Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047668 Klebsiella aerogenes strain HNHF1 plasmid pHNHF1_NDM-9, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP047669 Klebsiella aerogenes strain HNHF1 chromosome, complete genome 3 crisprs WYL,DinG,cas3,DEDDh,csa3,cas14j 0 2 4 0

Results visualization

1. NZ_CP047668
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 154288 : 206627 56 Salmonella_phage(17.65%) integrase,transposase attL 165779:165794|attR 209355:209370
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP047669
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047669_1 611021-611094 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047669_2 3265301-3265415 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047669_3 4021691-4021772 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047669_1 1.1|611045|26|NZ_CP047669|CRISPRCasFinder 611045-611070 26 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 324018-324043 0 1.0
NZ_CP047669_3 3.1|4021718|28|NZ_CP047669|CRISPRCasFinder 4021718-4021745 28 LR134132 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12 133968-133995 0 1.0
NZ_CP047669_1 1.1|611045|26|NZ_CP047669|CRISPRCasFinder 611045-611070 26 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447528-447553 2 0.923
NZ_CP047669_1 1.1|611045|26|NZ_CP047669|CRISPRCasFinder 611045-611070 26 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 323588-323613 5 0.808
NZ_CP047669_1 1.1|611045|26|NZ_CP047669|CRISPRCasFinder 611045-611070 26 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447689-447714 6 0.769

1. spacer 1.1|611045|26|NZ_CP047669|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 0, identity: 1.0

ggctacccgcggtgccgtttttttgt	CRISPR spacer
ggctacccgcggtgccgtttttttgt	Protospacer
**************************

2. spacer 3.1|4021718|28|NZ_CP047669|CRISPRCasFinder matches to LR134132 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12) position: , mismatch: 0, identity: 1.0

cctacggtctgatagctcgagcaagccc	CRISPR spacer
cctacggtctgatagctcgagcaagccc	Protospacer
****************************

3. spacer 1.1|611045|26|NZ_CP047669|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 2, identity: 0.923

ggctacccgcggtgccgtttttttgt	CRISPR spacer
cgctactcgcggtgccgtttttttgt	Protospacer
 *****.*******************

4. spacer 1.1|611045|26|NZ_CP047669|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.808

ggctacccgcggtgccgtttttttgt	CRISPR spacer
atctacccgcggtgccgttttttgtc	Protospacer
. *********************  .

5. spacer 1.1|611045|26|NZ_CP047669|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 6, identity: 0.769

ggctacccgcggtgccgtttttttgt	CRISPR spacer
cactactcgcggtgccgttttttgtc	Protospacer
 .****.****************  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 65017 : 72640 8 Erwinia_phage(33.33%) NA NA
DBSCAN-SWA_2 2139074 : 2183133 62 Enterobacteria_phage(22.22%) lysis,integrase,terminase,tail attL 2128136:2128160|attR 2183164:2183188
DBSCAN-SWA_3 2368274 : 2377595 10 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_4 4549331 : 4598471 45 Bacillus_phage(28.57%) transposase,integrase attL 4543796:4543811|attR 4583385:4583400
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage