Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047831 Staphylococcus aureus strain UP_996 plasmid unnamed1, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP047830 Staphylococcus aureus strain UP_996 chromosome, complete genome 8 crisprs cas3,DEDDh,DinG,csa3,WYL 6 1 6 0
NZ_CP047832 Staphylococcus aureus strain UP_996 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP047830
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047830_1 389794-389894 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047830_2 634065-634157 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047830_3 839867-839948 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047830_4 1036349-1036436 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047830_5 1775703-1775913 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047830_6 1932361-1932439 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047830_7 2124186-2124336 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047830_8 2248101-2248181 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP047830_3 3.1|839891|34|NZ_CP047830|CRISPRCasFinder 839891-839924 34 NZ_CP047830.1 1328844-1328877 0 1.0
NZ_CP047830_3 3.1|839891|34|NZ_CP047830|CRISPRCasFinder 839891-839924 34 NZ_CP047830.1 1418016-1418049 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 791179-791198 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 791234-791253 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 796727-796746 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 796785-796804 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 839945-839964 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 922358-922377 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 1046332-1046351 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 1418129-1418148 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 1597139-1597158 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 1933791-1933810 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 2687767-2687786 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 115463-115482 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 272009-272028 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 351257-351276 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 351312-351331 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 1328745-1328764 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 1775627-1775646 0 1.0
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 2439516-2439535 0 1.0
NZ_CP047830_5 5.1|1775741|21|NZ_CP047830|CRT 1775741-1775761 21 NZ_CP047830.1 1775682-1775702 1 0.952
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 803993-804012 1 0.95
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 1378057-1378076 1 0.95
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 1631105-1631124 1 0.95
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 1943199-1943218 1 0.95
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 272064-272083 1 0.95
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 1120628-1120647 1 0.95
NZ_CP047830_5 5.3|1775858|18|NZ_CP047830|CRT 1775858-1775875 18 NZ_CP047830.1 1775685-1775702 1 0.944
NZ_CP047830_6 6.1|1932384|33|NZ_CP047830|CRISPRCasFinder 1932384-1932416 33 NZ_CP047830.1 1597188-1597220 1 0.97
NZ_CP047830_6 6.1|1932384|33|NZ_CP047830|CRISPRCasFinder 1932384-1932416 33 NZ_CP047830.1 2522174-2522206 1 0.97
NZ_CP047830_6 6.1|1932384|33|NZ_CP047830|CRISPRCasFinder 1932384-1932416 33 NZ_CP047830.1 1120680-1120712 1 0.97
NZ_CP047830_6 6.1|1932384|33|NZ_CP047830|CRISPRCasFinder 1932384-1932416 33 NZ_CP047830.1 1328799-1328831 1 0.97
NZ_CP047830_5 5.2|1775800|20|NZ_CP047830|CRT 1775800-1775819 20 NZ_CP047830.1 764161-764180 2 0.9
NZ_CP047830_6 6.1|1932384|33|NZ_CP047830|CRISPRCasFinder 1932384-1932416 33 NZ_CP047830.1 1418062-1418094 2 0.939
NZ_CP047830_8 8.1|2248126|31|NZ_CP047830|CRISPRCasFinder 2248126-2248156 31 NZ_CP047830.1 796602-796632 2 0.935
NZ_CP047830_8 8.1|2248126|31|NZ_CP047830|CRISPRCasFinder 2248126-2248156 31 NZ_CP047830.1 1020067-1020097 2 0.935
NZ_CP047830_8 8.1|2248126|31|NZ_CP047830|CRISPRCasFinder 2248126-2248156 31 NZ_CP047830.1 2522172-2522202 2 0.935
NZ_CP047830_8 8.1|2248126|31|NZ_CP047830|CRISPRCasFinder 2248126-2248156 31 NZ_CP047830.1 2687701-2687731 2 0.935
NZ_CP047830_8 8.1|2248126|31|NZ_CP047830|CRISPRCasFinder 2248126-2248156 31 NZ_CP047830.1 351143-351173 2 0.935
NZ_CP047830_8 8.1|2248126|31|NZ_CP047830|CRISPRCasFinder 2248126-2248156 31 NZ_CP047830.1 1120684-1120714 2 0.935
NZ_CP047830_8 8.1|2248126|31|NZ_CP047830|CRISPRCasFinder 2248126-2248156 31 NZ_CP047830.1 1328803-1328833 2 0.935

1. spacer 3.1|839891|34|NZ_CP047830|CRISPRCasFinder matches to position: 1328844-1328877, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

2. spacer 3.1|839891|34|NZ_CP047830|CRISPRCasFinder matches to position: 1418016-1418049, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

3. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 791179-791198, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

4. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 791234-791253, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

5. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 796727-796746, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

6. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 796785-796804, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

7. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 839945-839964, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

8. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 922358-922377, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

9. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 1046332-1046351, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

10. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 1418129-1418148, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

11. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 1597139-1597158, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

12. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 1933791-1933810, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

13. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 2687767-2687786, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

14. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 115463-115482, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

15. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 272009-272028, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

16. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 351257-351276, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

17. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 351312-351331, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

18. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 1328745-1328764, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

19. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 1775627-1775646, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

20. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 2439516-2439535, mismatch: 0, identity: 1.0

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaagaaattct	Protospacer
********************

21. spacer 5.1|1775741|21|NZ_CP047830|CRT matches to position: 1775682-1775702, mismatch: 1, identity: 0.952

agctggccaatagtcagcttt	CRISPR spacer
agctggccaatagttagcttt	Protospacer
**************.******

22. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 803993-804012, mismatch: 1, identity: 0.95

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaatgaaattct	Protospacer
*********** ********

23. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 1378057-1378076, mismatch: 1, identity: 0.95

gaatttcgaaaagaaattct	CRISPR spacer
gattttcgaaaagaaattct	Protospacer
** *****************

24. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 1631105-1631124, mismatch: 1, identity: 0.95

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgtaaagaaattct	Protospacer
******** ***********

25. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 1943199-1943218, mismatch: 1, identity: 0.95

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcgaaaggaaattct	Protospacer
***********.********

26. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 272064-272083, mismatch: 1, identity: 0.95

gaatttcgaaaagaaattct	CRISPR spacer
gaaattcgaaaagaaattct	Protospacer
*** ****************

27. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 1120628-1120647, mismatch: 1, identity: 0.95

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcaaaaagaaattct	Protospacer
*******.************

28. spacer 5.3|1775858|18|NZ_CP047830|CRT matches to position: 1775685-1775702, mismatch: 1, identity: 0.944

tggccaatagtcagcttt	CRISPR spacer
tggccaatagttagcttt	Protospacer
***********.******

29. spacer 6.1|1932384|33|NZ_CP047830|CRISPRCasFinder matches to position: 1597188-1597220, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattatagtaagctgacttttcgtcagcttctg	Protospacer
****** **************************

30. spacer 6.1|1932384|33|NZ_CP047830|CRISPRCasFinder matches to position: 2522174-2522206, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

31. spacer 6.1|1932384|33|NZ_CP047830|CRISPRCasFinder matches to position: 1120680-1120712, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

32. spacer 6.1|1932384|33|NZ_CP047830|CRISPRCasFinder matches to position: 1328799-1328831, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

33. spacer 5.2|1775800|20|NZ_CP047830|CRT matches to position: 764161-764180, mismatch: 2, identity: 0.9

gaatttcgaaaagaaattct	CRISPR spacer
gaatttcaaaaaggaattct	Protospacer
*******.*****.******

34. spacer 6.1|1932384|33|NZ_CP047830|CRISPRCasFinder matches to position: 1418062-1418094, mismatch: 2, identity: 0.939

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
******.******************* ******

35. spacer 8.1|2248126|31|NZ_CP047830|CRISPRCasFinder matches to position: 796602-796632, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

36. spacer 8.1|2248126|31|NZ_CP047830|CRISPRCasFinder matches to position: 1020067-1020097, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

37. spacer 8.1|2248126|31|NZ_CP047830|CRISPRCasFinder matches to position: 2522172-2522202, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

38. spacer 8.1|2248126|31|NZ_CP047830|CRISPRCasFinder matches to position: 2687701-2687731, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

39. spacer 8.1|2248126|31|NZ_CP047830|CRISPRCasFinder matches to position: 351143-351173, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

40. spacer 8.1|2248126|31|NZ_CP047830|CRISPRCasFinder matches to position: 1120684-1120714, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

41. spacer 8.1|2248126|31|NZ_CP047830|CRISPRCasFinder matches to position: 1328803-1328833, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047830_6 6.1|1932384|33|NZ_CP047830|CRISPRCasFinder 1932384-1932416 33 NC_021536 Synechococcus phage S-IOM18 genomic sequence 159745-159777 10 0.697

1. spacer 6.1|1932384|33|NZ_CP047830|CRISPRCasFinder matches to NC_021536 (Synechococcus phage S-IOM18 genomic sequence) position: , mismatch: 10, identity: 0.697

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
ttttatcgtaaggtgagttttcgtcaagcacct	Protospacer
. ********** *** *********. . *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 728252 : 736072 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 748044 : 762775 14 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 841433 : 860714 25 Staphylococcus_phage(63.16%) terminase,integrase,capsid attL 843970:843986|attR 857977:857993
DBSCAN-SWA_4 1021573 : 1030046 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 1568749 : 1577061 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_6 1780800 : 1860150 74 Staphylococcus_phage(96.55%) protease,tRNA,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage