Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP028215 Bacillus subtilis strain SRCM102750 chromosome, complete genome 2 crisprs csa3,DinG,cas3,DEDDh 0 1 304 0
NZ_CP028216 Bacillus subtilis strain SRCM102750 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 3 0

Results visualization

1. NZ_CP028215
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028215_1 1187762-1187869 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028215_2 3175519-3175624 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP028215_1 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder 1187786-1187845 60 NZ_CP024037 Bacillus aryabhattai strain K13 plasmid unnamed2 10417-10476 7 0.883
NZ_CP028215_1 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder 1187786-1187845 60 NZ_CP026740 Bacillus megaterium strain YC4-R4 plasmid unnamed4 70764-70823 7 0.883
NZ_CP028215_1 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder 1187786-1187845 60 NC_017139 Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence 1318-1377 7 0.883
NZ_CP028215_1 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder 1187786-1187845 60 NZ_CP010587 Bacillus megaterium Q3 plasmid p1, complete sequence 838-897 7 0.883
NZ_CP028215_1 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder 1187786-1187845 60 NZ_CP023319 Bacillus megaterium strain A plasmid p2, complete sequence 75825-75884 7 0.883
NZ_CP028215_1 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder 1187786-1187845 60 NC_020451 Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence 1960-2019 9 0.85
NZ_CP028215_1 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder 1187786-1187845 60 NZ_CP015440 Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence 64773-64832 12 0.8
NZ_CP028215_1 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder 1187786-1187845 60 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 483791-483850 13 0.783
NZ_CP028215_1 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder 1187786-1187845 60 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 57361-57420 14 0.767

1. spacer 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder matches to NZ_CP024037 (Bacillus aryabhattai strain K13 plasmid unnamed2) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

2. spacer 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder matches to NZ_CP026740 (Bacillus megaterium strain YC4-R4 plasmid unnamed4) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

3. spacer 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder matches to NC_017139 (Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

4. spacer 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder matches to NZ_CP010587 (Bacillus megaterium Q3 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

5. spacer 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder matches to NZ_CP023319 (Bacillus megaterium strain A plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

6. spacer 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder matches to NC_020451 (Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence) position: , mismatch: 9, identity: 0.85

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcattttagttatggcccggg	Protospacer
****************************************** ***   * ***  **. 

7. spacer 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder matches to NZ_CP015440 (Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence) position: , mismatch: 12, identity: 0.8

cagcttggaaggctgaggttttaccactaaactacacccgca-------atttttatttg	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcataataatatataccattg	Protospacer
******************************************       ** * .  ***

8. spacer 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.783

cagcttggaaggctgaggttttaccactaaactacacccgc--------aatttttattt	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatggttaaaagttttgcca	Protospacer
*****************************************        ** ****... 

9. spacer 1.1|1187786|60|NZ_CP028215|CRISPRCasFinder matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 14, identity: 0.767

cagcttggaaggctgaggttttaccactaaactacacccgc---------aatttttatt	CRISPR spacer
cagcttggaaggctgtagttttaccactaaactacacccgcatagtaagtagttcttagt	Protospacer
*************** .************************         *.**.*** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 108527 119 Bacillus_phage(74.0%) holin,protease,tRNA,portal,terminase,plate,head,coat,capsid,tail,integrase attL 5267:5286|attR 84733:84752
DBSCAN-SWA_2 115957 : 120349 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_3 129206 : 130100 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_4 137029 : 138679 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_5 142654 : 180403 5 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_6 185845 : 189927 4 Bacillus_phage(50.0%) integrase attL 166163:166176|attR 186719:186732
DBSCAN-SWA_7 198261 : 201798 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_8 205556 : 206495 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_9 218284 : 222232 4 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_10 227156 : 227840 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_11 238402 : 251560 9 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_12 255679 : 262551 4 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_13 266991 : 269902 4 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_14 276833 : 279720 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_15 287991 : 288837 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_16 297699 : 302191 4 Halovirus(33.33%) NA NA
DBSCAN-SWA_17 335549 : 336575 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_18 346127 : 348042 3 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_19 353445 : 354063 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_20 357430 : 361411 9 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_21 377013 : 378939 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_22 384108 : 386358 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_23 390329 : 390950 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_24 394948 : 406589 11 Bacillus_phage(40.0%) tRNA NA
DBSCAN-SWA_25 410145 : 411018 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_26 415251 : 415791 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_27 419929 : 425415 6 Acinetobacter_phage(66.67%) NA NA
DBSCAN-SWA_28 428617 : 435339 9 Pandoravirus(25.0%) NA NA
DBSCAN-SWA_29 448669 : 449587 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_30 456430 : 467414 10 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_31 472893 : 480854 10 Staphylococcus_phage(57.14%) NA NA
DBSCAN-SWA_32 488324 : 488756 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_33 496395 : 502448 7 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_34 515159 : 526950 13 Erysipelothrix_phage(14.29%) NA NA
DBSCAN-SWA_35 532117 : 535119 2 Cyanophage(50.0%) NA NA
DBSCAN-SWA_36 543535 : 544258 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_37 567127 : 571785 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_38 579881 : 582217 2 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_39 595401 : 604410 8 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_40 621534 : 623451 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_41 630172 : 631775 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_42 638397 : 639006 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_43 645212 : 655263 9 Bodo_saltans_virus(20.0%) tRNA NA
DBSCAN-SWA_44 666419 : 667379 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_45 671833 : 672280 1 Xanthomonas_phage(100.0%) NA NA
DBSCAN-SWA_46 676707 : 684671 6 Catovirus(33.33%) NA NA
DBSCAN-SWA_47 689466 : 692370 2 Clostridium_botulinum_C_phage(50.0%) NA NA
DBSCAN-SWA_48 695688 : 696258 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_49 700826 : 705645 6 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_50 715736 : 716297 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_51 723590 : 724628 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_52 735044 : 735899 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_53 747374 : 748208 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_54 752842 : 759467 8 Synechococcus_phage(33.33%) protease,coat NA
DBSCAN-SWA_55 770708 : 772613 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_56 779158 : 792252 9 Tupanvirus(40.0%) NA NA
DBSCAN-SWA_57 800197 : 802262 2 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_58 807414 : 818283 11 Catovirus(20.0%) tRNA NA
DBSCAN-SWA_59 821482 : 823879 1 Virus_Rctr197k(100.0%) NA NA
DBSCAN-SWA_60 827532 : 844317 13 Bacillus_phage(25.0%) tRNA NA
DBSCAN-SWA_61 847627 : 901396 57 uncultured_Mediterranean_phage(22.22%) protease,tRNA,coat NA
DBSCAN-SWA_62 907490 : 912325 4 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_63 915897 : 916494 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_64 920079 : 920304 1 Caldibacillus_phage(100.0%) NA NA
DBSCAN-SWA_65 928376 : 928691 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_66 933996 : 940377 4 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_67 944944 : 945979 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_68 968335 : 968857 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_69 971991 : 982299 9 Enterobacteria_phage(25.0%) tRNA NA
DBSCAN-SWA_70 985543 : 996493 9 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_71 1000294 : 1002052 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_72 1006775 : 1010123 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_73 1016491 : 1020632 5 Indivirus(50.0%) NA NA
DBSCAN-SWA_74 1035546 : 1041161 5 Burkholderia_phage(33.33%) NA NA
DBSCAN-SWA_75 1049202 : 1055438 5 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_76 1060951 : 1062028 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_77 1065232 : 1069681 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_78 1081957 : 1087617 5 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_79 1090874 : 1093864 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_80 1107690 : 1110196 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_81 1118135 : 1127595 7 Staphylococcus_phage(66.67%) tRNA NA
DBSCAN-SWA_82 1130785 : 1153831 28 Staphylococcus_phage(58.33%) holin NA
DBSCAN-SWA_83 1159773 : 1164317 4 Indivirus(50.0%) NA NA
DBSCAN-SWA_84 1170241 : 1173465 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_85 1179241 : 1181638 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_86 1195979 : 1197509 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_87 1206347 : 1207196 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_88 1219611 : 1227977 4 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_89 1234399 : 1235386 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_90 1243125 : 1243947 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_91 1256628 : 1261661 4 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_92 1274986 : 1276459 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_93 1285488 : 1289976 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_94 1296091 : 1303228 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_95 1311988 : 1326296 18 Mycoplasma_phage(14.29%) protease NA
DBSCAN-SWA_96 1333076 : 1333577 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_97 1337029 : 1338010 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_98 1346076 : 1348724 2 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_99 1360586 : 1361690 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_100 1366683 : 1367670 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_101 1372584 : 1382503 15 Mycobacterium_phage(20.0%) NA NA
DBSCAN-SWA_102 1388313 : 1389222 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_103 1392592 : 1395513 4 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_104 1399140 : 1401977 3 Clostridium_phage(33.33%) protease NA
DBSCAN-SWA_105 1416720 : 1419110 2 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_106 1422193 : 1424646 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_107 1428929 : 1431777 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_108 1437351 : 1443159 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_109 1455362 : 1460042 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_110 1467763 : 1484060 19 Thermus_phage(28.57%) holin NA
DBSCAN-SWA_111 1489622 : 1490915 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_112 1504723 : 1505758 1 Microbacterium_phage(100.0%) NA NA
DBSCAN-SWA_113 1511420 : 1512326 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_114 1521734 : 1522727 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_115 1528140 : 1529307 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_116 1537495 : 1552137 14 Catovirus(20.0%) NA NA
DBSCAN-SWA_117 1559307 : 1560638 2 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_118 1572024 : 1574656 3 Catovirus(33.33%) NA NA
DBSCAN-SWA_119 1578580 : 1579360 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_120 1582657 : 1592586 8 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_121 1617933 : 1618680 1 Powai_lake_megavirus(100.0%) tRNA NA
DBSCAN-SWA_122 1624176 : 1627050 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_123 1636467 : 1639619 3 Moraxella_phage(50.0%) protease NA
DBSCAN-SWA_124 1650157 : 1650382 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_125 1656278 : 1661518 5 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_126 1665208 : 1669636 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_127 1673256 : 1690137 11 Paenibacillus_phage(14.29%) NA NA
DBSCAN-SWA_128 1695583 : 1702471 5 Hokovirus(33.33%) NA NA
DBSCAN-SWA_129 1707536 : 1712502 4 Aichi_virus(50.0%) NA NA
DBSCAN-SWA_130 1718685 : 1720167 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_131 1726502 : 1728950 2 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_132 1739506 : 1757536 19 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_133 1765403 : 1765685 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_134 1776677 : 1777550 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_135 1787998 : 1789132 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_136 1793721 : 1794753 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_137 1806187 : 1811007 6 Aeromonas_phage(50.0%) NA NA
DBSCAN-SWA_138 1814082 : 1815153 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_139 1819402 : 1819990 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_140 1824751 : 1829298 5 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_141 1834860 : 1838479 4 Acanthamoeba_polyphaga_mimivirus(50.0%) NA NA
DBSCAN-SWA_142 1841809 : 1843273 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_143 1850648 : 1925967 74 Bacillus_phage(26.67%) bacteriocin,protease,tRNA,coat NA
DBSCAN-SWA_144 1951486 : 1952674 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_145 1957418 : 1962971 4 Bacillus_phage(50.0%) protease NA
DBSCAN-SWA_146 1972465 : 1975161 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_147 1985187 : 1989793 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_148 1993552 : 1996980 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_149 2004350 : 2011180 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_150 2016702 : 2019225 2 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_151 2026879 : 2028940 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_152 2034722 : 2036162 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_153 2060787 : 2062314 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_154 2067743 : 2069045 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_155 2076763 : 2077513 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_156 2081277 : 2082264 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_157 2089126 : 2089900 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_158 2108170 : 2110051 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_159 2117667 : 2119911 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_160 2130814 : 2131963 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_161 2135821 : 2139800 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_162 2146787 : 2148278 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_163 2151934 : 2153161 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_164 2156390 : 2161636 5 Klosneuvirus(66.67%) NA NA
DBSCAN-SWA_165 2164942 : 2182151 15 Bacillus_phage(33.33%) protease NA
DBSCAN-SWA_166 2203838 : 2204360 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_167 2210144 : 2214240 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_168 2223675 : 2233921 14 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_169 2240778 : 2242402 3 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_170 2247899 : 2251748 5 Bacillus_virus(25.0%) protease NA
DBSCAN-SWA_171 2260544 : 2268065 6 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_172 2274520 : 2282375 7 Klosneuvirus(20.0%) tRNA NA
DBSCAN-SWA_173 2285419 : 2287111 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_174 2295006 : 2308472 15 Streptococcus_phage(42.86%) tRNA NA
DBSCAN-SWA_175 2314882 : 2317229 2 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_176 2322629 : 2323166 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_177 2335514 : 2343405 7 Micromonas_pusilla_virus(25.0%) protease NA
DBSCAN-SWA_178 2347257 : 2348757 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_179 2362109 : 2364542 1 Enterobacteria_phage(100.0%) protease NA
DBSCAN-SWA_180 2371988 : 2373389 1 Catovirus(100.0%) tRNA NA
DBSCAN-SWA_181 2376428 : 2376962 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_182 2380457 : 2391301 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_183 2408981 : 2410672 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_184 2415146 : 2415860 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_185 2435422 : 2436859 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_186 2458617 : 2463204 5 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_187 2475237 : 2475957 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_188 2479584 : 2482312 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_189 2491334 : 2492216 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_190 2511018 : 2512914 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_191 2534486 : 2539006 7 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_192 2542157 : 2546203 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_193 2552537 : 2553278 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_194 2559916 : 2561664 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_195 2565459 : 2570911 7 Caulobacter_phage(60.0%) NA NA
DBSCAN-SWA_196 2577125 : 2578382 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_197 2594420 : 2595239 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_198 2599713 : 2601597 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_199 2608985 : 2609996 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_200 2614429 : 2616562 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_201 2626386 : 2658482 10 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_202 2662253 : 2666073 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_203 2672357 : 2675870 2 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_204 2682704 : 2691141 10 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_205 2697696 : 2702255 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_206 2725550 : 2728693 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_207 2732684 : 2734868 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_208 2744435 : 2746676 2 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_209 2759030 : 2759957 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_210 2763878 : 2764199 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_211 2767282 : 2768767 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_212 2775013 : 2775364 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_213 2778932 : 2779721 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_214 2784202 : 2793516 10 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_215 2798451 : 2799324 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_216 2811178 : 2812051 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_217 2816401 : 2817709 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_218 2825473 : 2826115 1 Feldmannia_irregularis_virus(100.0%) NA NA
DBSCAN-SWA_219 2846276 : 2847905 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_220 2853717 : 2854347 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_221 2859620 : 2860808 1 Lambdina_fiscellaria_nucleopolyhedrovirus(100.0%) NA NA
DBSCAN-SWA_222 2870158 : 2871556 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_223 2884792 : 2893598 10 uncultured_virus(40.0%) protease,tRNA NA
DBSCAN-SWA_224 2896952 : 2899427 2 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_225 2923274 : 2924090 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_226 2934465 : 2953952 19 Synechococcus_phage(30.0%) NA NA
DBSCAN-SWA_227 2963192 : 2970556 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_228 2976778 : 2986863 4 Leptospira_phage(25.0%) NA NA
DBSCAN-SWA_229 2990130 : 2995039 4 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_230 2998733 : 2999864 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_231 3006511 : 3008245 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_232 3038088 : 3045615 4 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_233 3053973 : 3065116 10 uncultured_Caudovirales_phage(20.0%) NA NA
DBSCAN-SWA_234 3080197 : 3080335 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_235 3083462 : 3085412 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_236 3111553 : 3112954 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_237 3123416 : 3123746 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_238 3131476 : 3135006 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_239 3143387 : 3144323 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_240 3151498 : 3152035 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_241 3167299 : 3169381 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_242 3176921 : 3178664 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_243 3195266 : 3199723 4 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_244 3210717 : 3213971 2 Thermus_phage(50.0%) NA NA
DBSCAN-SWA_245 3219165 : 3224375 6 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_246 3234655 : 3237418 4 Bodo_saltans_virus(33.33%) NA NA
DBSCAN-SWA_247 3241532 : 3242357 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_248 3245805 : 3247551 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_249 3250823 : 3252290 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_250 3258030 : 3262142 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_251 3276348 : 3279880 5 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_252 3284360 : 3289277 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_253 3293789 : 3294143 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_254 3301634 : 3302531 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_255 3314331 : 3317226 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_256 3340010 : 3344599 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_257 3349518 : 3357673 8 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_258 3367312 : 3368638 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_259 3378833 : 3387168 3 Clostridium_botulinum_C_phage(50.0%) NA NA
DBSCAN-SWA_260 3392815 : 3398102 3 Bacillus_phage(50.0%) protease NA
DBSCAN-SWA_261 3408065 : 3410665 3 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_262 3426724 : 3427576 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_263 3431651 : 3433313 2 Bacteriophage(50.0%) NA NA
DBSCAN-SWA_264 3437122 : 3439413 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_265 3442485 : 3443445 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_266 3446842 : 3498636 60 Bacillus_phage(30.0%) tRNA,coat NA
DBSCAN-SWA_267 3504909 : 3507124 4 uncultured_Caudovirales_phage(66.67%) NA NA
DBSCAN-SWA_268 3516708 : 3587242 84 Bacillus_phage(27.03%) holin,tRNA,portal,terminase,plate,coat NA
DBSCAN-SWA_269 3595467 : 3598315 2 Salmonella_phage(50.0%) protease NA
DBSCAN-SWA_270 3602170 : 3603178 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_271 3606970 : 3608863 2 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_272 3617525 : 3633039 15 Streptococcus_phage(33.33%) protease NA
DBSCAN-SWA_273 3642510 : 3646322 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_274 3649683 : 3653024 4 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_275 3658247 : 3660958 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_276 3674664 : 3682575 8 Pneumococcus_phage(40.0%) protease NA
DBSCAN-SWA_277 3687640 : 3698424 9 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_278 3702764 : 3713659 8 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_279 3717214 : 3717979 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_280 3722832 : 3724663 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_281 3728667 : 3729114 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_282 3735680 : 3741900 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_283 3748160 : 3749783 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_284 3753651 : 3755406 2 Paenibacillus_phage(50.0%) NA NA
DBSCAN-SWA_285 3761166 : 3762530 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_286 3767650 : 3769063 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_287 3781903 : 3786576 5 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_288 3802162 : 3806347 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_289 3835066 : 3843138 5 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_290 3849138 : 3859532 9 Moumouvirus(25.0%) tRNA NA
DBSCAN-SWA_291 3865100 : 3869743 5 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_292 3873745 : 3883735 9 Acanthocystis_turfacea_Chlorella_virus(20.0%) tRNA NA
DBSCAN-SWA_293 3886924 : 3888871 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_294 3900295 : 3902242 3 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_295 3913230 : 3913998 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_296 3918359 : 3925859 6 Thermus_phage(25.0%) protease,tRNA NA
DBSCAN-SWA_297 3952272 : 3953037 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_298 3956993 : 3957776 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_299 3962912 : 3974564 10 Clostridium_phage(33.33%) tRNA NA
DBSCAN-SWA_300 3978395 : 3979625 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_301 3988056 : 3996165 6 Mycobacterium_phage(25.0%) NA NA
DBSCAN-SWA_302 4000427 : 4008478 7 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_303 4011527 : 4016003 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_304 4028588 : 4094310 5 Paenibacillus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP028216
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 28919 30 Enterococcus_phage(30.43%) tail,terminase,head,portal,capsid,protease,integrase attL 2407:2422|attR 33848:33863
DBSCAN-SWA_2 32815 : 40267 6 Lactococcus_phage(40.0%) NA NA
DBSCAN-SWA_3 43663 : 81305 45 Enterococcus_phage(34.78%) integrase attL 68567:68582|attR 81806:81821
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage