Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP026941 Escherichia coli strain CFS3313 plasmid pCFS3313-2, complete sequence 0 crisprs DEDDh,RT 0 0 0 0
NZ_CP026939 Escherichia coli strain CFS3313 chromosome, complete genome 7 crisprs csa3,PD-DExK,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,RT,DEDDh,c2c9_V-U4,DinG 0 11 9 0
NZ_CP026942 Escherichia coli strain CFS3313 plasmid pCFS3313-3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP026940 Escherichia coli strain CFS3313 plasmid pCFS3313-1, complete sequence 0 crisprs DEDDh 0 0 1 0

Results visualization

1. NZ_CP026939
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026939_1 671977-672094 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026939_2 1132976-1133797 TypeI-E I-E
13 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026939_3 1149299-1150060 TypeI-E I-E
12 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026939_4 2322174-2322297 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026939_5 2986073-2986164 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026939_6 4108199-4108331 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026939_7 4359332-4359481 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP026939_6 6.1|4108216|42|NZ_CP026939|PILER-CR 4108216-4108257 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
NZ_CP026939_5 5.1|2986099|40|NZ_CP026939|CRISPRCasFinder 2986099-2986138 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
NZ_CP026939_6 6.2|4108275|40|NZ_CP026939|PILER-CR 4108275-4108314 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 1 0.975
NZ_CP026939_4 4.1|2322217|38|NZ_CP026939|CRISPRCasFinder 2322217-2322254 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP019314 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence 71972-72003 6 0.812
NZ_CP026939_2 2.21|1133432|32|NZ_CP026939|CRISPRCasFinder,CRT 1133432-1133463 32 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 555773-555804 7 0.781
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 66681-66712 7 0.781
NZ_CP026939_2 2.26|1133737|32|NZ_CP026939|CRISPRCasFinder,CRT 1133737-1133768 32 MK249151 Blackfly microvirus SF02 isolate 049, complete genome 1908-1939 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 46007-46038 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 125777-125808 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 134655-134686 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 68724-68755 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 166140-166171 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP013598 Rhizobium sp. N741 plasmid pRspN741c, complete sequence 103164-103195 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP013544 Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence 36015-36046 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 125777-125808 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP013502 Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence 103085-103116 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP013508 Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence 103164-103195 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP013519 Rhizobium sp. N113 plasmid pRspN113b, complete sequence 103163-103194 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP013492 Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence 103161-103192 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP013497 Rhizobium sp. N621 plasmid pRspN621b, complete sequence 103161-103192 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP013592 Rhizobium sp. N871 plasmid pRspN871b, complete sequence 103085-103116 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 CP007643 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence 92301-92332 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 100863-100894 9 0.719
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 97248-97279 9 0.719
NZ_CP026939_3 3.3|1149450|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149450-1149481 32 NZ_CP033139 Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence 115828-115859 9 0.719
NZ_CP026939_3 3.3|1149450|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149450-1149481 32 KY579375 Sulfolobus spindle-shaped virus 3 strain REY 15/4, complete genome 4523-4554 9 0.719
NZ_CP026939_3 3.3|1149450|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149450-1149481 32 EU030939 Sulfolobus spindle-shaped virus 5, complete genome 8793-8824 9 0.719
NZ_CP026939_3 3.3|1149450|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149450-1149481 32 JF412294 EBPR podovirus 1, partial sequence 3991-4022 9 0.719
NZ_CP026939_3 3.5|1149572|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149572-1149603 32 AP014927 Ralstonia phage RSF1 DNA, complete genome 171005-171036 9 0.719
NZ_CP026939_2 2.25|1133676|32|NZ_CP026939|CRISPRCasFinder,CRT 1133676-1133707 32 NZ_CP039902 Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence 33041-33072 10 0.688
NZ_CP026939_2 2.25|1133676|32|NZ_CP026939|CRISPRCasFinder,CRT 1133676-1133707 32 NZ_CP039893 Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence 217865-217896 10 0.688
NZ_CP026939_2 2.25|1133676|32|NZ_CP026939|CRISPRCasFinder,CRT 1133676-1133707 32 NZ_KY000025 Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence 208000-208031 10 0.688
NZ_CP026939_2 2.25|1133676|32|NZ_CP026939|CRISPRCasFinder,CRT 1133676-1133707 32 NZ_KY000029 Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence 208000-208031 10 0.688
NZ_CP026939_2 2.26|1133737|32|NZ_CP026939|CRISPRCasFinder,CRT 1133737-1133768 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 450688-450719 10 0.688
NZ_CP026939_3 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT 1149389-1149420 32 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1679246-1679277 10 0.688
NZ_CP026939_2 2.18|1133249|32|NZ_CP026939|CRISPRCasFinder,CRT 1133249-1133280 32 NZ_AP018282 Chondrocystis sp. NIES-4102 plasmid plasmid1 DNA, complete genome 109485-109516 11 0.656

1. spacer 6.1|4108216|42|NZ_CP026939|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

2. spacer 5.1|2986099|40|NZ_CP026939|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975

gcgctgcgggtcattcttgaaattccccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
************************ ***************

3. spacer 6.2|4108275|40|NZ_CP026939|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.975

catggcgtagcaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********** *****************************

4. spacer 4.1|2322217|38|NZ_CP026939|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

5. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019314 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence) position: , mismatch: 6, identity: 0.812

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
gcaccgttctcgcccaacagggcg-acaatctc	Protospacer
 *******.******* ******* ****.*. 

6. spacer 2.21|1133432|32|NZ_CP026939|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

-gtctgtgatggcctgctcgtgagtccgcggcg	CRISPR spacer
cgcgtg-gatggcctgctcgtcagttcgcgcct	Protospacer
 *. ** ************** ***.**** * 

7. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
ccaccgtcttcgccgaccagggca-acgtcctc	Protospacer
*******.****** ********. **. **. 

8. spacer 2.26|1133737|32|NZ_CP026939|CRISPRCasFinder,CRT matches to MK249151 (Blackfly microvirus SF02 isolate 049, complete genome) position: , mismatch: 9, identity: 0.719

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
gccatgtcccaacaaaacgccagggaacaaat	Protospacer
  *. *  ***.************* ***** 

9. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

10. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

11. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

12. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

13. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gcaccgttttcgccgatcagggcggtgacctt	Protospacer
 ************* *.*******   * *..

14. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

15. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

16. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

17. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

18. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

19. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

20. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

21. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

22. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

23. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

24. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

25. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

26. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

27. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

28. spacer 3.3|1149450|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033139 (Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence) position: , mismatch: 9, identity: 0.719

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gaaaaagagaatgtagaggaagcgtttttctt	Protospacer
*********** ******.*****   *..  

29. spacer 3.3|1149450|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to KY579375 (Sulfolobus spindle-shaped virus 3 strain REY 15/4, complete genome) position: , mismatch: 9, identity: 0.719

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gacaaagagaaagtagagaaagcgattttctt	Protospacer
** ********.************.  *..  

30. spacer 3.3|1149450|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to EU030939 (Sulfolobus spindle-shaped virus 5, complete genome) position: , mismatch: 9, identity: 0.719

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gacaaagagaaagtagagaaagcgattttctt	Protospacer
** ********.************.  *..  

31. spacer 3.3|1149450|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to JF412294 (EBPR podovirus 1, partial sequence) position: , mismatch: 9, identity: 0.719

gaaaaagagaaggtagagaaagcggaatctgg	CRISPR spacer
gaaaaagagaaggccgagaaagcagcgaaggc	Protospacer
*************. ********.* .   * 

32. spacer 3.5|1149572|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to AP014927 (Ralstonia phage RSF1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

gcgcaccgttgcgtcgaaaaggcgctggagat	CRISPR spacer
cagacccgtttcgtcgaacaggcgctggcgtg	Protospacer
  *  ***** ******* ********* *  

33. spacer 2.25|1133676|32|NZ_CP026939|CRISPRCasFinder,CRT matches to NZ_CP039902 (Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

34. spacer 2.25|1133676|32|NZ_CP026939|CRISPRCasFinder,CRT matches to NZ_CP039893 (Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

35. spacer 2.25|1133676|32|NZ_CP026939|CRISPRCasFinder,CRT matches to NZ_KY000025 (Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

36. spacer 2.25|1133676|32|NZ_CP026939|CRISPRCasFinder,CRT matches to NZ_KY000029 (Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

37. spacer 2.26|1133737|32|NZ_CP026939|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
ggaaggagcctgcaaagcgccagggcaccggt	Protospacer
 * ..***** *****.*********** .. 

38. spacer 3.2|1149389|32|NZ_CP026939|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
ccaccgtattcgccaaccagggcggcagggaa	Protospacer
******* ****** *********   ..   

39. spacer 2.18|1133249|32|NZ_CP026939|CRISPRCasFinder,CRT matches to NZ_AP018282 (Chondrocystis sp. NIES-4102 plasmid plasmid1 DNA, complete genome) position: , mismatch: 11, identity: 0.656

acggcgtggattgagggacgggtatttggtcc	CRISPR spacer
gcggagtggattgaggtacgggtaaagaagga	Protospacer
.*** *********** *******   ..   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 855534 : 930163 58 Shigella_phage(33.33%) transposase,tRNA,integrase attL 903180:903195|attR 936005:936020
DBSCAN-SWA_2 1166416 : 1173556 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_3 1675241 : 1737323 75 Enterobacteria_phage(38.46%) head,holin,terminase,protease,tail,capsid,lysis,portal NA
DBSCAN-SWA_4 2821124 : 2871236 57 Escherichia_phage(53.33%) head,holin,integrase,tRNA,protease,terminase,tail,capsid,lysis,portal attL 2829415:2829429|attR 2871338:2871352
DBSCAN-SWA_5 3069393 : 3142502 60 Bacillus_phage(19.05%) head,integrase,transposase,tRNA,protease,capsid attL 3075590:3075605|attR 3145899:3145914
DBSCAN-SWA_6 3178051 : 3210970 45 Salmonella_phage(83.33%) head,integrase,terminase,tail,plate,capsid,lysis,portal attL 3177961:3177974|attR 3211045:3211058
DBSCAN-SWA_7 3514812 : 3571828 68 Enterobacteria_phage(60.0%) head,integrase,transposase,protease,terminase,tail,capsid,lysis,portal attL 3523293:3523339|attR 3571842:3571888
DBSCAN-SWA_8 3891723 : 3953914 51 Enterobacteria_phage(12.5%) transposase,tRNA,plate,protease NA
DBSCAN-SWA_9 4296789 : 4342584 38 Stx2-converting_phage(23.08%) transposase,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP026940
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1262 : 72345 59 Enterobacteria_phage(18.18%) protease,transposase,integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage