Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031975 Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59a, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031974 Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59b, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031972 Acinetobacter haemolyticus strain AN59 chromosome, complete genome 1 crisprs TnsE_C,csa3,cas3,DEDDh,WYL,PrimPol 0 2 10 0
NZ_CP031973 Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence 0 crisprs WYL,PD-DExK 0 0 1 0

Results visualization

1. NZ_CP031972
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031972_1 2037487-2037694 Orphan I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031972_1 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT 2037515-2037546 32 NC_019526 Enterobacteria phage vB_KleM-RaK2, complete genome 133452-133483 8 0.75
NZ_CP031972_1 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT 2037515-2037546 32 MT708547 Klebsiella phage Muenster, complete genome 256186-256217 8 0.75
NZ_CP031972_1 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT 2037515-2037546 32 AB897757 Klebsiella phage K64-1 DNA, complete genome 133403-133434 8 0.75
NZ_CP031972_1 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT 2037515-2037546 32 NZ_CP023514 Enterococcus sp. FDAARGOS_375 plasmid unnamed1, complete sequence 105874-105905 8 0.75
NZ_CP031972_1 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT 2037515-2037546 32 MN693967 Marine virus AFVG_250M992, complete genome 26160-26191 8 0.75
NZ_CP031972_1 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT 2037515-2037546 32 NZ_CP033935 Chryseobacterium balustinum strain KC_1863 plasmid unnamed, complete sequence 17595-17626 9 0.719
NZ_CP031972_1 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT 2037515-2037546 32 NC_048015 Cyanophage S-TIM4, complete genome 145348-145379 9 0.719
NZ_CP031972_1 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT 2037515-2037546 32 MH512890 Cyanophage S-TIM4 145348-145379 9 0.719
NZ_CP031972_1 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT 2037515-2037546 32 NC_015283 Prochlorococcus phage P-RSM4, complete genome 145281-145312 9 0.719
NZ_CP031972_1 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT 2037635-2037666 32 NZ_CP028268 Pediococcus pentosaceus strain SRCM102739 plasmid unnamed2, complete sequence 16654-16685 9 0.719
NZ_CP031972_1 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT 2037635-2037666 32 NC_021529 Vibrio phage nt-1, complete genome 193447-193478 9 0.719
NZ_CP031972_1 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT 2037635-2037666 32 KX349253 Synechococcus phage S-RIM2 isolate Np_33_0912, complete genome 31363-31394 9 0.719
NZ_CP031972_1 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT 2037635-2037666 32 KX349251 Synechococcus phage S-RIM2 isolate Np_24_1112, complete genome 31366-31397 9 0.719
NZ_CP031972_1 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT 2037635-2037666 32 KX349268 Synechococcus phage S-RIM2 isolate RW_30_0905, complete genome 31369-31400 9 0.719
NZ_CP031972_1 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT 2037635-2037666 32 KX349230 Synechococcus phage S-RIM2 isolate LIS_02_1013, complete genome 31710-31741 9 0.719
NZ_CP031972_1 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT 2037635-2037666 32 MF042360 Pseudomonas phage Phabio, complete genome 227106-227137 9 0.719
NZ_CP031972_1 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT 2037635-2037666 32 MN693397 Marine virus AFVG_25M279, complete genome 27311-27342 10 0.688
NZ_CP031972_1 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT 2037635-2037666 32 MN693087 Marine virus AFVG_25M280, complete genome 25316-25347 10 0.688
NZ_CP031972_1 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT 2037635-2037666 32 MN693388 Marine virus AFVG_25M277, complete genome 3618-3649 10 0.688
NZ_CP031972_1 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT 2037635-2037666 32 MN693389 Marine virus AFVG_25M278, complete genome 1147-1178 10 0.688
NZ_CP031972_1 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT 2037635-2037666 32 MN693389 Marine virus AFVG_25M278, complete genome 31527-31558 10 0.688

1. spacer 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT matches to NC_019526 (Enterobacteria phage vB_KleM-RaK2, complete genome) position: , mismatch: 8, identity: 0.75

caacacatactcatcaagaattacttttaatt	CRISPR spacer
aaaataatacttttcaagaattacttttaaac	Protospacer
 **   *****. ***************** .

2. spacer 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT matches to MT708547 (Klebsiella phage Muenster, complete genome) position: , mismatch: 8, identity: 0.75

caacacatactcatcaagaattacttttaatt	CRISPR spacer
aaaataatacttttcaagaattacttttaaac	Protospacer
 **   *****. ***************** .

3. spacer 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT matches to AB897757 (Klebsiella phage K64-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75

caacacatactcatcaagaattacttttaatt	CRISPR spacer
aaaataatacttttcaagaattacttttaaac	Protospacer
 **   *****. ***************** .

4. spacer 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT matches to NZ_CP023514 (Enterococcus sp. FDAARGOS_375 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

caacacatactcatcaagaattacttttaatt--	CRISPR spacer
ttacacctactcatcaagaatt--tctgaaataa	Protospacer
. **** ***************  *.* ** *  

5. spacer 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT matches to MN693967 (Marine virus AFVG_250M992, complete genome) position: , mismatch: 8, identity: 0.75

caacacatactcatcaagaattacttttaatt-----	CRISPR spacer
caacacatactcatccaggatta-----aatacttgg	Protospacer
*************** **.****     ***      

6. spacer 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT matches to NZ_CP033935 (Chryseobacterium balustinum strain KC_1863 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

caacacatactcatcaagaattacttttaatt	CRISPR spacer
gtggtcatactcatcaagaattttttttgttt	Protospacer
  .  ***************** .****. **

7. spacer 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT matches to NC_048015 (Cyanophage S-TIM4, complete genome) position: , mismatch: 9, identity: 0.719

caacacatactcatcaagaattacttttaatt	CRISPR spacer
gttttcatactcatcatgatttacttttcttt	Protospacer
   . *********** ** ********  **

8. spacer 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT matches to MH512890 (Cyanophage S-TIM4) position: , mismatch: 9, identity: 0.719

caacacatactcatcaagaattacttttaatt	CRISPR spacer
gttttcatactcatcatgatttacttttcttt	Protospacer
   . *********** ** ********  **

9. spacer 1.1|2037515|32|NZ_CP031972|CRISPRCasFinder,CRT matches to NC_015283 (Prochlorococcus phage P-RSM4, complete genome) position: , mismatch: 9, identity: 0.719

caacacatactcatcaagaattacttttaatt	CRISPR spacer
gttttcatactcatcatgatttacttttcttt	Protospacer
   . *********** ** ********  **

10. spacer 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT matches to NZ_CP028268 (Pediococcus pentosaceus strain SRCM102739 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

taactttgtagctgtatctgtagccattgttg	CRISPR spacer
tccaattgtagctgtatcagtagccactgaaa	Protospacer
*    ************* *******.**  .

11. spacer 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT matches to NC_021529 (Vibrio phage nt-1, complete genome) position: , mismatch: 9, identity: 0.719

taactttgtagctgtatctgtagccattgttg	CRISPR spacer
aatctttgtagatgtatttgtagccaaattca	Protospacer
 * ******** *****.********   *..

12. spacer 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT matches to KX349253 (Synechococcus phage S-RIM2 isolate Np_33_0912, complete genome) position: , mismatch: 9, identity: 0.719

taactttgtagctgtatctgtagccattgttg	CRISPR spacer
caagtttgtagatgtatctgtagcgtgaactg	Protospacer
.** ******* ************    ..**

13. spacer 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT matches to KX349251 (Synechococcus phage S-RIM2 isolate Np_24_1112, complete genome) position: , mismatch: 9, identity: 0.719

taactttgtagctgtatctgtagccattgttg	CRISPR spacer
caagtttgtagatgtatctgtagcgtgaactg	Protospacer
.** ******* ************    ..**

14. spacer 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT matches to KX349268 (Synechococcus phage S-RIM2 isolate RW_30_0905, complete genome) position: , mismatch: 9, identity: 0.719

taactttgtagctgtatctgtagccattgttg	CRISPR spacer
caagtttgtagatgtatctgtagcgtgaactg	Protospacer
.** ******* ************    ..**

15. spacer 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT matches to KX349230 (Synechococcus phage S-RIM2 isolate LIS_02_1013, complete genome) position: , mismatch: 9, identity: 0.719

taactttgtagctgtatctgtagccattgttg	CRISPR spacer
caagtttgtagatgtatctgtagcgtgaactg	Protospacer
.** ******* ************    ..**

16. spacer 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT matches to MF042360 (Pseudomonas phage Phabio, complete genome) position: , mismatch: 9, identity: 0.719

taactttgtagctgtatctgtagccattgttg	CRISPR spacer
aaactttgaagctgtatttgtagctaccccta	Protospacer
 ******* ********.******.*.. .*.

17. spacer 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT matches to MN693397 (Marine virus AFVG_25M279, complete genome) position: , mismatch: 10, identity: 0.688

taactttgtagctgtatctgtagccattgttg	CRISPR spacer
gccacttgtacctgtaactgtagccattttat	Protospacer
    .***** ***** *********** *  

18. spacer 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT matches to MN693087 (Marine virus AFVG_25M280, complete genome) position: , mismatch: 10, identity: 0.688

taactttgtagctgtatctgtagccattgttg	CRISPR spacer
gccacttgtacctgtaactgtagccattttat	Protospacer
    .***** ***** *********** *  

19. spacer 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT matches to MN693388 (Marine virus AFVG_25M277, complete genome) position: , mismatch: 10, identity: 0.688

taactttgtagctgtatctgtagccattgttg	CRISPR spacer
gccacttgtacctgtaactgtagccattttat	Protospacer
    .***** ***** *********** *  

20. spacer 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT matches to MN693389 (Marine virus AFVG_25M278, complete genome) position: , mismatch: 10, identity: 0.688

taactttgtagctgtatctgtagccattgttg	CRISPR spacer
gccacttgtacctgtaactgtagccattttat	Protospacer
    .***** ***** *********** *  

21. spacer 1.3|2037635|32|NZ_CP031972|CRISPRCasFinder,CRT matches to MN693389 (Marine virus AFVG_25M278, complete genome) position: , mismatch: 10, identity: 0.688

taactttgtagctgtatctgtagccattgttg	CRISPR spacer
gccacttgtacctgtaactgtagccattttgt	Protospacer
    .***** ***** *********** *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 82123 : 125648 37 Escherichia_phage(20.0%) integrase,transposase attL 73340:73357|attR 110816:110833
DBSCAN-SWA_2 267056 : 384839 104 Shigella_phage(11.11%) integrase,transposase,tRNA attL 256571:256586|attR 354557:355796
DBSCAN-SWA_3 924776 : 986374 48 Enterobacteria_phage(25.0%) transposase,protease,tRNA,plate NA
DBSCAN-SWA_4 1140003 : 1203451 60 uncultured_Caudovirales_phage(15.79%) transposase,tRNA NA
DBSCAN-SWA_5 1259368 : 1331698 54 Escherichia_phage(20.0%) transposase,tRNA NA
DBSCAN-SWA_6 1453092 : 1514155 56 uncultured_virus(18.18%) transposase NA
DBSCAN-SWA_7 1653897 : 1716519 60 Enterobacteria_phage(18.18%) transposase,protease NA
DBSCAN-SWA_8 2347305 : 2449073 85 uncultured_virus(17.39%) integrase,protease,transposase attL 2335822:2335838|attR 2384453:2384469
DBSCAN-SWA_9 3201697 : 3268715 55 Enterobacteria_phage(16.67%) transposase,tRNA NA
DBSCAN-SWA_10 3373175 : 3440439 55 Enterobacteria_phage(21.43%) integrase,transposase,tRNA attL 3396339:3396359|attR 3446366:3446386
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP031973
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11555 : 67799 49 uncultured_virus(25.0%) protease,integrase,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage