Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047846 Staphylococcus aureus strain UP_591 plasmid unnamed, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP047845 Staphylococcus aureus strain UP_591 chromosome, complete genome 4 crisprs csa3,cas3,DinG,DEDDh,WYL 2 0 216 1

Results visualization

1. NZ_CP047845
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047845_1 1388257-1388395 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047845_2 1426818-1426910 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047845_3 1579220-1579313 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047845_4 2683458-2683541 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP047845_4 4.1|2683483|34|NZ_CP047845|CRISPRCasFinder 2683483-2683516 34 NZ_CP047845.1 943113-943146 0 1.0
NZ_CP047845_1 1.1|1388308|37|NZ_CP047845|CRISPRCasFinder 1388308-1388344 37 NZ_CP047845.1 1388219-1388255 2 0.946

1. spacer 4.1|2683483|34|NZ_CP047845|CRISPRCasFinder matches to position: 943113-943146, mismatch: 0, identity: 1.0

ttgttggggcccacaccccaacttgcacattatc	CRISPR spacer
ttgttggggcccacaccccaacttgcacattatc	Protospacer
**********************************

2. spacer 1.1|1388308|37|NZ_CP047845|CRISPRCasFinder matches to position: 1388219-1388255, mismatch: 2, identity: 0.946

agctcacaaaacccttgatatcattggtttcccatga	CRISPR spacer
agctcacaaaacccttgatatcactggtttctcatga	Protospacer
***********************.*******.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 24289 28 Staphylococcus_phage(100.0%) holin,terminase,capsid,protease,head,tail,portal NA
DBSCAN-SWA_2 30223 : 32670 3 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_3 37917 : 38319 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_4 42515 : 44545 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_5 48575 : 50859 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_6 54546 : 61313 5 Gordonia_phage(33.33%) NA NA
DBSCAN-SWA_7 68371 : 73399 5 Catovirus(33.33%) NA NA
DBSCAN-SWA_8 76851 : 77265 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_9 82178 : 82808 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_10 98296 : 100033 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_11 116439 : 117168 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_12 128163 : 128508 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_13 138141 : 138882 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_14 146610 : 150874 5 Staphylococcus_phage(80.0%) NA NA
DBSCAN-SWA_15 154126 : 155256 1 Paenibacillus_phage(100.0%) transposase NA
DBSCAN-SWA_16 158771 : 198218 42 Staphylococcus_phage(91.18%) protease,tRNA,transposase NA
DBSCAN-SWA_17 205216 : 206485 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_18 217601 : 222929 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_19 231669 : 233376 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_20 239981 : 242612 2 Cronobacter_phage(50.0%) tRNA,protease NA
DBSCAN-SWA_21 246380 : 250515 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_22 268346 : 271544 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_23 276477 : 278235 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_24 283119 : 291283 5 Feldmannia_irregularis_virus(25.0%) NA NA
DBSCAN-SWA_25 295198 : 306351 12 Brevibacillus_phage(20.0%) tRNA,protease NA
DBSCAN-SWA_26 315919 : 318550 1 Catovirus(100.0%) tRNA NA
DBSCAN-SWA_27 328484 : 364092 31 uncultured_Mediterranean_phage(18.75%) tRNA NA
DBSCAN-SWA_28 370769 : 373157 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_29 380425 : 386589 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_30 390023 : 393131 2 Micromonas_pusilla_virus(50.0%) NA NA
DBSCAN-SWA_31 399600 : 400548 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_32 403602 : 417330 13 Klosneuvirus(25.0%) tRNA NA
DBSCAN-SWA_33 423503 : 424127 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_34 429671 : 432483 2 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_35 439982 : 446552 6 Indivirus(66.67%) NA NA
DBSCAN-SWA_36 453379 : 454786 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_37 459431 : 460916 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_38 466581 : 481007 14 Bacillus_phage(28.57%) NA NA
DBSCAN-SWA_39 490433 : 495923 7 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_40 499585 : 500161 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_41 503547 : 511054 5 unidentified_phage(25.0%) tRNA NA
DBSCAN-SWA_42 514745 : 515372 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_43 524696 : 525575 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_44 563959 : 573348 13 Staphylococcus_phage(60.0%) NA NA
DBSCAN-SWA_45 576756 : 578768 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_46 586436 : 587228 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_47 590761 : 596372 8 Lactobacillus_phage(33.33%) protease,lysis NA
DBSCAN-SWA_48 604214 : 605816 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_49 610241 : 617835 8 Indivirus(25.0%) NA NA
DBSCAN-SWA_50 625329 : 627684 3 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_51 632003 : 633266 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_52 642924 : 647318 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_53 652941 : 654588 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_54 658257 : 659379 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_55 663528 : 669183 7 Phage_Wrath(25.0%) NA NA
DBSCAN-SWA_56 679319 : 683595 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_57 689374 : 703883 24 Staphylococcus_phage(57.14%) terminase,head,integrase,portal attL 685555:685572|attR 710044:710061
DBSCAN-SWA_58 708500 : 708977 1 Fowlpox_virus(100.0%) NA NA
DBSCAN-SWA_59 714920 : 721402 4 Acanthocystis_turfacea_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_60 730816 : 731860 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_61 736060 : 741604 4 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_62 746742 : 758557 9 Klosneuvirus(33.33%) tRNA NA
DBSCAN-SWA_63 762830 : 763601 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_64 768374 : 782047 11 Erwinia_phage(16.67%) protease,tRNA NA
DBSCAN-SWA_65 795429 : 797486 3 Acanthamoeba_polyphaga_mimivirus(33.33%) NA NA
DBSCAN-SWA_66 807856 : 809851 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_67 812998 : 813934 1 Prochlorococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_68 818937 : 821194 3 Methanothermobacter_phage(50.0%) NA NA
DBSCAN-SWA_69 824560 : 825172 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_70 829139 : 833750 4 Halovirus(33.33%) NA NA
DBSCAN-SWA_71 837683 : 840437 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_72 860008 : 860197 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_73 869081 : 871051 3 Staphylococcus_virus(50.0%) NA NA
DBSCAN-SWA_74 884597 : 889155 3 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_75 894236 : 895295 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_76 907239 : 910136 5 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_77 921654 : 923502 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_78 931636 : 935277 4 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_79 939943 : 940495 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_80 946612 : 950991 5 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_81 954107 : 968868 14 Prochlorococcus_phage(22.22%) NA NA
DBSCAN-SWA_82 979244 : 983009 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_83 986661 : 987663 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_84 995968 : 999494 6 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_85 1009634 : 1014845 3 Pithovirus(33.33%) protease NA
DBSCAN-SWA_86 1033774 : 1035583 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_87 1041397 : 1043367 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_88 1047018 : 1049032 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_89 1056964 : 1061591 2 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_90 1066882 : 1070536 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_91 1081291 : 1088339 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_92 1098273 : 1101901 3 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_93 1105945 : 1108614 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_94 1121822 : 1125345 3 environmental_halophage(50.0%) NA NA
DBSCAN-SWA_95 1128829 : 1129855 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_96 1132924 : 1138101 8 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_97 1141504 : 1142748 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_98 1154477 : 1178796 37 Staphylococcus_phage(84.85%) integrase,transposase attL 1153396:1153411|attR 1181912:1181927
DBSCAN-SWA_99 1182684 : 1184661 2 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_100 1191784 : 1205849 13 uncultured_Caudovirales_phage(16.67%) tRNA NA
DBSCAN-SWA_101 1209614 : 1214338 4 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_102 1229320 : 1232704 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_103 1237853 : 1239881 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_104 1245555 : 1247076 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_105 1254276 : 1254924 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_106 1260833 : 1261229 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_107 1271662 : 1279415 9 Catovirus(25.0%) NA NA
DBSCAN-SWA_108 1287219 : 1288830 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_109 1296768 : 1300605 4 Geobacillus_virus(50.0%) NA NA
DBSCAN-SWA_110 1310216 : 1313037 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_111 1319309 : 1326668 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_112 1330264 : 1331173 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_113 1346999 : 1347968 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_114 1358174 : 1359737 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_115 1373108 : 1375065 3 Orpheovirus(50.0%) NA NA
DBSCAN-SWA_116 1378577 : 1379432 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_117 1384988 : 1389823 4 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_118 1392864 : 1394531 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_119 1418229 : 1421397 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_120 1433430 : 1434036 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_121 1453013 : 1453823 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_122 1457743 : 1462363 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_123 1476112 : 1476748 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_124 1484628 : 1485510 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_125 1498316 : 1499216 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_126 1511312 : 1512521 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_127 1516259 : 1522820 8 Planktothrix_phage(25.0%) NA NA
DBSCAN-SWA_128 1533238 : 1534273 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_129 1555599 : 1557159 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_130 1573000 : 1573732 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_131 1581555 : 1587334 6 Staphylococcus_phage(75.0%) NA NA
DBSCAN-SWA_132 1590795 : 1596926 6 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_133 1615298 : 1616525 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_134 1620218 : 1624645 4 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_135 1630877 : 1632435 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_136 1640374 : 1641193 1 Acanthamoeba_polyphaga_moumouvirus(100.0%) NA NA
DBSCAN-SWA_137 1645736 : 1646432 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_138 1649984 : 1657171 6 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_139 1676565 : 1677261 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_140 1686675 : 1687668 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_141 1696963 : 1703346 5 Powai_lake_megavirus(33.33%) NA NA
DBSCAN-SWA_142 1709771 : 1712764 2 Streptococcus_phage(50.0%) protease NA
DBSCAN-SWA_143 1722006 : 1726197 3 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_144 1733502 : 1738383 4 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_145 1766555 : 1776667 9 Klosneuvirus(50.0%) holin NA
DBSCAN-SWA_146 1781543 : 1783927 2 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_147 1788965 : 1789463 1 Canarypox_virus(100.0%) NA NA
DBSCAN-SWA_148 1792898 : 1793654 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_149 1820570 : 1822430 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_150 1852052 : 1852745 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_151 1865141 : 1866155 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_152 1885273 : 1886032 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_153 1889345 : 1892474 5 Lactococcus_phage(33.33%) NA NA
DBSCAN-SWA_154 1902562 : 1911601 5 Bacillus_virus(50.0%) tRNA NA
DBSCAN-SWA_155 1918287 : 1928283 7 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_156 1931848 : 1933726 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_157 1939348 : 1940479 3 Paenibacillus_phage(66.67%) transposase NA
DBSCAN-SWA_158 1984169 : 1988379 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_159 1996645 : 1997848 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_160 2001700 : 2002681 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_161 2007629 : 2008229 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_162 2025870 : 2032435 6 Catovirus(50.0%) NA NA
DBSCAN-SWA_163 2039453 : 2041938 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_164 2045278 : 2048278 4 Indivirus(50.0%) NA NA
DBSCAN-SWA_165 2053126 : 2060302 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_166 2065160 : 2066345 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_167 2082939 : 2084532 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_168 2093083 : 2095145 2 Pontimonas_phage(50.0%) NA NA
DBSCAN-SWA_169 2105548 : 2110907 3 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_170 2122054 : 2123560 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_171 2136081 : 2137611 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_172 2144827 : 2145871 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_173 2155198 : 2159738 3 Catovirus(50.0%) NA NA
DBSCAN-SWA_174 2163495 : 2164932 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_175 2173458 : 2175120 2 Arthrobacter_phage(50.0%) NA NA
DBSCAN-SWA_176 2187081 : 2191521 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_177 2208755 : 2209433 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_178 2227673 : 2230408 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_179 2250186 : 2251029 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_180 2260949 : 2269383 10 Staphylococcus_phage(60.0%) NA NA
DBSCAN-SWA_181 2275866 : 2277390 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_182 2286346 : 2289379 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_183 2295359 : 2297093 2 Staphylococcus_phage(50.0%) transposase NA
DBSCAN-SWA_184 2309662 : 2312471 2 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_185 2335344 : 2341570 5 Lactococcus_phage(33.33%) NA NA
DBSCAN-SWA_186 2358220 : 2359918 1 Streptococcus_virus(100.0%) NA NA
DBSCAN-SWA_187 2368754 : 2369372 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_188 2373278 : 2376376 2 Streptococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_189 2382259 : 2384724 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_190 2393980 : 2404253 10 Klosneuvirus(16.67%) tRNA,protease NA
DBSCAN-SWA_191 2423168 : 2425625 1 Escherichia_phage(100.0%) protease NA
DBSCAN-SWA_192 2431635 : 2436418 8 Catovirus(50.0%) tRNA NA
DBSCAN-SWA_193 2440101 : 2451055 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_194 2454085 : 2455273 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_195 2461819 : 2462482 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_196 2485981 : 2489302 2 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_197 2492969 : 2493626 1 Elephant_endotheliotropic_herpesvirus(100.0%) NA NA
DBSCAN-SWA_198 2504929 : 2506252 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_199 2514440 : 2517794 3 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_200 2531165 : 2531726 1 Streptococcus_phage(100.0%) integrase attL 2523761:2523775|attR 2536407:2536421
DBSCAN-SWA_201 2542810 : 2543554 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_202 2550489 : 2554448 3 Streptomyces_phage(33.33%) NA NA
DBSCAN-SWA_203 2557677 : 2558475 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_204 2564998 : 2566042 1 Acanthamoeba_polyphaga_moumouvirus(100.0%) NA NA
DBSCAN-SWA_205 2570421 : 2571183 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_206 2575903 : 2576701 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_207 2581962 : 2582436 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_208 2589450 : 2595730 6 Enterococcus_phage(33.33%) NA NA
DBSCAN-SWA_209 2600706 : 2602080 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_210 2613701 : 2623546 12 Staphylococcus_phage(12.5%) NA NA
DBSCAN-SWA_211 2626690 : 2649798 18 uncultured_Caudovirales_phage(35.71%) NA NA
DBSCAN-SWA_212 2659082 : 2664796 5 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_213 2670877 : 2671717 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_214 2675035 : 2677864 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_215 2682026 : 2687898 5 Streptococcus_phage(40.0%) NA NA
DBSCAN-SWA_216 2698885 : 2720054 30 Staphylococcus_phage(79.17%) coat,integrase,transposase attL 2690607:2690622|attR 2711304:2711319
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP047845.1|WP_001622005.1|1386941_1387142_+|hypothetical-protein 1386941_1387142_+ 66 aa aa NA NA NA 1384988-1389823 yes