLO149_63, complete sequence 59709-59738 8 0.733
NZ_CP028275_1 1.23|1443737|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR 1443737-1443766 30 NZ_CP027408 Roseobacter denitrificans strain FDAARGOS_309 plasmid unnamed2, complete sequence 61691-61720 8 0.733
NZ_CP028275_1 1.23|1443737|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR 1443737-1443766 30 NZ_CP026745 Nocardia cyriacigeorgica strain MDA3349 isolate MDA3349 ancestor plasmid p_unnamed, complete sequence 90557-90586 8 0.733
NZ_CP028275_1 1.23|1443737|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR 1443737-1443766 30 NC_008387 Roseobacter denitrificans OCh 114 plasmid pTB2, complete sequence 30719-30748 8 0.733
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 118534-118563 8 0.733
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 312406-312435 8 0.733
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 220127-220156 8 0.733
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 88848-88877 8 0.733
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 205849-205878 8 0.733
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 88848-88877 8 0.733
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 52730-52759 8 0.733
NZ_CP028275_1 1.30|1444199|30|NZ_CP028275|CRT 1444199-1444228 30 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 88356-88385 8 0.733
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NZ_CP010801 Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence 183710-183739 9 0.7
NZ_CP028275_1 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT 1442417-1442446 30 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 909914-909943 9 0.7
NZ_CP028275_1 1.7|1442681|30|NZ_CP028275|CRISPRCasFinder,CRT 1442681-1442710 30 MN693509 Marine virus AFVG_25M367, complete genome 54175-54204 9 0.7
NZ_CP028275_1 1.7|1442681|30|NZ_CP028275|CRISPRCasFinder,CRT 1442681-1442710 30 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 20801-20830 9 0.7
NZ_CP028275_1 1.22|1443671|30|NZ_CP028275|CRISPRCasFinder,CRT 1443671-1443700 30 MN582058 Caudovirales sp. ctOwN3, complete genome 16148-16177 9 0.7

1. spacer 1.18|1443407|30|NZ_CP028275|CRISPRCasFinder,CRT matches to JX486087 (Lactobacillus phage ATCC 8014-B1, complete genome) position: , mismatch: 3, identity: 0.9

ttgaataccattccttgtttatactccatc	CRISPR spacer
gtgaataccataccttgtttataatccatc	Protospacer
 ********** *********** ******

2. spacer 1.12|1443011|30|NZ_CP028275|CRISPRCasFinder,CRT matches to JX486087 (Lactobacillus phage ATCC 8014-B1, complete genome) position: , mismatch: 4, identity: 0.867

gcggccacgaccgccatgggtgtcagcgcc	CRISPR spacer
gcggccacgaccgctatgggtgtcagttca	Protospacer
**************.***********. * 

3. spacer 1.18|1443407|30|NZ_CP028275|CRISPRCasFinder,CRT matches to JN051154 (Pediococcus phage clP1, complete genome) position: , mismatch: 4, identity: 0.867

ttgaataccattccttgtttatactccatc	CRISPR spacer
gtaaataccataccttgtttataatccatc	Protospacer
 *.******** *********** ******

4. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 5, identity: 0.833

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacacggccaccgaagaagccggcgagcag	Protospacer
 *** *********.************* .

5. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MN585972 (Arthrobacter phage Edmundo, complete genome) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
cgcaaggccaccgaggaagccgtcgataag	Protospacer
*.******************** ***   .

6. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
caccaggccacccaggaagccggcgcccat	Protospacer
*** ******** ************  *  

7. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MK894437 (Microbacterium phage MonChoix, complete genome) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gtcaaggccacggaggaagccgtcgaggtc	Protospacer
  ********* ********** **** * 

8. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta-	CRISPR spacer
ggcaaggccaccgaggcacccggcg-cctat	Protospacer
 .************** * ******  *** 

9. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta-	CRISPR spacer
ggcaaggccaccgaggcacccggcg-cctat	Protospacer
 .************** * ******  *** 

10. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta-	CRISPR spacer
ggcaaggccaccgaggcacccggcg-cctat	Protospacer
 .************** * ******  *** 

11. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta-	CRISPR spacer
ggcaaggccaccgaggcacccggcg-cctat	Protospacer
 .************** * ******  *** 

12. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cacaaggccaccgaggaagccggcgagcta-	CRISPR spacer
ggcaaggccaccgaggcacccggcg-cctat	Protospacer
 .************** * ******  *** 

13. spacer 1.8|1442747|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_AP018205 (Leptolyngbya boryana NIES-2135 plasmid plasmid2 DNA, complete genome) position: , mismatch: 6, identity: 0.8

ttaggttgagctggatcgggatcaggatcg	CRISPR spacer
tccgtttgggctgaatcgggatcaggatgg	Protospacer
*. * ***.****.************** *

14. spacer 1.8|1442747|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_AP014640 (Leptolyngbya boryana IAM M-101 plasmid pLBX) position: , mismatch: 6, identity: 0.8

ttaggttgagctggatcgggatcaggatcg	CRISPR spacer
tccgtttgggctgaatcgggatcaggatgg	Protospacer
*. * ***.****.************** *

15. spacer 1.14|1443143|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MN119376 (Streptomyces phage Geostin, complete genome) position: , mismatch: 6, identity: 0.8

gaggcttgcactagtgagttcaatcgttat-	CRISPR spacer
gaggcttggactcgtgagttcaa-caagatg	Protospacer
******** *** ********** *.  ** 

16. spacer 1.14|1443143|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MH155868 (Streptomyces phage FlowerPower, complete genome) position: , mismatch: 6, identity: 0.8

gaggcttgcactagtgagttcaatcgttat-	CRISPR spacer
gaggcttggactcgtgagttcaa-caagatg	Protospacer
******** *** ********** *.  ** 

17. spacer 1.14|1443143|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MN284894 (Streptomyces phage Fabian, complete genome) position: , mismatch: 6, identity: 0.8

gaggcttgcactagtgagttcaatcgttat-	CRISPR spacer
gaggcttggactcgtgagttcaa-caagatg	Protospacer
******** *** ********** *.  ** 

18. spacer 1.21|1443605|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 6, identity: 0.8

caatcagaaagaagatgacgactataatgc	CRISPR spacer
cgatcagaaagaagaagacgaccatcaacc	Protospacer
*.************* ******.** *  *

19. spacer 1.21|1443605|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP017303 (Rhodococcus sp. YL-1 plasmid pYLL1 sequence) position: , mismatch: 6, identity: 0.8

caatcagaaagaagatgacgactataatgc	CRISPR spacer
cgatcagaaagaagaagacgaccatcaacc	Protospacer
*.************* ******.** *  *

20. spacer 1.21|1443605|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 6, identity: 0.8

caatcagaaagaagatgacgactataatgc	CRISPR spacer
cgatcagaaagaagaagacgaccatcaacc	Protospacer
*.************* ******.** *  *

21. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to MK250021 (Prevotella phage Lak-B2, complete genome) position: , mismatch: 6, identity: 0.8

-agcataatgtattatgtaacatattatgtt	CRISPR spacer
ctacat-atgtattatgtaacatatattgta	Protospacer
  .*** ******************  *** 

22. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to MK250024 (Prevotella phage Lak-B5, complete genome) position: , mismatch: 6, identity: 0.8

-agcataatgtattatgtaacatattatgtt	CRISPR spacer
ctacat-atgtattatgtaacatatattgta	Protospacer
  .*** ******************  *** 

23. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to MK250028 (Prevotella phage Lak-B9, complete genome) position: , mismatch: 6, identity: 0.8

-agcataatgtattatgtaacatattatgtt	CRISPR spacer
ctacat-atgtattatgtaacatatattgta	Protospacer
  .*** ******************  *** 

24. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to MK250023 (Prevotella phage Lak-B4, complete genome) position: , mismatch: 6, identity: 0.8

-agcataatgtattatgtaacatattatgtt	CRISPR spacer
ctacat-atgtattatgtaacatatattgta	Protospacer
  .*** ******************  *** 

25. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to MK250025 (Prevotella phage Lak-B6, complete genome) position: , mismatch: 6, identity: 0.8

-agcataatgtattatgtaacatattatgtt	CRISPR spacer
ctacat-atgtattatgtaacatatattgta	Protospacer
  .*** ******************  *** 

26. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to MK250022 (Prevotella phage Lak-B3, complete genome) position: , mismatch: 6, identity: 0.8

-agcataatgtattatgtaacatattatgtt	CRISPR spacer
ctacat-atgtattatgtaacatatattgta	Protospacer
  .*** ******************  *** 

27. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 6, identity: 0.8

-agcataatgtattatgtaacatattatgtt	CRISPR spacer
ctacat-atgtattatgtaacatatattgta	Protospacer
  .*** ******************  *** 

28. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 6, identity: 0.8

-agcataatgtattatgtaacatattatgtt	CRISPR spacer
ctacat-atgtattatgtaacatatattgta	Protospacer
  .*** ******************  *** 

29. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to MK250020 (Prevotella phage Lak-B1, complete genome) position: , mismatch: 6, identity: 0.8

-agcataatgtattatgtaacatattatgtt	CRISPR spacer
ctacat-atgtattatgtaacatatattgta	Protospacer
  .*** ******************  *** 

30. spacer 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT matches to KX961630 (Bacillus phage QCM8, complete genome) position: , mismatch: 7, identity: 0.767

aaaatggatttctgagcattactgtccgac	CRISPR spacer
taaatggatttctgagcattactacggaaa	Protospacer
 **********************..  .* 

31. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
tacacggccaccgaggcagccggcgcgtcg	Protospacer
.*** *********** ******** *...

32. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to AX955019 (Sequence 1 from Patent WO03093461) position: , mismatch: 7, identity: 0.767

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacgccaccaccgaggaagccgccgagctc	Protospacer
 **.  .*************** ****** 

33. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 7, identity: 0.767

cacaag---gccaccgaggaagccggcgagcta	CRISPR spacer
---atgcttgccaccgaggaaaccggcaagctc	Protospacer
   * *   ************.*****.**** 

34. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 7, identity: 0.767

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gaacaggccaccgagatagccggcgagtga	Protospacer
 *  ***********. **********. *

35. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_KU140623 (Sinorhizobium sp. M14 plasmid pSinB, complete sequence) position: , mismatch: 7, identity: 0.767

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
atcaacgccaccgaggaagccgccgcggtt	Protospacer
  *** **************** ** * * 

36. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MF614628 (Sinorhizobium phage phi3LM21, complete genome) position: , mismatch: 7, identity: 0.767

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaaggccgccgaggaaaccggcctgccg	Protospacer
 ********.********.*****  **..

37. spacer 1.5|1442549|30|NZ_CP028275|CRISPRCasFinder,CRT matches to KX507046 (Vibrio phage S4-7, complete genome) position: , mismatch: 7, identity: 0.767

taggtttactcatggtaaatcctcctatgt	CRISPR spacer
caggtttccacatggtaaatcctctagtgg	Protospacer
.****** * **************. .** 

38. spacer 1.8|1442747|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MH669013 (Gordonia phage Skysand, complete genome) position: , mismatch: 7, identity: 0.767

ttaggttgagctggatcgggatcaggatcg	CRISPR spacer
cgagcaggcgcaggatcgggatcaggatcg	Protospacer
. **   * ** ******************

39. spacer 1.8|1442747|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MK977699 (Gordonia Phage Lollipop1437, complete genome) position: , mismatch: 7, identity: 0.767

ttaggttgagctggatcgggatcaggatcg	CRISPR spacer
cgagcaggcgcaggatcgggatcaggatcg	Protospacer
. **   * ** ******************

40. spacer 1.17|1443341|30|NZ_CP028275|CRISPRCasFinder,CRT matches to LR215721 (Staphylococcus phage Stab22 genome assembly, chromosome: I) position: , mismatch: 7, identity: 0.767

aggatatatgaaattagtacatgtactagt	CRISPR spacer
attttatatgaaattagtatatgaactcat	Protospacer
*   ***************.*** *** .*

41. spacer 1.17|1443341|30|NZ_CP028275|CRISPRCasFinder,CRT matches to LR215721 (Staphylococcus phage Stab22 genome assembly, chromosome: I) position: , mismatch: 7, identity: 0.767

aggatatatgaaattagtacatgtactagt	CRISPR spacer
attttatatgaaattagtatatgaactcat	Protospacer
*   ***************.*** *** .*

42. spacer 1.19|1443473|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NC_014389 (Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence) position: , mismatch: 7, identity: 0.767

agttcataatcatatgatctaagtgacggt	CRISPR spacer
ggtatcgaatcatatgatgtaagagacggt	Protospacer
.** .  *********** **** ******

43. spacer 1.23|1443737|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 7, identity: 0.767

aactgggagcggtcaacaccccaggctgtg	CRISPR spacer
gcacgggagcggtcgacaccccgggctgtt	Protospacer
.  .**********.*******.****** 

44. spacer 1.23|1443737|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN868941 (Nocardia farcinica strain NCTC11134 plasmid 4, complete sequence) position: , mismatch: 7, identity: 0.767

aactgggagcggtcaacaccccaggctgtg	CRISPR spacer
gcacgggagcggtcgacaccccgggctgtt	Protospacer
.  .**********.*******.****** 

45. spacer 1.23|1443737|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031419 (Nocardia farcinica strain W6977 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

aactgggagcggtcaacaccccaggctgtg	CRISPR spacer
gcacgggagcggtcgacaccccgggctgtt	Protospacer
.  .**********.*******.****** 

46. spacer 1.26|1443935|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024791 (Nostoc flagelliforme CCNUN1 plasmid pNFSY06, complete sequence) position: , mismatch: 7, identity: 0.767

caataccatagtagtcaattattacacgtc	CRISPR spacer
ccataccatcgtattcaattattactttcc	Protospacer
* ******* *** *********** . .*

47. spacer 1.26|1443935|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 7, identity: 0.767

caataccatagtagtcaattattacacgtc	CRISPR spacer
aaataccatagtcgtcaattatcatatttt	Protospacer
 *********** *********.*.*. *.

48. spacer 1.29|1444133|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015089 (Pelagibaca abyssi strain JLT2014 plasmid pPABY5, complete sequence) position: , mismatch: 7, identity: 0.767

gatggtgctgttgcacgtgatcccgcgctt	CRISPR spacer
ctccgagctgttccaggtgatcccgcgctt	Protospacer
  . * ****** ** **************

49. spacer 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MN013089 (Bacillus phage vB_BspM_MarvelLand, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
taaatggatttccgagcattactacggaaa	Protospacer
 ***********.**********..  .* 

50. spacer 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MH688040 (Salmonella phage Mooltan, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

51. spacer 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NC_025446 (Escherichia phage ECML-4, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

52. spacer 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MN342150 (Escherichia phage vB_EcoM_3HA11, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

53. spacer 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NC_023856 (Salmonella phage vB_SalM_SJ2, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

54. spacer 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MH427377 (Escherichia phage vB_EcoM Sa157lw, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

55. spacer 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT matches to FQ312032 (Salmonella phage Vi01 complete sequence) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

56. spacer 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NC_015296 (Salmonella phage Vi01, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

57. spacer 1.1|1442285|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MN066127 (Salmonella phage Matapan, complete genome) position: , mismatch: 8, identity: 0.733

aaaatggatttctgagcattactgtccgac	CRISPR spacer
aaaattgatttctgagtattactacatcag	Protospacer
***** **********.******.. . * 

58. spacer 1.2|1442351|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NC_004349 (Shewanella oneidensis MR-1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.733

gactataccaatgaggtcgaagcatggtta	CRISPR spacer
gactgtaccaatgaggtggaagcgccctgt	Protospacer
****.************ *****..  *  

59. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacgaggccgccgaggaagccggcggcaag	Protospacer
 **.*****.***************.   .

60. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaacgccaccgaggaggccggccatgac	Protospacer
 **** ***********.****** *    

61. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaacgccaccgaggaggccggccatgac	Protospacer
 **** ***********.****** *    

62. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaacgccaccgaggaggccggccatgac	Protospacer
 **** ***********.****** *    

63. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaacgccaccgaggaggccggccatgac	Protospacer
 **** ***********.****** *    

64. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaacgccaccgaggaggccggccatgac	Protospacer
 **** ***********.****** *    

65. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaacgccaccgaggaggccggccatgac	Protospacer
 **** ***********.****** *    

66. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gagaaggccgccgaggaagccggcatgacg	Protospacer
 * ******.**************. * ..

67. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gacaacgccaccgaggaggccggccatgac	Protospacer
 **** ***********.****** *    

68. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to KY676784 (Streptomyces phage ToastyFinz, complete genome) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gcgaaggccgccgaggacgccggcgacgaa	Protospacer
   ******.******* ********   *

69. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to KY092482 (Streptomyces phage Mojorita, complete genome) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gagcaggccgccgaggaggccggcgagaag	Protospacer
 *  *****.*******.*********  .

70. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to KY092480 (Streptomyces phage Picard, complete genome) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
gagcaggccgccgaggaggccggcgagaag	Protospacer
 *  *****.*******.*********  .

71. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 8, identity: 0.733

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
ttccgcgccgccgagaaagccggcgagctc	Protospacer
. * . ***.*****.************* 

72. spacer 1.8|1442747|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttaggttgagctggatcgggatcaggatcg	CRISPR spacer
gcgggttgagctggaacgggatcaggccga	Protospacer
 ..************ ********** . .

73. spacer 1.9|1442813|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MH617654 (Caudovirales sp. isolate ctbf53, complete genome) position: , mismatch: 8, identity: 0.733

tctgttgtttaatttgttttagattgttac	CRISPR spacer
attgttgtttaatttgtttaacatttacag	Protospacer
 .***************** * ***  .* 

74. spacer 1.12|1443011|30|NZ_CP028275|CRISPRCasFinder,CRT matches to KM879463 (Arthrobacter phage vB_ArtM-ArV1, complete genome) position: , mismatch: 8, identity: 0.733

gcggccacgaccgccatgggtgtcagcgcc	CRISPR spacer
ggtttccaaaccgccatgggtgtcagcacc	Protospacer
*   .*  .******************.**

75. spacer 1.21|1443605|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MH616711 (Inoviridae sp. isolate ctbe45, complete genome) position: , mismatch: 8, identity: 0.733

caatcagaaagaagatgacgactataatgc	CRISPR spacer
gtggcagaaagaagatgacgcctatgcttc	Protospacer
  . **************** ****. * *

76. spacer 1.23|1443737|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR matches to NC_015729 (Roseobacter litoralis Och 149 plasmid pRLO149_63, complete sequence) position: , mismatch: 8, identity: 0.733

aactgggagcggtcaacaccccaggctgtg	CRISPR spacer
ttctgggagaggtcaacacccccggcctgc	Protospacer
  ******* ************ ***.   

77. spacer 1.23|1443737|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027408 (Roseobacter denitrificans strain FDAARGOS_309 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

aactgggagcggtcaacaccccaggctgtg	CRISPR spacer
ttctgggagaggtcaacacccccggcctgc	Protospacer
  ******* ************ ***.   

78. spacer 1.23|1443737|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026745 (Nocardia cyriacigeorgica strain MDA3349 isolate MDA3349 ancestor plasmid p_unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

aactgggagcggtcaacaccccaggctgtg	CRISPR spacer
gcacaggagcggtcgacaccccgggctgtt	Protospacer
.  ..*********.*******.****** 

79. spacer 1.23|1443737|30|NZ_CP028275|CRISPRCasFinder,CRT,PILER-CR matches to NC_008387 (Roseobacter denitrificans OCh 114 plasmid pTB2, complete sequence) position: , mismatch: 8, identity: 0.733

aactgggagcggtcaacaccccaggctgtg	CRISPR spacer
ttctgggagaggtcaacacccccggcctgc	Protospacer
  ******* ************ ***.   

80. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 8, identity: 0.733

agcataatgtattatgtaacatattatgtt	CRISPR spacer
tacctaatttattttgtaacatattattca	Protospacer
 .* **** **** ************* . 

81. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

agcataatgtattatgtaacatattatgtt	CRISPR spacer
tacctaatttattttgtaacatattattca	Protospacer
 .* **** **** ************* . 

82. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733

agcataatgtattatgtaacatattatgtt	CRISPR spacer
tacctaatttattttgtaacatattattca	Protospacer
 .* **** **** ************* . 

83. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 8, identity: 0.733

agcataatgtattatgtaacatattatgtt	CRISPR spacer
tacctaatttattttgtaacatattattca	Protospacer
 .* **** **** ************* . 

84. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733

agcataatgtattatgtaacatattatgtt	CRISPR spacer
tacctaatttattttgtaacatattattca	Protospacer
 .* **** **** ************* . 

85. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.733

agcataatgtattatgtaacatattatgtt	CRISPR spacer
tacctaatttattttgtaacatattattca	Protospacer
 .* **** **** ************* . 

86. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.733

agcataatgtattatgtaacatattatgtt	CRISPR spacer
tacctaatttattttgtaacatattattca	Protospacer
 .* **** **** ************* . 

87. spacer 1.30|1444199|30|NZ_CP028275|CRT matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733

agcataatgtattatgtaacatattatgtt	CRISPR spacer
tacctaatttattttgtaacatattattca	Protospacer
 .* **** **** ************* . 

88. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP010801 (Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence) position: , mismatch: 9, identity: 0.7

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
atccccttcaccgaggaagccggcgtgctc	Protospacer
  *    .***************** *** 

89. spacer 1.3|1442417|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 9, identity: 0.7

cacaaggccaccgaggaagccggcgagcta	CRISPR spacer
aagcgcgccaccgaggatgccggcgagggc	Protospacer
 *  . *********** *********   

90. spacer 1.7|1442681|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MN693509 (Marine virus AFVG_25M367, complete genome) position: , mismatch: 9, identity: 0.7

aactcatcataaatgacgtcttttaccgag	CRISPR spacer
tcatcatcataaacgacttcttttactcct	Protospacer
   **********.*** ********.   

91. spacer 1.7|1442681|30|NZ_CP028275|CRISPRCasFinder,CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 9, identity: 0.7

aactcatcataaatgacgtcttttaccgag	CRISPR spacer
tcatcatcataaatggcgtcttttttttat	Protospacer
   ************.******** .. * 

92. spacer 1.22|1443671|30|NZ_CP028275|CRISPRCasFinder,CRT matches to MN582058 (Caudovirales sp. ctOwN3, complete genome) position: , mismatch: 9, identity: 0.7

gacttataccagcagtaccgaagacggtta	CRISPR spacer
actagataccagcagtaccgaatacggcac	Protospacer
. .  ***************** ****.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 179081 : 219075 46 Oenococcus_phage(39.39%) holin,protease,capsid,portal,terminase,tail NA
DBSCAN-SWA_2 433108 : 441622 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 1656016 : 1705978 50 Bacillus_virus(50.0%) bacteriocin,protease NA
DBSCAN-SWA_4 1898780 : 1907404 11 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_5 2529991 : 2541957 9 Lactobacillus_phage(87.5%) NA NA
DBSCAN-SWA_6 3018059 : 3079409 60 Lactobacillus_phage(17.65%) integrase,transposase,protease,tRNA attL 3059950:3059967|attR 3086232:3086249
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP028280
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028280_1 15299-15455 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP013752 Lactobacillus plantarum strain KP plasmid unnamed3, complete sequence 33084-33166 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP023177 Lactobacillus plantarum strain BDGP2 plasmid pLtBDGP2C, complete sequence 2282-2364 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP037432 Lactobacillus plantarum strain EM plasmid pEM3, complete sequence 20405-20487 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP037432 Lactobacillus plantarum strain EM plasmid pEM3, complete sequence 32434-32516 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP035575 Lactobacillus plantarum strain SRCM103303 plasmid unnamed4 27497-27579 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP013756 Lactobacillus plantarum strain DF plasmid unnamed3, complete sequence 12389-12471 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP013756 Lactobacillus plantarum strain DF plasmid unnamed3, complete sequence 60459-60541 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP028280 Lactobacillus plantarum strain SRCM100995 plasmid unnamed5, complete sequence 15336-15418 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP031319 Lactobacillus plantarum strain DR7 plasmid unnamed1, complete sequence 27217-27299 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP029350 Lactobacillus plantarum strain HAC01 plasmid pLP-HAC01, complete sequence 2645-2727 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NC_015429 Lactobacillus buchneri NRRL B-30929 plasmid pLBUC02, complete sequence 17641-17723 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP032467 Lactobacillus plantarum strain ATG-K8 plasmid pK8, complete sequence 10898-10980 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP032467 Lactobacillus plantarum strain ATG-K8 plasmid pK8, complete sequence 43774-43856 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP018868 Lactobacillus alimentarius DSM 20249 plasmid pLDW-11, complete sequence 5943-6025 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP018868 Lactobacillus alimentarius DSM 20249 plasmid pLDW-11, complete sequence 54801-54883 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP028231 Lactobacillus plantarum strain SRCM101222 plasmid unnamed2, complete sequence 18509-18591 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP023492 Lactobacillus plantarum strain NCIMB 700965 plasmid unamed2, complete sequence 1319-1401 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP014919 Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-4, complete sequence 2234-2316 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP035016 Lactobacillus plantarum strain 12_3 plasmid pldD, complete sequence 8775-8857 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP020096 Lactobacillus plantarum strain K25 plasmid unnamed3, complete sequence 31875-31957 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP026507 Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed2, complete sequence 35987-36069 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP032465 Lactobacillus plantarum strain ATG-K6 plasmid pK6, complete sequence 8939-9021 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP032465 Lactobacillus plantarum strain ATG-K6 plasmid pK6, complete sequence 41815-41897 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP019723 Lactobacillus plantarum strain CLP0611 plasmid pUnnamed, complete sequence 30205-30287 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP053913 Lactobacillus plantarum subsp. plantarum strain G1 plasmid p1, complete sequence 4550-4632 23 0.723
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP040738 Lactobacillus futsaii strain Y97 plasmid p2, complete sequence 9385-9467 24 0.711
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP014884 Lactobacillus backii strain TMW 1.1991 plasmid pL11991-3, complete sequence 21803-21885 24 0.711
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP014875 Lactobacillus backii strain TMW 1.1989 plasmid pL11989-2, complete sequence 21765-21847 24 0.711
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP014627 Lactobacillus backii strain TMW 1.1988 plasmid L11988-3, complete sequence 5895-5977 24 0.711
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP014892 Lactobacillus backii strain TMW 1.1992 plasmid pL11992-2, complete sequence 29785-29867 24 0.711
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP014901 Lactobacillus backii strain TMW 1.2002 plasmid pL12002-2, complete sequence 12372-12454 24 0.711
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP035561 Lactobacillus plantarum strain SRCM103297 plasmid unnamed5 2455-2537 24 0.711
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP035561 Lactobacillus plantarum strain SRCM103297 plasmid unnamed5 44108-44190 24 0.711
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP028336 Lactobacillus plantarum strain SRCM101167 plasmid unnamed2, complete sequence 2281-2363 24 0.711
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP012278 Pediococcus damnosus strain TMW 2.1533 plasmid pL21533-3, complete sequence 43262-43344 25 0.699
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NZ_CP032745 Lactobacillus paraplantarum strain DSM 10667 plasmid unnamed1, complete sequence 39955-40037 34 0.59
NZ_CP028280_1 1.1|15336|83|NZ_CP028280|CRISPRCasFinder 15336-15418 83 NC_016607 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-4, complete sequence 3707-3789 35 0.578

1. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP013752 (Lactobacillus plantarum strain KP plasmid unnamed3, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

2. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP023177 (Lactobacillus plantarum strain BDGP2 plasmid pLtBDGP2C, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

3. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP037432 (Lactobacillus plantarum strain EM plasmid pEM3, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

4. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP037432 (Lactobacillus plantarum strain EM plasmid pEM3, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

5. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP035575 (Lactobacillus plantarum strain SRCM103303 plasmid unnamed4) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

6. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP013756 (Lactobacillus plantarum strain DF plasmid unnamed3, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

7. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP013756 (Lactobacillus plantarum strain DF plasmid unnamed3, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

8. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP028280 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed5, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

9. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP031319 (Lactobacillus plantarum strain DR7 plasmid unnamed1, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

10. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP029350 (Lactobacillus plantarum strain HAC01 plasmid pLP-HAC01, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

11. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NC_015429 (Lactobacillus buchneri NRRL B-30929 plasmid pLBUC02, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

12. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP032467 (Lactobacillus plantarum strain ATG-K8 plasmid pK8, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

13. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP032467 (Lactobacillus plantarum strain ATG-K8 plasmid pK8, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

14. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP018868 (Lactobacillus alimentarius DSM 20249 plasmid pLDW-11, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

15. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP018868 (Lactobacillus alimentarius DSM 20249 plasmid pLDW-11, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

16. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP028231 (Lactobacillus plantarum strain SRCM101222 plasmid unnamed2, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

17. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP023492 (Lactobacillus plantarum strain NCIMB 700965 plasmid unamed2, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

18. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP014919 (Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-4, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

19. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP035016 (Lactobacillus plantarum strain 12_3 plasmid pldD, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

20. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP020096 (Lactobacillus plantarum strain K25 plasmid unnamed3, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

21. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP026507 (Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed2, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

22. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP032465 (Lactobacillus plantarum strain ATG-K6 plasmid pK6, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

23. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP032465 (Lactobacillus plantarum strain ATG-K6 plasmid pK6, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

24. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP019723 (Lactobacillus plantarum strain CLP0611 plasmid pUnnamed, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

25. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP053913 (Lactobacillus plantarum subsp. plantarum strain G1 plasmid p1, complete sequence) position: , mismatch: 23, identity: 0.723

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************************************************

26. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP040738 (Lactobacillus futsaii strain Y97 plasmid p2, complete sequence) position: , mismatch: 24, identity: 0.711

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccctttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
************************.***********************************

27. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP014884 (Lactobacillus backii strain TMW 1.1991 plasmid pL11991-3, complete sequence) position: , mismatch: 24, identity: 0.711

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaaacggacttctcaaaaagagaaacccg	Protospacer
**********************************.*************************

28. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP014875 (Lactobacillus backii strain TMW 1.1989 plasmid pL11989-2, complete sequence) position: , mismatch: 24, identity: 0.711

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaaacggacttctcaaaaagagaaacccg	Protospacer
**********************************.*************************

29. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP014627 (Lactobacillus backii strain TMW 1.1988 plasmid L11988-3, complete sequence) position: , mismatch: 24, identity: 0.711

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaaacggacttctcaaaaagagaaacccg	Protospacer
**********************************.*************************

30. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP014892 (Lactobacillus backii strain TMW 1.1992 plasmid pL11992-2, complete sequence) position: , mismatch: 24, identity: 0.711

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaaacggacttctcaaaaagagaaacccg	Protospacer
**********************************.*************************

31. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP014901 (Lactobacillus backii strain TMW 1.2002 plasmid pL12002-2, complete sequence) position: , mismatch: 24, identity: 0.711

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgcatgataccgttgaaccccttggtacaaacggacttctcaaaaagagaaacccg	Protospacer
**********************************.*************************

32. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP035561 (Lactobacillus plantarum strain SRCM103297 plasmid unnamed5) position: , mismatch: 24, identity: 0.711

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgtatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
******.*****************************************************

33. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP035561 (Lactobacillus plantarum strain SRCM103297 plasmid unnamed5) position: , mismatch: 24, identity: 0.711

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgtatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
******.*****************************************************

34. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP028336 (Lactobacillus plantarum strain SRCM101167 plasmid unnamed2, complete sequence) position: , mismatch: 24, identity: 0.711

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgtatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
******.*****************************************************

35. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP012278 (Pediococcus damnosus strain TMW 2.1533 plasmid pL21533-3, complete sequence) position: , mismatch: 25, identity: 0.699

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
aacccgtatgataccgttgaaccccttggtacaaacggacttctcaaaaagagaaacccg	Protospacer
******.***************************.*************************

36. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NZ_CP032745 (Lactobacillus paraplantarum strain DSM 10667 plasmid unnamed1, complete sequence) position: , mismatch: 34, identity: 0.59

aacccgcatgataccg-ttgaaccccttggtacaagcggacttctcaaaaagagaaaccc	CRISPR spacer
-gagccaatgaaatcgcctaaaccccttggtacaagcggacttctcaaaaagagaaaccc	Protospacer
 .  *  **** *.** .*.****************************************

37. spacer 1.1|15336|83|NZ_CP028280|CRISPRCasFinder matches to NC_016607 (Pediococcus claussenii ATCC BAA-344 plasmid pPECL-4, complete sequence) position: , mismatch: 35, identity: 0.578

aacccgcatgataccgttgaaccccttggtacaagcggacttctcaaaaagagaaacccg	CRISPR spacer
gagccattaaaatcgcctgaaccccttggtacaagcggacttctcaaaaagagaaacccg	Protospacer
.* **..  .*  *  .*******************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP028276
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028276_1 48691-48864 Orphan NA
4 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028276.1 48841-48870 0 1.0
NZ_CP028276_1 1.1|48709|18|NZ_CP028276|CRT 48709-48726 18 NZ_CP028276.1 48853-48870 1 0.944
NZ_CP028276_1 1.2|48745|18|NZ_CP028276|CRT 48745-48762 18 NZ_CP028276.1 48853-48870 1 0.944
NZ_CP028276_1 1.4|48829|18|NZ_CP028276|CRT 48829-48846 18 NZ_CP028276.1 48853-48870 1 0.944

1. spacer 1.3|48781|30|NZ_CP028276|CRT matches to position: 48841-48870, mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

2. spacer 1.1|48709|18|NZ_CP028276|CRT matches to position: 48853-48870, mismatch: 1, identity: 0.944

gccagtaatacagccagt	CRISPR spacer
gccagtaatacagtcagt	Protospacer
*************.****

3. spacer 1.2|48745|18|NZ_CP028276|CRT matches to position: 48853-48870, mismatch: 1, identity: 0.944

gccagtaatacagccagt	CRISPR spacer
gccagtaatacagtcagt	Protospacer
*************.****

4. spacer 1.4|48829|18|NZ_CP028276|CRT matches to position: 48853-48870, mismatch: 1, identity: 0.944

gccagtaatacagccagt	CRISPR spacer
gccagtaatacagtcagt	Protospacer
*************.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 319-348 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 379-408 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9536-9565 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35265-35294 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35361-35390 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58136-58165 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58184-58213 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 780-809 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 876-905 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 61329-61358 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 61377-61406 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48781-48810 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48841-48870 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37968-37997 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035152 Pediococcus acidilactici strain SRCM103367 plasmid unnamed1 19468-19497 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 23101-23130 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47148-47177 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47208-47237 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26575-26604 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26623-26652 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36706-36735 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36754-36783 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45368-45397 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45416-45445 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 16-45 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 100-129 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 148-177 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16129-16158 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16177-16206 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16225-16254 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76584-76613 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76632-76661 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76680-76709 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21582-21611 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21690-21719 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21738-21767 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5281-5310 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5329-5358 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5377-5406 0 1.0
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 283-312 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 295-324 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 307-336 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 355-384 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 367-396 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 391-420 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9439-9468 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9524-9553 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9572-9601 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9584-9613 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35229-35258 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35241-35270 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35253-35282 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35301-35330 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35313-35342 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35325-35354 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35337-35366 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35349-35378 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35373-35402 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 57992-58021 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58004-58033 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58016-58045 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58028-58057 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58040-58069 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58052-58081 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58064-58093 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58076-58105 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58088-58117 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58100-58129 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58112-58141 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58124-58153 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58172-58201 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 744-773 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 756-785 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 768-797 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 816-845 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 828-857 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 840-869 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 852-881 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 864-893 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 888-917 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 61317-61346 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 61365-61394 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 61389-61418 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48697-48726 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48709-48738 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48721-48750 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48733-48762 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48745-48774 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48757-48786 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48769-48798 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48817-48846 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48829-48858 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37872-37901 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37896-37925 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37932-37961 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37944-37973 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37956-37985 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035152 Pediococcus acidilactici strain SRCM103367 plasmid unnamed1 19432-19461 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035152 Pediococcus acidilactici strain SRCM103367 plasmid unnamed1 19444-19473 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035152 Pediococcus acidilactici strain SRCM103367 plasmid unnamed1 19456-19485 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 23029-23058 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 23065-23094 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 23077-23106 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 23089-23118 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47160-47189 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47172-47201 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47220-47249 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47232-47261 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47244-47273 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47256-47285 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47268-47297 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47280-47309 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47292-47321 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47304-47333 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26587-26616 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26635-26664 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26647-26676 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26659-26688 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26671-26700 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26683-26712 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26695-26724 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26707-26736 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26719-26748 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36718-36747 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36766-36795 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36778-36807 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36790-36819 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36802-36831 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36814-36843 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36826-36855 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36838-36867 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36850-36879 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45380-45409 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45428-45457 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45440-45469 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45452-45481 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45464-45493 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45476-45505 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45488-45517 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45500-45529 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45512-45541 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 4-33 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 28-57 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 40-69 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 52-81 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 64-93 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 112-141 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 160-189 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16117-16146 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16141-16170 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16189-16218 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16237-16266 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76572-76601 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76596-76625 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76644-76673 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76692-76721 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21570-21599 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21594-21623 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21606-21635 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21618-21647 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21630-21659 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21666-21695 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21702-21731 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21750-21779 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5293-5322 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5341-5370 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5389-5418 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5401-5430 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5413-5442 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP015919 Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence 32329-32358 1 0.967
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 331-360 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 343-372 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 403-432 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9427-9456 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9488-9517 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9500-9529 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9512-9541 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9548-9577 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9560-9589 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9451-9480 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35217-35246 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35277-35306 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 35289-35318 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 57980-58009 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58148-58177 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 58160-58189 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 732-761 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 792-821 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 804-833 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 61341-61370 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 61353-61382 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48685-48714 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48793-48822 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 48805-48834 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37884-37913 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37908-37937 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 37920-37949 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035152 Pediococcus acidilactici strain SRCM103367 plasmid unnamed1 19396-19425 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035152 Pediococcus acidilactici strain SRCM103367 plasmid unnamed1 19408-19437 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035152 Pediococcus acidilactici strain SRCM103367 plasmid unnamed1 19420-19449 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 23041-23070 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 23053-23082 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47316-47345 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47184-47213 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 47196-47225 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26731-26760 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36862-36891 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26599-26628 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 26611-26640 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36730-36759 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 36742-36771 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45524-45553 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45392-45421 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 45404-45433 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 76-105 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 88-117 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 124-153 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 136-165 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16105-16134 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16153-16182 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16165-16194 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16201-16230 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 16213-16242 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76560-76589 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76608-76637 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76620-76649 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76656-76685 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 76668-76697 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21762-21791 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21642-21671 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21654-21683 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21678-21707 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21714-21743 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 21726-21755 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5425-5454 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5305-5334 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5317-5346 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5353-5382 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 5365-5394 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP015919 Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence 32365-32394 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP015919 Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence 32341-32370 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP015919 Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence 32353-32382 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021471 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence 24436-24465 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021471 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence 24448-24477 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021471 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence 24460-24489 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021471 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence 24472-24501 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021471 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence 24484-24513 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP021471 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence 24496-24525 2 0.933
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9476-9505 4 0.867
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 9596-9625 6 0.8
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 NZ_CP015919 Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence 32317-32346 6 0.8
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 MH593836 Inoviridae sp. isolate ctbh10, complete genome 1549-1578 6 0.8
NZ_CP028276_1 1.3|48781|30|NZ_CP028276|CRT 48781-48810 30 MN047793 Xanthomonas phage Xoo-sp13, complete genome 206176-206205 7 0.767

1. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

2. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

3. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

4. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

5. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

6. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

7. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

8. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

9. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

10. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

11. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

12. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

13. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

14. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

15. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

16. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

17. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

18. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

19. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

20. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

21. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

22. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

23. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

24. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

25. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

26. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

27. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

28. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

29. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

30. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

31. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

32. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

33. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

34. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

35. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

36. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

37. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

38. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

39. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 0, identity: 1.0

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagtcagt	Protospacer
******************************

40. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

41. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

42. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

43. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

44. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

45. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagtcagt	Protospacer
*************.****************

46. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

47. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

48. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

49. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

50. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

51. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

52. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

53. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

54. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

55. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

56. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

57. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

58. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagtcagt	Protospacer
*************.****************

59. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

60. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

61. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

62. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

63. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

64. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

65. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

66. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

67. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

68. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

69. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

70. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

71. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

72. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

73. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

74. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

75. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

76. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

77. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

78. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

79. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

80. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagtcagt	Protospacer
*************.****************

81. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

82. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

83. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagtcagt	Protospacer
*************.****************

84. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

85. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

86. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

87. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

88. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

89. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

90. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

91. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

92. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

93. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagtcagt	Protospacer
 *****************************

94. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagtcagt	Protospacer
*.****************************

95. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

96. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

97. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

98. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

99. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

100. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

101. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagtcagt	Protospacer
 *****************************

102. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

103. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

104. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

105. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

106. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

107. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

108. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

109. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

110. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

111. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

112. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

113. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

114. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

115. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

116. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

117. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

118. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

119. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

120. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

121. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

122. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

123. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

124. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

125. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

126. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

127. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

128. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

129. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

130. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

131. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

132. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

133. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

134. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

135. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

136. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

137. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

138. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

139. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

140. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

141. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

142. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagtcagt	Protospacer
*************.****************

143. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

144. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

145. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

146. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

147. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

148. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

149. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagtcagt	Protospacer
*************.****************

150. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

151. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

152. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

153. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagtcagt	Protospacer
*************.****************

154. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

155. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

156. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

157. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagtcagt	Protospacer
*************.****************

158. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

159. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

160. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

161. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

162. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagtcagt	Protospacer
*.****************************

163. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

164. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

165. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

166. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

167. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

168. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

169. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

170. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP015919 (Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence) position: , mismatch: 1, identity: 0.967

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatacagccagt	Protospacer
*************************.****

171. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

172. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

173. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagtcagtaatacagtcagt	Protospacer
*.***********.****************

174. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagccagt	Protospacer
 ************************.****

175. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagacagt	Protospacer
*.*********************** ****

176. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagacagtaatacagccagt	Protospacer
************* ***********.****

177. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gacagtaatacagccagtaatacagccagt	Protospacer
* ***********************.****

178. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

179. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

180. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagt-cagt	CRISPR spacer
gccagtaatacagccagtaatacagcacag-	Protospacer
*************************. *** 

181. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagccagt	Protospacer
 ************************.****

182. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

183. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

184. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagccagt	Protospacer
 ************************.****

185. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

186. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

187. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagccagt	Protospacer
 ************************.****

188. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

189. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

190. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

191. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

192. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagccagt	Protospacer
 ************************.****

193. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

194. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

195. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

196. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

197. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

198. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagccagt	Protospacer
 ************************.****

199. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatgcagccagt	Protospacer
*********************.***.****

200. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatgcagccagtaatacagccagt	Protospacer
*********.***************.****

201. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

202. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

203. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagccagt	Protospacer
 ************************.****

204. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

205. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

206. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagccagt	Protospacer
 ************************.****

207. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagccagt	Protospacer
 ************************.****

208. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

209. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

210. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

211. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

212. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagccagt	Protospacer
 ************************.****

213. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

214. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

215. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

216. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

217. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

218. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

219. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagtcagtaatacagtcagt	Protospacer
*.***********.****************

220. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

221. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

222. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

223. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

224. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagtcagtaatacagtcagt	Protospacer
*.***********.****************

225. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

226. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

227. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

228. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

229. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagccagt	Protospacer
 ************************.****

230. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

231. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

232. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

233. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

234. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

235. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagccagt	Protospacer
 ************************.****

236. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

237. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

238. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gtcagtaatacagccagtaatacagccagt	Protospacer
*.***********************.****

239. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagtcagtaatacagccagt	Protospacer
*************.***********.****

240. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP015919 (Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagccagt	Protospacer
 ************************.****

241. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP015919 (Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatgcagccagtaatacagccagt	Protospacer
*********.***************.****

242. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP015919 (Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatgcagccagt	Protospacer
*********************.***.****

243. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021471 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
tccagtaatacagccagtaatacagccagt	Protospacer
 ************************.****

244. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021471 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatgcagccagt	Protospacer
*********************.***.****

245. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021471 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatgcagccagtaatacagccagt	Protospacer
*********.***************.****

246. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021471 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatgcagccagt	Protospacer
*********************.***.****

247. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021471 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatgcagccagtaatacagccagt	Protospacer
*********.***************.****

248. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP021471 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-1, complete sequence) position: , mismatch: 2, identity: 0.933

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtaatgcagccagt	Protospacer
*********************.***.****

249. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 4, identity: 0.867

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
cacagtaatacagtcagtaatacagccagt	Protospacer
  ***********.***********.****

250. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 6, identity: 0.8

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtcaaacagatgat	Protospacer
****************** * **** ...*

251. spacer 1.3|48781|30|NZ_CP028276|CRT matches to NZ_CP015919 (Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence) position: , mismatch: 6, identity: 0.8

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gccagtaatacagccagtcaaacagatgat	Protospacer
****************** * **** ...*

252. spacer 1.3|48781|30|NZ_CP028276|CRT matches to MH593836 (Inoviridae sp. isolate ctbh10, complete genome) position: , mismatch: 6, identity: 0.8

gccagtaatacagccagtaatacagtcagt	CRISPR spacer
gacataaagacagccagtaaaacagtcagc	Protospacer
* **  ** *********** ********.

253. spacer 1.3|48781|30|NZ_CP028276|CRT matches to MN047793 (Xanthomonas phage Xoo-sp13, complete genome) position: , mismatch: 7, identity: 0.767

--gccagtaatacagccagtaatacagtcagt	CRISPR spacer
aaactggt--tacagccagtattacagtcaga	Protospacer
  .*..**  *********** ********* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP028279
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 6310 4 Streptococcus_phage(33.33%) transposase NA
DBSCAN-SWA_2 11091 : 12021 1 unidentified_phage(100.0%) transposase NA
DBSCAN-SWA_3 15282 : 18261 3 Lactobacillus_phage(66.67%) transposase NA
DBSCAN-SWA_4 23014 : 27818 2 Liberibacter_phage(50.0%) NA NA
DBSCAN-SWA_5 30941 : 33077 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_6 39653 : 40460 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_7 44342 : 46081 2 Vibrio_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage