Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP030262 Ensifer adhaerens strain Corn53 chromosome, complete genome 3 crisprs csa3,WYL,cas3,DEDDh 0 2 3 0
NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 0 crisprs csa3,DEDDh,WYL 0 0 3 0
NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 0 crisprs csa3,DEDDh 0 0 0 0

Results visualization

1. NZ_CP030262
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030262_1 1683953-1684041 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030262_2 2162255-2162340 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030262_3 2673029-2673121 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP015236 Rhodococcus fascians D188 plasmid pFiD188, complete sequence 171870-171897 5 0.821
NZ_CP030262_3 3.1|2673063|25|NZ_CP030262|CRISPRCasFinder 2673063-2673087 25 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 222273-222297 5 0.8
NZ_CP030262_3 3.1|2673063|25|NZ_CP030262|CRISPRCasFinder 2673063-2673087 25 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 206667-206691 5 0.8
NZ_CP030262_3 3.1|2673063|25|NZ_CP030262|CRISPRCasFinder 2673063-2673087 25 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1200011-1200035 5 0.8
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP017759 Cupriavidus necator strain NH9 plasmid pENH92, complete sequence 292964-292991 6 0.786
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 291447-291474 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 238892-238919 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 453540-453567 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 455275-455302 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 601425-601452 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 377169-377196 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 275274-275301 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 247387-247414 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 342479-342506 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 278121-278148 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 256434-256461 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 276424-276451 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 360100-360127 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 251773-251800 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 258975-259002 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 256607-256634 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 256977-257004 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 270773-270800 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 256977-257004 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 260042-260069 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 256972-256999 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 276424-276451 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 336416-336443 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 453542-453569 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 270773-270800 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 291516-291543 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 336416-336443 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 336416-336443 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 256607-256634 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 336416-336443 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 336740-336767 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 50723-50750 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 262611-262638 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 360098-360125 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 106920-106947 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 104214-104241 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1707958-1707985 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 132809-132836 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 1540122-1540149 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 213460-213487 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 277550-277577 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 505180-505207 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 172611-172638 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 689173-689200 7 0.75
NZ_CP030262_2 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder 2162284-2162311 28 MF063068 Pseudomonas phage Noxifer, complete genome 175030-175057 8 0.714

1. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP015236 (Rhodococcus fascians D188 plasmid pFiD188, complete sequence) position: , mismatch: 5, identity: 0.821

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtcccgagcagcggctttttcgtcttcc	Protospacer
 *.* ************.****.*****

2. spacer 3.1|2673063|25|NZ_CP030262|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.8

cagcttgaagtgacgcaattccgga	CRISPR spacer
tcatttgaaatgacgcaattccgga	Protospacer
. ..*****.***************

3. spacer 3.1|2673063|25|NZ_CP030262|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.8

cagcttgaagtgacgcaattccgga	CRISPR spacer
tcatttgaaatgacgcaattccgga	Protospacer
. ..*****.***************

4. spacer 3.1|2673063|25|NZ_CP030262|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.8

cagcttgaagtgacgcaattccgga	CRISPR spacer
agttttgaagtgtcgcaattccgga	Protospacer
 . .******** ************

5. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP017759 (Cupriavidus necator strain NH9 plasmid pENH92, complete sequence) position: , mismatch: 6, identity: 0.786

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
ttggcgagcagcggcgtgttcgccttcc	Protospacer
.*   ********** * **********

6. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

7. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

8. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

9. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

10. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

11. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

12. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtaaggagaagcggcttcttcgcctgat	Protospacer
 *  **** ****************  .

13. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

14. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

15. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

16. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtaaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

17. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtaaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

18. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

19. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtaaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

20. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtaaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

21. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtaaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

22. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtaaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

23. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtaaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

24. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtaaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

25. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtaaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

26. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtaaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

27. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtaaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

28. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

29. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

30. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtaaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

31. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

32. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

33. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

34. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtaaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

35. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

36. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

37. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

38. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtaaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

39. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

40. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
cttcggagcggcggcttcttccgtcttg	Protospacer
*********.***********  ..*. 

41. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
cttcggagcggcggcttcttccgtcttg	Protospacer
*********.***********  ..*. 

42. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
ccgacgagcagcggcttctttgcctttt	Protospacer
*.   ***************.*****..

43. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
atgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

44. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
ccgacgagcagcggcttctttgcctttt	Protospacer
*.   ***************.*****..

45. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggaggagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

46. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

47. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggagaagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

48. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
gtgaggaggagcggcttcttcgcctggt	Protospacer
 *  **** ****************  .

49. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.75

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
tgtttgagcagcggcttcttcggcttgt	Protospacer
. *. ***************** *** .

50. spacer 2.1|2162284|28|NZ_CP030262|CRISPRCasFinder matches to MF063068 (Pseudomonas phage Noxifer, complete genome) position: , mismatch: 8, identity: 0.714

cttcggagcagcggcttcttcgccttcc	CRISPR spacer
accgccagcagcggcttcttcgacttcg	Protospacer
 ..   **************** **** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2046385 : 2068053 27 Sinorhizobium_phage(65.0%) terminase,tail,head NA
DBSCAN-SWA_2 2076656 : 2084042 13 Sinorhizobium_phage(33.33%) NA NA
DBSCAN-SWA_3 2170956 : 2186356 15 uncultured_Mediterranean_phage(83.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP030263
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 922486 : 969274 38 Acidithiobacillus_phage(18.18%) protease,transposase NA
DBSCAN-SWA_2 1004511 : 1013546 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 1132551 : 1176765 38 Rhizobium_phage(27.27%) transposase,integrase attL 1163010:1163069|attR 1182278:1182362
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage