Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047879 Escherichia coli strain LD22-1 plasmid pLD22-1-6kb, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP047877 Escherichia coli strain LD22-1 plasmid pLD22-1-MCR1, complete sequence 0 crisprs csa3 0 0 2 0
NZ_CP047876 Escherichia coli strain LD22-1 chromosome, complete genome 6 crisprs csa3,PD-DExK,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,c2c9_V-U4,DinG 0 18 8 0
NZ_CP047878 Escherichia coli strain LD22-1 plasmid pLD22-1-135kb, complete sequence 0 crisprs DEDDh 0 0 1 0

Results visualization

1. NZ_CP047877
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 57775 : 99927 45 Escherichia_phage(30.77%) integrase,transposase,protease attL 52724:52737|attR 65235:65248
DBSCAN-SWA_2 103265 : 160778 56 Escherichia_phage(33.33%) integrase,transposase attL 103213:103272|attR 156766:157586
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP047876
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047876_1 619456-619573 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047876_2 1052551-1053677 TypeI-E I-E
18 spacers
cas3,cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047876_3 1069194-1069894 TypeI-E I-E
11 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047876_4 2164539-2164662 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047876_5 2202062-2202193 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047876_6 2836983-2837074 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047876_6 6.1|2837009|40|NZ_CP047876|CRISPRCasFinder 2837009-2837048 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP047876_4 4.1|2164582|38|NZ_CP047876|CRISPRCasFinder 2164582-2164619 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP019314 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence 71972-72003 6 0.812
NZ_CP047876_2 2.26|1053007|32|NZ_CP047876|CRISPRCasFinder,CRT 1053007-1053038 32 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 555773-555804 7 0.781
NZ_CP047876_2 2.33|1053434|32|NZ_CP047876|CRISPRCasFinder,CRT 1053434-1053465 32 NZ_CP026333 Pseudomonas sp. XWY-1 plasmid pXWY, complete sequence 141829-141860 7 0.781
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 66681-66712 7 0.781
NZ_CP047876_2 2.11|1053189|33|NZ_CP047876|PILER-CR 1053189-1053221 33 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 152763-152795 8 0.758
NZ_CP047876_2 2.15|1053433|33|NZ_CP047876|PILER-CR 1053433-1053465 33 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 1036449-1036481 8 0.758
NZ_CP047876_2 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT 1053129-1053160 32 NC_010180 Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence 223698-223729 8 0.75
NZ_CP047876_2 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT 1053129-1053160 32 NZ_CP015592 Bacillus cereus strain AR156 plasmid pAR460, complete sequence 221508-221539 8 0.75
NZ_CP047876_2 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT 1053129-1053160 32 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 147474-147505 8 0.75
NZ_CP047876_2 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT 1053129-1053160 32 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 374123-374154 8 0.75
NZ_CP047876_2 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT 1053129-1053160 32 NZ_CP009368 Bacillus cereus strain FM1 plasmid unnamed, complete sequence 74049-74080 8 0.75
NZ_CP047876_2 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT 1053129-1053160 32 NZ_CP009691 Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence 130803-130834 8 0.75
NZ_CP047876_2 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT 1053129-1053160 32 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 195225-195256 8 0.75
NZ_CP047876_2 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT 1053129-1053160 32 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 471476-471507 8 0.75
NZ_CP047876_2 2.29|1053190|32|NZ_CP047876|CRISPRCasFinder,CRT 1053190-1053221 32 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 152763-152794 8 0.75
NZ_CP047876_2 2.12|1053250|33|NZ_CP047876|PILER-CR 1053250-1053282 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5210758-5210790 9 0.727
NZ_CP047876_2 2.29|1053190|32|NZ_CP047876|CRISPRCasFinder,CRT 1053190-1053221 32 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 161129-161160 9 0.719
NZ_CP047876_2 2.30|1053251|32|NZ_CP047876|CRISPRCasFinder,CRT 1053251-1053282 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5210759-5210790 9 0.719
NZ_CP047876_2 2.30|1053251|32|NZ_CP047876|CRISPRCasFinder,CRT 1053251-1053282 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 191956-191987 9 0.719
NZ_CP047876_2 2.30|1053251|32|NZ_CP047876|CRISPRCasFinder,CRT 1053251-1053282 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1498191-1498222 9 0.719
NZ_CP047876_2 2.33|1053434|32|NZ_CP047876|CRISPRCasFinder,CRT 1053434-1053465 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 1036450-1036481 9 0.719
NZ_CP047876_2 2.33|1053434|32|NZ_CP047876|CRISPRCasFinder,CRT 1053434-1053465 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 823434-823465 9 0.719
NZ_CP047876_2 2.33|1053434|32|NZ_CP047876|CRISPRCasFinder,CRT 1053434-1053465 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 682589-682620 9 0.719
NZ_CP047876_2 2.34|1053495|32|NZ_CP047876|CRISPRCasFinder,CRT 1053495-1053526 32 NC_017140 Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence 5097-5128 9 0.719
NZ_CP047876_2 2.36|1053617|32|NZ_CP047876|CRISPRCasFinder,CRT 1053617-1053648 32 MK249151 Blackfly microvirus SF02 isolate 049, complete genome 1908-1939 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 46007-46038 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 125777-125808 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 134655-134686 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 68724-68755 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 166140-166171 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP013598 Rhizobium sp. N741 plasmid pRspN741c, complete sequence 103164-103195 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP013544 Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence 36015-36046 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 125777-125808 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP013502 Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence 103085-103116 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP013508 Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence 103164-103195 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP013519 Rhizobium sp. N113 plasmid pRspN113b, complete sequence 103163-103194 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP013492 Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence 103161-103192 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP013497 Rhizobium sp. N621 plasmid pRspN621b, complete sequence 103161-103192 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP013592 Rhizobium sp. N871 plasmid pRspN871b, complete sequence 103085-103116 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 CP007643 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence 92301-92332 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 100863-100894 9 0.719
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 97248-97279 9 0.719
NZ_CP047876_3 3.3|1069345|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069345-1069376 32 NZ_CP033139 Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence 115828-115859 9 0.719
NZ_CP047876_3 3.3|1069345|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069345-1069376 32 KY579375 Sulfolobus spindle-shaped virus 3 strain REY 15/4, complete genome 4523-4554 9 0.719
NZ_CP047876_3 3.3|1069345|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069345-1069376 32 EU030939 Sulfolobus spindle-shaped virus 5, complete genome 8793-8824 9 0.719
NZ_CP047876_3 3.3|1069345|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069345-1069376 32 JF412294 EBPR podovirus 1, partial sequence 3991-4022 9 0.719
NZ_CP047876_3 3.5|1069467|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069467-1069498 32 AP014927 Ralstonia phage RSF1 DNA, complete genome 171005-171036 9 0.719
NZ_CP047876_2 2.10|1053128|33|NZ_CP047876|PILER-CR 1053128-1053160 33 NC_010180 Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence 223697-223729 10 0.697
NZ_CP047876_2 2.10|1053128|33|NZ_CP047876|PILER-CR 1053128-1053160 33 NZ_CP015592 Bacillus cereus strain AR156 plasmid pAR460, complete sequence 221507-221539 10 0.697
NZ_CP047876_2 2.10|1053128|33|NZ_CP047876|PILER-CR 1053128-1053160 33 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 374122-374154 10 0.697
NZ_CP047876_2 2.10|1053128|33|NZ_CP047876|PILER-CR 1053128-1053160 33 NZ_CP009691 Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence 130802-130834 10 0.697
NZ_CP047876_2 2.10|1053128|33|NZ_CP047876|PILER-CR 1053128-1053160 33 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 195224-195256 10 0.697
NZ_CP047876_2 2.10|1053128|33|NZ_CP047876|PILER-CR 1053128-1053160 33 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 147474-147506 10 0.697
NZ_CP047876_2 2.10|1053128|33|NZ_CP047876|PILER-CR 1053128-1053160 33 NZ_CP009368 Bacillus cereus strain FM1 plasmid unnamed, complete sequence 74049-74081 10 0.697
NZ_CP047876_2 2.10|1053128|33|NZ_CP047876|PILER-CR 1053128-1053160 33 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 471476-471508 10 0.697
NZ_CP047876_2 2.35|1053556|32|NZ_CP047876|CRISPRCasFinder,CRT 1053556-1053587 32 NZ_CP039902 Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence 33041-33072 10 0.688
NZ_CP047876_2 2.35|1053556|32|NZ_CP047876|CRISPRCasFinder,CRT 1053556-1053587 32 NZ_CP039893 Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence 217865-217896 10 0.688
NZ_CP047876_2 2.35|1053556|32|NZ_CP047876|CRISPRCasFinder,CRT 1053556-1053587 32 NZ_KY000025 Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence 208000-208031 10 0.688
NZ_CP047876_2 2.35|1053556|32|NZ_CP047876|CRISPRCasFinder,CRT 1053556-1053587 32 NZ_KY000029 Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence 208000-208031 10 0.688
NZ_CP047876_2 2.36|1053617|32|NZ_CP047876|CRISPRCasFinder,CRT 1053617-1053648 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 450688-450719 10 0.688
NZ_CP047876_3 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT 1069284-1069315 32 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1679246-1679277 10 0.688
NZ_CP047876_2 2.23|1052824|32|NZ_CP047876|CRISPRCasFinder,CRT 1052824-1052855 32 NZ_AP018282 Chondrocystis sp. NIES-4102 plasmid plasmid1 DNA, complete genome 109485-109516 11 0.656

1. spacer 6.1|2837009|40|NZ_CP047876|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 4.1|2164582|38|NZ_CP047876|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019314 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence) position: , mismatch: 6, identity: 0.812

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
gcaccgttctcgcccaacagggcg-acaatctc	Protospacer
 *******.******* ******* ****.*. 

4. spacer 2.26|1053007|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

-gtctgtgatggcctgctcgtgagtccgcggcg	CRISPR spacer
cgcgtg-gatggcctgctcgtcagttcgcgcct	Protospacer
 *. ** ************** ***.**** * 

5. spacer 2.33|1053434|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_CP026333 (Pseudomonas sp. XWY-1 plasmid pXWY, complete sequence) position: , mismatch: 7, identity: 0.781

cctagcccgattatcggcatgagcgatgcgga	CRISPR spacer
ccgcgcccgatcatcgccatgagcgatatggg	Protospacer
**  *******.**** **********..**.

6. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
ccaccgtcttcgccgaccagggca-acgtcctc	Protospacer
*******.****** ********. **. **. 

7. spacer 2.11|1053189|33|NZ_CP047876|PILER-CR matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 8, identity: 0.758

gagcgtcaatcagcgcgtctatcgcgtcacttt	CRISPR spacer
gggcgtcaatgagcgcgtcgatcgcggcgggat	Protospacer
*.******** ******** ****** *.   *

8. spacer 2.15|1053433|33|NZ_CP047876|PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 8, identity: 0.758

---gcctagcccgattatcggcatgagcgatgcgga	CRISPR spacer
ttgaattag---gattatcgacatgagcgatacgga	Protospacer
   . .***   ********.**********.****

9. spacer 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NC_010180 (Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

10. spacer 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

11. spacer 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

12. spacer 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

13. spacer 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

14. spacer 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_CP009691 (Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

15. spacer 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

16. spacer 2.28|1053129|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

17. spacer 2.29|1053190|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 8, identity: 0.75

agcgtcaatcagcgcgtctatcgcgtcacttt	CRISPR spacer
ggcgtcaatgagcgcgtcgatcgcggcgggat	Protospacer
.******** ******** ****** *.   *

18. spacer 2.12|1053250|33|NZ_CP047876|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.727

gatttgggggtatgagagcgccgagccgttcgg	CRISPR spacer
ggtcgaacggtatgcgggcgccgagccgttcga	Protospacer
*.*. .. ****** *.***************.

19. spacer 2.29|1053190|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

agcgtcaatcagcgcgtctatcgcgtcacttt	CRISPR spacer
gaactcaatcagcgcgttcatcgcgtcgcgat	Protospacer
..  *************..********.*  *

20. spacer 2.30|1053251|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

atttgggggtatgagagcgccgagccgttcgg	CRISPR spacer
gtcgaacggtatgcgggcgccgagccgttcga	Protospacer
.*. .. ****** *.***************.

21. spacer 2.30|1053251|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

atttgggggtatgagagcgccgagccgttcgg	CRISPR spacer
aaacgttcgtatgagcgcgccgagtcgttcgt	Protospacer
*  .*   ******* ********.****** 

22. spacer 2.30|1053251|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719

atttgggggtatgagagcgccgagccgttcgg	CRISPR spacer
aaacgttcgtatgagcgcgccgagtcgttcgt	Protospacer
*  .*   ******* ********.****** 

23. spacer 2.33|1053434|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.719

cctagcccgattatcggcatgagcgatgcgga	CRISPR spacer
tgaattaggattatcgacatgagcgatacgga	Protospacer
.  * .  ********.**********.****

24. spacer 2.33|1053434|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

cctagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gttgcggcgatcatcggcatgggcgatgcgta	Protospacer
 .*.   ****.*********.******** *

25. spacer 2.33|1053434|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719

cctagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gttgcggcgatcatcggcatgggcgatgcgta	Protospacer
 .*.   ****.*********.******** *

26. spacer 2.34|1053495|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NC_017140 (Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence) position: , mismatch: 9, identity: 0.719

tcgaagaagaaagggaaataatgcgaggaacg	CRISPR spacer
atggagaagaaagggaaacaaagcgagcgcgg	Protospacer
 .*.**************.** ***** .  *

27. spacer 2.36|1053617|32|NZ_CP047876|CRISPRCasFinder,CRT matches to MK249151 (Blackfly microvirus SF02 isolate 049, complete genome) position: , mismatch: 9, identity: 0.719

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
gccatgtcccaacaaaacgccagggaacaaat	Protospacer
  *. *  ***.************* ***** 

28. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

29. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

30. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

31. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

32. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gcaccgttttcgccgatcagggcggtgacctt	Protospacer
 ************* *.*******   * *..

33. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

34. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

35. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

36. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

37. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

38. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

39. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

40. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

41. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

42. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

43. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

44. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

45. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

46. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

47. spacer 3.3|1069345|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033139 (Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence) position: , mismatch: 9, identity: 0.719

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gaaaaagagaatgtagaggaagcgtttttctt	Protospacer
*********** ******.*****   *..  

48. spacer 3.3|1069345|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to KY579375 (Sulfolobus spindle-shaped virus 3 strain REY 15/4, complete genome) position: , mismatch: 9, identity: 0.719

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gacaaagagaaagtagagaaagcgattttctt	Protospacer
** ********.************.  *..  

49. spacer 3.3|1069345|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to EU030939 (Sulfolobus spindle-shaped virus 5, complete genome) position: , mismatch: 9, identity: 0.719

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gacaaagagaaagtagagaaagcgattttctt	Protospacer
** ********.************.  *..  

50. spacer 3.3|1069345|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to JF412294 (EBPR podovirus 1, partial sequence) position: , mismatch: 9, identity: 0.719

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gaaaaagagaaggccgagaaagcagcgaaggc	Protospacer
*************. ********.* .   * 

51. spacer 3.5|1069467|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to AP014927 (Ralstonia phage RSF1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

gcgcaccgttgcgtcgaaaaggcgctggagat	CRISPR spacer
cagacccgtttcgtcgaacaggcgctggcgtg	Protospacer
  *  ***** ******* ********* *  

52. spacer 2.10|1053128|33|NZ_CP047876|PILER-CR matches to NC_010180 (Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence) position: , mismatch: 10, identity: 0.697

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  ******* 

53. spacer 2.10|1053128|33|NZ_CP047876|PILER-CR matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 10, identity: 0.697

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  ******* 

54. spacer 2.10|1053128|33|NZ_CP047876|PILER-CR matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  ******* 

55. spacer 2.10|1053128|33|NZ_CP047876|PILER-CR matches to NZ_CP009691 (Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence) position: , mismatch: 10, identity: 0.697

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  ******* 

56. spacer 2.10|1053128|33|NZ_CP047876|PILER-CR matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.697

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  ******* 

57. spacer 2.10|1053128|33|NZ_CP047876|PILER-CR matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 10, identity: 0.697

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  ******* 

58. spacer 2.10|1053128|33|NZ_CP047876|PILER-CR matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  ******* 

59. spacer 2.10|1053128|33|NZ_CP047876|PILER-CR matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 10, identity: 0.697

gcgttctgaatccgatattcttcagcaccttca	CRISPR spacer
gtccaaacaatccgatattcttcctcaccttct	Protospacer
*. .    ***************  ******* 

60. spacer 2.35|1053556|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_CP039902 (Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

61. spacer 2.35|1053556|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_CP039893 (Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

62. spacer 2.35|1053556|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_KY000025 (Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

63. spacer 2.35|1053556|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_KY000029 (Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

64. spacer 2.36|1053617|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
ggaaggagcctgcaaagcgccagggcaccggt	Protospacer
 * ..***** *****.*********** .. 

65. spacer 3.2|1069284|32|NZ_CP047876|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
ccaccgtattcgccaaccagggcggcagggaa	Protospacer
******* ****** *********   ..   

66. spacer 2.23|1052824|32|NZ_CP047876|CRISPRCasFinder,CRT matches to NZ_AP018282 (Chondrocystis sp. NIES-4102 plasmid plasmid1 DNA, complete genome) position: , mismatch: 11, identity: 0.656

acggcgtggattgagggacgggtatttggtcc	CRISPR spacer
gcggagtggattgaggtacgggtaaagaagga	Protospacer
.*** *********** *******   ..   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1086250 : 1093390 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_2 1686056 : 1695498 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_3 1787092 : 1794630 7 Enterobacteria_phage(28.57%) NA NA
DBSCAN-SWA_4 2408548 : 2528790 112 Escherichia_phage(42.59%) lysis,terminase,tail,transposase,tRNA,integrase attL 2434984:2435000|attR 2527923:2527939
DBSCAN-SWA_5 2963822 : 3051618 92 Salmonella_phage(59.65%) lysis,terminase,capsid,tail,portal,tRNA,protease,plate,integrase,head attL 2999675:2999689|attR 3053331:3053345
DBSCAN-SWA_6 3082624 : 3180466 115 Enterobacteria_phage(44.0%) lysis,capsid,terminase,tail,portal,transposase,protease,integrase,head attL 3108903:3108938|attR 3181900:3181935
DBSCAN-SWA_7 3641022 : 3729138 94 Shigella_phage(50.0%) lysis,capsid,terminase,tail,portal,transposase,protease,holin,plate,integrase,head attL 3667879:3667895|attR 3726584:3726600
DBSCAN-SWA_8 3759971 : 3822162 51 Enterobacteria_phage(12.5%) protease,transposase,tRNA,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP047878
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1262 : 74598 55 Enterobacteria_phage(23.53%) transposase,bacteriocin,protease,integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage