Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP047242 Trichormus variabilis 0441 chromosome, complete genome 18 crisprs cas3,PD-DExK,cas10d,csc2gr7,csc1gr5,2OG_CAS,cas6,cas4,cas1,cas2,csa3,Cas9_archaeal,cas14k,Cas14c_CAS-V-F,cas14j,c2c5_V-U5,DinG,RT,cas8b3,cas7,cas5 1 37 0 0
NZ_CP047246 Trichormus variabilis 0441 plasmid unnamed4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP047244 Trichormus variabilis 0441 plasmid unnamed2, complete sequence 1 crisprs cas14j,cas3,cas14k,RT,PD-DExK 0 1 1 0
NZ_CP047245 Trichormus variabilis 0441 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP047243 Trichormus variabilis 0441 plasmid unnamed1, complete sequence 1 crisprs RT,Cas9_archaeal,cas14k,Cas14u_CAS-V,cas14j,DEDDh 0 3 21 0

Results visualization

1. NZ_CP047242
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_1 150427-150522 TypeI-D I-D,II-B
1 spacers
cas3,WYL,PD-DExK,cas10d,csc2gr7,csc1gr5,2OG_CAS,cas6,cas4

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_2 162002-164071 TypeI-D I-D,II-B
28 spacers
cas2,cas1,cas4,cas6,2OG_CAS,csc1gr5,csc2gr7,cas10d,PD-DExK

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_3 698679-701097 Orphan I-D,II-B
33 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_4 2493450-2493707 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_5 2525000-2527626 Orphan I-D,II-B
36 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_6 2714250-2714434 TypeV-U5 V-U5
2 spacers
c2c5_V-U5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_7 2727312-2727404 TypeV-U5 NA
1 spacers
c2c5_V-U5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_8 2913110-2913292 TypeV-U5 V-U5
2 spacers
c2c5_V-U5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_9 3385529-3385615 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_10 3591675-3591770 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_11 3672821-3675854 Orphan I-D,II-B
42 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_12 3948442-3948522 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_13 4002942-4003194 TypeV-U5 V-U5
3 spacers
c2c5_V-U5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_14 5542600-5542672 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_15 5557085-5557192 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_16 5559835-5559944 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_17 5646758-5646938 Unclear I-A,I-B,II-B
2 spacers
cas5,cas7,cas8b3,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047242_18 6133805-6136308 Orphan I-D,II-B
34 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP047242_14 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder 5542624-5542648 25 NZ_CP047242.1 1544929-1544953 0 1.0
NZ_CP047242_14 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder 5542624-5542648 25 NZ_CP047242.1 2072062-2072086 0 1.0
NZ_CP047242_14 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder 5542624-5542648 25 NZ_CP047242.1 1559864-1559888 0 1.0
NZ_CP047242_14 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder 5542624-5542648 25 NZ_CP047242.1 4530591-4530615 0 1.0
NZ_CP047242_14 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder 5542624-5542648 25 NZ_CP047242.1 6064831-6064855 0 1.0
NZ_CP047242_14 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder 5542624-5542648 25 NZ_CP047242.1 3073938-3073962 1 0.96
NZ_CP047242_14 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder 5542624-5542648 25 NZ_CP047242.1 5187237-5187261 1 0.96
NZ_CP047242_14 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder 5542624-5542648 25 NZ_CP047242.1 336330-336354 1 0.96
NZ_CP047242_14 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder 5542624-5542648 25 NZ_CP047242.1 3194594-3194618 1 0.96
NZ_CP047242_14 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder 5542624-5542648 25 NZ_CP047242.1 3390069-3390093 1 0.96
NZ_CP047242_14 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder 5542624-5542648 25 NZ_CP047242.1 1113345-1113369 2 0.92
NZ_CP047242_14 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder 5542624-5542648 25 NZ_CP047242.1 4512550-4512574 7 0.72
NZ_CP047242_14 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder 5542624-5542648 25 NZ_CP047242.1 4204752-4204776 2 0.92
NZ_CP047242_14 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder 5542624-5542648 25 NZ_CP047242.1 4234837-4234861 2 0.92

1. spacer 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder matches to position: 1544929-1544953, mismatch: 0, identity: 1.0

gggtgaagacgcgattcatcgcgtc	CRISPR spacer
gggtgaagacgcgattcatcgcgtc	Protospacer
*************************

2. spacer 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder matches to position: 2072062-2072086, mismatch: 0, identity: 1.0

gggtgaagacgcgattcatcgcgtc	CRISPR spacer
gggtgaagacgcgattcatcgcgtc	Protospacer
*************************

3. spacer 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder matches to position: 1559864-1559888, mismatch: 0, identity: 1.0

gggtgaagacgcgattcatcgcgtc	CRISPR spacer
gggtgaagacgcgattcatcgcgtc	Protospacer
*************************

4. spacer 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder matches to position: 4530591-4530615, mismatch: 0, identity: 1.0

gggtgaagacgcgattcatcgcgtc	CRISPR spacer
gggtgaagacgcgattcatcgcgtc	Protospacer
*************************

5. spacer 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder matches to position: 6064831-6064855, mismatch: 0, identity: 1.0

gggtgaagacgcgattcatcgcgtc	CRISPR spacer
gggtgaagacgcgattcatcgcgtc	Protospacer
*************************

6. spacer 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder matches to position: 3073938-3073962, mismatch: 1, identity: 0.96

gggtgaagacgcgattcatcgcgtc	CRISPR spacer
gggtgaagacgcgatttatcgcgtc	Protospacer
****************.********

7. spacer 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder matches to position: 5187237-5187261, mismatch: 1, identity: 0.96

gggtgaagacgcgattcatcgcgtc	CRISPR spacer
gggtgaagacgcgattaatcgcgtc	Protospacer
**************** ********

8. spacer 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder matches to position: 336330-336354, mismatch: 1, identity: 0.96

gggtgaagacgcgattcatcgcgtc	CRISPR spacer
ggatgaagacgcgattcatcgcgtc	Protospacer
**.**********************

9. spacer 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder matches to position: 3194594-3194618, mismatch: 1, identity: 0.96

gggtgaagacgcgattcatcgcgtc	CRISPR spacer
ggctgaagacgcgattcatcgcgtc	Protospacer
** **********************

10. spacer 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder matches to position: 3390069-3390093, mismatch: 1, identity: 0.96

gggtgaagacgcgattcatcgcgtc	CRISPR spacer
gggtgaagacgcgatttatcgcgtc	Protospacer
****************.********

11. spacer 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder matches to position: 1113345-1113369, mismatch: 2, identity: 0.92

gggtgaagacgcgattcatcgcgtc	CRISPR spacer
gggtgaagacgcgataaatcgcgtc	Protospacer
***************  ********

12. spacer 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder matches to position: 4512550-4512574, mismatch: 7, identity: 0.72

gggtgaagacgcgattcatcgcgtc-------	CRISPR spacer
-------gacgcgattcatcgcgtcttcaccc	Protospacer
       ******************       

13. spacer 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder matches to position: 4204752-4204776, mismatch: 2, identity: 0.92

gggtgaagacgcgattcatcgcgtc	CRISPR spacer
gggtgaagacgcgatgaatcgcgtc	Protospacer
***************  ********

14. spacer 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder matches to position: 4234837-4234861, mismatch: 2, identity: 0.92

gggtgaagacgcgattcatcgcgtc	CRISPR spacer
gggtgaagacgcgataaatcgcgtc	Protospacer
***************  ********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047242_18 18.27|6135725|36|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 6135725-6135760 36 KU234532 Nostoc phage N1, complete genome 13148-13183 1 0.972
NZ_CP047242_18 18.29|6135873|36|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 6135873-6135908 36 KU234532 Nostoc phage N1, complete genome 2375-2410 1 0.972
NZ_CP047242_14 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder 5542624-5542648 25 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 298563-298587 3 0.88
NZ_CP047242_5 5.32|2527273|32|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2527273-2527304 32 NZ_CP026685 Nostoc sp. 'Peltigera membranacea cyanobiont' N6 plasmid pNPM3, complete sequence 18810-18841 5 0.844
NZ_CP047242_5 5.32|2527273|32|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2527273-2527304 32 NC_009933 Acaryochloris marina MBIC11017 plasmid pREB8, complete sequence 76718-76749 6 0.812
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 KT895374 Bacillus phage vB_BpuM-BpSp, complete genome 247946-247979 7 0.794
NZ_CP047242_5 5.32|2527273|32|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2527273-2527304 32 NC_009933 Acaryochloris marina MBIC11017 plasmid pREB8, complete sequence 76493-76524 7 0.781
NZ_CP047242_13 13.1|4002983|30|NZ_CP047242|PILER-CR 4002983-4003012 30 NC_015223 Nitrosomonas sp. AL212 plasmid pNAL21201, complete sequence 33272-33301 7 0.767
NZ_CP047242_13 13.3|4002982|33|NZ_CP047242|CRT 4002982-4003014 33 NC_015223 Nitrosomonas sp. AL212 plasmid pNAL21201, complete sequence 33270-33302 7 0.788
NZ_CP047242_13 13.6|4002982|34|NZ_CP047242|CRISPRCasFinder 4002982-4003015 34 NC_015223 Nitrosomonas sp. AL212 plasmid pNAL21201, complete sequence 33269-33302 7 0.794
NZ_CP047242_2 2.16|163139|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 163139-163172 34 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 344185-344218 8 0.765
NZ_CP047242_2 2.16|163139|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 163139-163172 34 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1468880-1468913 8 0.765
NZ_CP047242_2 2.16|163139|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 163139-163172 34 NZ_CP030830 Neorhizobium sp. NCHU2750 plasmid pNCHU2750c, complete sequence 263586-263619 8 0.765
NZ_CP047242_2 2.19|163352|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 163352-163385 34 NZ_CP046662 Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence 22326-22359 8 0.765
NZ_CP047242_3 3.11|699455|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 699455-699488 34 CP033563 Acinetobacter nosocomialis strain 2010S01-197 plasmid p2010S01-197-2, complete sequence 38415-38448 8 0.765
NZ_CP047242_5 5.16|2526120|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2526120-2526153 34 NZ_CP045385 Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence 105170-105203 8 0.765
NZ_CP047242_5 5.25|2526775|33|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2526775-2526807 33 MN694789 Marine virus AFVG_250M565, complete genome 12729-12761 8 0.758
NZ_CP047242_11 11.25|3674574|33|NZ_CP047242|CRISPRCasFinder,CRT 3674574-3674606 33 MN693370 Marine virus AFVG_25M236, complete genome 6405-6437 8 0.758
NZ_CP047242_11 11.67|3674575|33|NZ_CP047242|PILER-CR 3674575-3674607 33 MN693370 Marine virus AFVG_25M236, complete genome 6405-6437 8 0.758
NZ_CP047242_13 13.5|4003125|32|NZ_CP047242|CRT 4003125-4003156 32 MW057855 Providencia phage PSTCR3, complete genome 25327-25358 8 0.75
NZ_CP047242_18 18.14|6134790|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 6134790-6134823 34 MN694598 Marine virus AFVG_250M666, complete genome 11161-11194 8 0.765
NZ_CP047242_18 18.14|6134790|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 6134790-6134823 34 MN693877 Marine virus AFVG_250M566, complete genome 25934-25967 8 0.765
NZ_CP047242_18 18.14|6134790|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 6134790-6134823 34 MN694162 Marine virus AFVG_250M665, complete genome 27499-27532 8 0.765
NZ_CP047242_18 18.14|6134790|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 6134790-6134823 34 MN693718 Marine virus AFVG_250M664, complete genome 27475-27508 8 0.765
NZ_CP047242_18 18.24|6135509|31|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 6135509-6135539 31 NC_014389 Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence 93045-93075 8 0.742
NZ_CP047242_18 18.24|6135509|31|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 6135509-6135539 31 NZ_LR217721 Candidatus Erwinia haradaeae strain ErCilaricifoliae isolate 3058 plasmid pBioThi 13709-13739 8 0.742
NZ_CP047242_2 2.16|163139|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 163139-163172 34 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1407897-1407930 9 0.735
NZ_CP047242_2 2.16|163139|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 163139-163172 34 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1746371-1746404 9 0.735
NZ_CP047242_2 2.25|163785|33|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 163785-163817 33 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 357076-357108 9 0.727
NZ_CP047242_2 2.25|163785|33|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 163785-163817 33 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 357076-357108 9 0.727
NZ_CP047242_3 3.14|699668|33|NZ_CP047242|CRISPRCasFinder,CRT 699668-699700 33 NZ_CP017587 Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ06, complete sequence 14276-14308 9 0.727
NZ_CP047242_5 5.4|2525248|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 2525248-2525281 34 KX507046 Vibrio phage S4-7, complete genome 118014-118047 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_KY120365 Salmonella enterica subsp. enterica serovar Typhimurium strain P111 plasmid pP111, complete sequence 6967-7000 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_KY075661 Escherichia coli strain GD65 plasmid pGD65-3, complete sequence 58885-58918 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_KY693674 Escherichia coli strain OM97 plasmid pOM97-mcr, complete sequence 58236-58269 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_KY075654 Escherichia coli strain Lishui142 plasmid pLishui142-1, complete sequence 55935-55968 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_KU934209 Salmonella enterica strain SC23 plasmid pSCS23, complete sequence 59933-59966 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_KY012274 Escherichia coli strain 20COE13 plasmid pEc_20COE13, complete sequence 55439-55472 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_KX013539 Escherichia coli strain BA77 plasmid pBA77-MCR-1, complete sequence 57175-57208 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_KX084393 Escherichia coli strain 61 plasmid pECJS-61-63, complete sequence 34237-34270 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_KU922754 Kluyvera ascorbata strain WCH1410 plasmid pMCR_1410, complete sequence 46360-46393 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_KX254342 Escherichia coli strain JS-61 plasmid pECJS-61-63, complete sequence 57940-57973 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP032990 Escherichia coli strain W2-5 plasmid pMCR_W2-5, complete sequence 45255-45288 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 CP043014 Escherichia coli strain 388755_gen plasmid unnamed3, complete sequence 38022-38055 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP011294 Salmonella enterica subsp. diarizonae strain 11-01854 plasmid unnamed2, complete sequence 31772-31805 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP011291 Salmonella enterica subsp. diarizonae strain 11-01853 plasmid unnamed2, complete sequence 31822-31855 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP010220 Escherichia coli strain M18 plasmid A, complete sequence 23747-23780 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP020548 Escherichia coli strain ZJ3920 plasmid pZJ3920-3, complete sequence 35180-35213 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP019254 Escherichia coli strain 13KWH46 plasmid p13KWH46-4, complete sequence 20041-20074 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP019277 Escherichia coli strain 13P477T plasmid p13P477T-4, complete sequence 49039-49072 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MK574667 Escherichia coli strain DRC-3 plasmid pDRC-3, complete sequence 54535-54568 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MK574668 Escherichia coli strain HAB-6 plasmid pHAB-6, complete sequence 59963-59996 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MK574669 Escherichia coli strain LSECO-1 plasmid pLSECO-1, complete sequence 55480-55513 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP029184 Escherichia coli strain H9Ecoli plasmid pMCR-H9, complete sequence 54969-55002 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232179 Escherichia coli plasmid pAH59-106, complete sequence 54796-54829 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232180 Escherichia coli plasmid pAH59-40, complete sequence 52520-52553 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232182 Escherichia coli plasmid pAH59-57, complete sequence 55551-55584 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232183 Escherichia coli plasmid pAH59-58, complete sequence 54972-55005 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232184 Escherichia coli plasmid pAH81-109, complete sequence 54658-54691 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232185 Escherichia coli plasmid pAH81-113, complete sequence 54892-54925 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232186 Escherichia coli plasmid pAH81-39, complete sequence 55475-55508 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232188 Escherichia coli plasmid pGD16-3, complete sequence 52284-52317 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232196 Escherichia coli plasmid pHLJ109-11, complete sequence 55474-55507 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232198 Escherichia coli plasmid pHLJ109-25, complete sequence 55474-55507 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232199 Escherichia coli plasmid pHLJ109-28, complete sequence 53172-53205 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232200 Escherichia coli plasmid pHLJ109-34, complete sequence 57438-57471 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232201 Escherichia coli plasmid pHLJ109-70, complete sequence 55537-55570 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232203 Escherichia coli plasmid pHLJ109-92, complete sequence 55474-55507 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232204 Escherichia coli plasmid pHLJ111-101, complete sequence 55513-55546 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232205 Escherichia coli plasmid pHLJ111-18, complete sequence 55476-55509 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232206 Escherichia coli plasmid pHLJ111-20, complete sequence 53271-53304 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232207 Escherichia coli plasmid pHLJ111-3, complete sequence 58379-58412 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232208 Escherichia coli plasmid pHLJ111-5, complete sequence 55608-55641 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232210 Escherichia coli plasmid pHLJ179-141, complete sequence 55474-55507 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232211 Escherichia coli plasmid pHLJ179-167, complete sequence 55474-55507 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232212 Escherichia fergusonii plasmid pHLJ179-32, complete sequence 59413-59446 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN232213 Escherichia coli plasmid pHLJ179-34, complete sequence 55474-55507 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP049356 Escherichia coli strain T28R plasmid pT28R-3, complete sequence 59213-59246 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 CP019690 Shigella sonnei strain 75/02 plasmid p75-02_2, complete sequence 48634-48667 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 LC511662 Escherichia coli 2018-10-2CC plasmid p2018-10-2CC DNA, complete genome 54993-55026 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP021176 Escherichia coli strain 5CRE51 plasmid p5CRE51-MCR-1, complete sequence 60809-60842 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP045521 Salmonella enterica subsp. enterica serovar Anatum strain Sal-5091 plasmid pSal-5091_MCR64k, complete sequence 57789-57822 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP024156 Escherichia coli strain 14EC047 plasmid p14EC047a, complete sequence 23738-23771 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP022452 Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-2, complete sequence 41137-41170 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP024148 Escherichia coli strain 14EC033 plasmid p14EC033a, complete sequence 7205-7238 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP033355 Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-3, complete sequence 50800-50833 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP024142 Escherichia coli strain 14EC029 plasmid p14EC029a, complete sequence 60878-60911 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP047579 Escherichia coli strain 94EC plasmid p94EC-3, complete sequence 54987-55020 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN746292 Escherichia coli strain GN2984 plasmid p778, complete sequence 56337-56370 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP015913 Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy1, complete sequence 1346-1379 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP033254 Salmonella enterica subsp. enterica strain CFSA244 plasmid pCFSA244-2, complete sequence 54570-54603 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 KY657478 Escherichia coli plasmid pUSU-ECO-12704_4, complete sequence 13216-13249 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP016187 Escherichia coli strain S2.14 plasmid pS2.14-2, complete sequence 55465-55498 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 KY657476 Escherichia coli plasmid pCREC-527_4, complete sequence 57535-57568 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP016186 Escherichia coli strain EC13 plasmid pEC13-1, complete sequence 54732-54765 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP016185 Escherichia coli strain EC5 plasmid pEC5-1, complete sequence 56249-56282 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MH176237 Escherichia coli plasmid pmcr-JLF4, complete sequence 55005-55038 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP024139 Escherichia coli strain 14EC020 plasmid p14EC020a, complete sequence 54477-54510 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_MK571810 Escherichia coli strain PK411 plasmid pPK411, complete sequence 54675-54708 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_MN689940 Escherichia coli strain LWY24J plasmid pLWY24J-mcr-1.1, complete sequence 56035-56068 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_CP053083 Escherichia coli strain HB37 plasmid pHB37-3, complete sequence 51283-51316 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_MH202956 Escherichia coli strain HXH-5 plasmid pHXH-5, complete sequence 24005-24038 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_MH522412 Salmonella enterica subsp. enterica serovar Typhimurium strain SH13G1582 plasmid pSH13G1582, complete sequence 23766-23799 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_MF978388 Escherichia coli strain GDT6F93 plasmid pHNGDF93, complete sequence 37728-37761 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_MF175188 Escherichia coli strain ColR644SK1 plasmid pColR644SK1, complete sequence 55017-55050 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_MG808035 Escherichia coli strain PK105 plasmid pPK105, complete sequence 54563-54596 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_MG825374 Escherichia coli strain 1106 plasmid p1106-IncI2, complete sequence 54987-55020 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_MF175189 Escherichia coli strain ColR598 plasmid pColR598_2, complete sequence 55004-55037 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_MG825380 Escherichia coli strain 1108 plasmid p1108-MCR, complete sequence 23827-23860 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_MG594800 Escherichia coli isolate 1724 plasmid p1724, complete sequence 48900-48933 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_MG598816 Escherichia coli isolate 979 plasmid p979, complete sequence 53627-53660 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_KY829117 Escherichia coli strain WCHEC050604 plasmid pMCR_WCHEC1604-IncI2, complete sequence 49492-49525 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_KY792081 Escherichia coli strain EC-MCR1.8 plasmid unnamed, complete sequence 56691-56724 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_KY795978 Escherichia coli strain JIE3685 plasmid pJIE3685-1, complete sequence 55474-55507 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_MF521836 Escherichia coli str. K-12 substr. MG1655 strain K-12 plasmid TP114, complete sequence 1304-1337 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 NZ_MG747472 Klebsiella pneumoniae strain 09-20 plasmid pK09-20-mcr-1, complete sequence 41340-41373 9 0.735
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 MN692959 Marine virus AFVG_117M52, complete genome 9952-9985 9 0.735
NZ_CP047242_5 5.8|2525537|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525537-2525570 34 MN994503 Phage NBSal004, complete genome 37657-37690 9 0.735
NZ_CP047242_5 5.28|2526988|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2526988-2527021 34 NZ_CP014128 Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence 76903-76936 9 0.735
NZ_CP047242_5 5.33|2527342|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2527342-2527375 34 NZ_CP014128 Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence 76903-76936 9 0.735
NZ_CP047242_11 11.25|3674574|33|NZ_CP047242|CRISPRCasFinder,CRT 3674574-3674606 33 NC_007390 Spiroplasma citri pSci4 plasmid 8285-8317 9 0.727
NZ_CP047242_11 11.25|3674574|33|NZ_CP047242|CRISPRCasFinder,CRT 3674574-3674606 33 NC_028924 Polaribacter phage P12002L, complete genome 4132-4164 9 0.727
NZ_CP047242_11 11.25|3674574|33|NZ_CP047242|CRISPRCasFinder,CRT 3674574-3674606 33 NC_028763 Polaribacter phage P12002S, complete genome 4116-4148 9 0.727
NZ_CP047242_11 11.67|3674575|33|NZ_CP047242|PILER-CR 3674575-3674607 33 NC_007390 Spiroplasma citri pSci4 plasmid 8285-8317 9 0.727
NZ_CP047242_11 11.67|3674575|33|NZ_CP047242|PILER-CR 3674575-3674607 33 NC_028924 Polaribacter phage P12002L, complete genome 4132-4164 9 0.727
NZ_CP047242_11 11.67|3674575|33|NZ_CP047242|PILER-CR 3674575-3674607 33 NC_028763 Polaribacter phage P12002S, complete genome 4116-4148 9 0.727
NZ_CP047242_18 18.1|6133842|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 6133842-6133875 34 NC_003267 Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120gamma, complete sequence 7930-7963 9 0.735
NZ_CP047242_18 18.1|6133842|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 6133842-6133875 34 NC_003276 Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence 242018-242051 9 0.735
NZ_CP047242_18 18.1|6133842|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 6133842-6133875 34 NC_003276 Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence 245656-245689 9 0.735
NZ_CP047242_18 18.1|6133842|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 6133842-6133875 34 KU234533 Nostoc phage A1, complete genome 51684-51717 9 0.735
NZ_CP047242_3 3.27|700587|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 700587-700620 34 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 239838-239871 10 0.706
NZ_CP047242_5 5.8|2525537|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525537-2525570 34 MG251392 Salmonella virus VSe102, complete genome 49267-49300 10 0.706
NZ_CP047242_5 5.8|2525537|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525537-2525570 34 MG251391 Salmonella virus VSe11, complete genome 49234-49267 10 0.706
NZ_CP047242_5 5.8|2525537|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525537-2525570 34 LR597658 Escherichia phage VpaE1_ev108 genome assembly, chromosome: 1 52734-52767 10 0.706
NZ_CP047242_5 5.8|2525537|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525537-2525570 34 CP031020 Lactobacillus helveticus isolate NWC_2_4 plasmid pNWC_2_4, complete sequence 3497-3530 10 0.706
NZ_CP047242_5 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2526480-2526513 34 MF399199 Acinetobacter baumannii strain D46 plasmid pD46-4, complete sequence 162204-162237 10 0.706
NZ_CP047242_5 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2526480-2526513 34 NZ_CP040051 Acinetobacter baumannii strain VB16141 plasmid unnamed1, complete sequence 80443-80476 10 0.706
NZ_CP047242_5 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2526480-2526513 34 NZ_AP014650 Acinetobacter baumannii strain IOMTU433 plasmid pIOMTU433, complete sequence 78645-78678 10 0.706
NZ_CP047242_5 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2526480-2526513 34 MK531536 Acinetobacter baumannii strain MC1 plasmid pMC1.1, complete sequence 36095-36128 10 0.706
NZ_CP047242_5 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2526480-2526513 34 NZ_AP019743 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA3, complete sequence 25552-25585 10 0.706
NZ_CP047242_5 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2526480-2526513 34 CP040054 Acinetobacter baumannii strain VB35179 plasmid unnamed1, complete sequence 66743-66776 10 0.706
NZ_CP047242_5 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2526480-2526513 34 NZ_CP050433 Acinetobacter baumannii strain PM194229 plasmid pPM194229_1, complete sequence 104047-104080 10 0.706
NZ_CP047242_5 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2526480-2526513 34 NZ_CP038025 Acinetobacter radioresistens strain DD78 plasmid pAR3, complete sequence 59279-59312 10 0.706
NZ_CP047242_5 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2526480-2526513 34 NZ_CP038025 Acinetobacter radioresistens strain DD78 plasmid pAR3, complete sequence 70812-70845 10 0.706
NZ_CP047242_5 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2526480-2526513 34 NZ_CP014652 Acinetobacter sp. DUT-2 plasmid unnamed1, complete sequence 86471-86504 10 0.706
NZ_CP047242_5 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2526480-2526513 34 NZ_KU744946 Acinetobacter baumannii strain A297 (RUH875) plasmid pA297-3 clone Global clone 1 (GC1), complete sequence 155717-155750 10 0.706
NZ_CP047242_5 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2526480-2526513 34 NZ_CP022285 Acinetobacter baumannii strain 7804 plasmid pAba7804b, complete sequence 155288-155321 10 0.706
NZ_CP047242_5 5.29|2527059|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2527059-2527092 34 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 568491-568524 10 0.706
NZ_CP047242_5 5.34|2527413|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2527413-2527446 34 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 568491-568524 10 0.706
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP045758 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669, complete sequence 18497-18528 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP047309 Citrobacter freundii strain L75 plasmid pCf76, complete sequence 61513-61544 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP037736 Citrobacter freundii strain CAV1857 plasmid pCAV1857-105, complete sequence 46674-46705 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP045760 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000661 plasmid pCFSAN000661, complete sequence 43514-43545 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP019187 Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 plasmid pATCC10729_01, complete sequence 27987-28018 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_LS992176 Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 2, complete sequence 89718-89749 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP045755 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid p1CFSAN000752, complete sequence 13053-13084 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NC_021871 Salmonella bongori N268-08 plasmid RM1, complete sequence 14059-14090 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP039470 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001112 plasmid pCFSAN001112, complete sequence 78103-78134 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP039485 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000952 plasmid pCFSAN000952, complete sequence 58142-58173 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP039494 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669_1, complete sequence 5705-5736 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP039466 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001118 plasmid pCFSAN001118, complete sequence 13220-13251 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP039468 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001115 plasmid pCFSAN001115, complete sequence 5705-5736 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP030210 Salmonella enterica strain SA20044414 plasmid pSA20044414.1, complete sequence 80388-80419 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NC_019125 Salmonella enterica subsp. salamae plasmid pSGSC3045-121, complete sequence 99291-99322 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP022156 Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence 102108-102139 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP046347 Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence 113151-113182 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP039464 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001140 plasmid pCFSAN001140, complete sequence 23696-23727 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP039472 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000970 plasmid pCFSAN000970, complete sequence 23696-23727 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP039474 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 plasmid pCFSAN000968_1, complete sequence 20860-20891 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP039492 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000700 plasmid pCFSAN000700, complete sequence 5705-5736 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP011595 Klebsiella oxytoca strain CAV1099 plasmid pKPC_CAV1099, complete sequence 9364-9395 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP011654 Citrobacter freundii strain CAV1741 plasmid pCAV1741-101, complete sequence 62891-62922 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP011610 Citrobacter freundii strain CAV1321 plasmid pCAV1321-135, complete sequence 107147-107178 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP039483 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000954 plasmid pCFSAN000954, complete sequence 5705-5736 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP039479 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000960 plasmid pCFSAN000960, complete sequence 40564-40595 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 CP039501 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000189 plasmid pCFSAN000189, complete sequence 72529-72560 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP034178 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000189 plasmid unnamed, complete sequence 16083-16114 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP039481 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000958 plasmid pCFSAN000958, complete sequence 5705-5736 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP039488 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000753 plasmid pCFSAN000753, complete sequence 40737-40768 10 0.688
NZ_CP047242_8 8.2|2913224|32|NZ_CP047242|PILER-CR 2913224-2913255 32 NZ_CP044100 Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence 115899-115930 10 0.688
NZ_CP047242_11 11.25|3674574|33|NZ_CP047242|CRISPRCasFinder,CRT 3674574-3674606 33 NZ_CP032092 Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed2, complete sequence 242601-242633 10 0.697
NZ_CP047242_11 11.25|3674574|33|NZ_CP047242|CRISPRCasFinder,CRT 3674574-3674606 33 NZ_CP040096 Pantoea sp. SO10 plasmid unnamed1, complete sequence 462462-462494 10 0.697
NZ_CP047242_11 11.67|3674575|33|NZ_CP047242|PILER-CR 3674575-3674607 33 NZ_CP032092 Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed2, complete sequence 242601-242633 10 0.697
NZ_CP047242_11 11.67|3674575|33|NZ_CP047242|PILER-CR 3674575-3674607 33 NZ_CP040096 Pantoea sp. SO10 plasmid unnamed1, complete sequence 462462-462494 10 0.697
NZ_CP047242_18 18.31|6136017|33|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 6136017-6136049 33 NZ_CP034112 Staphylococcus epidermidis strain CDC120 plasmid pSTA491, complete sequence 32065-32097 10 0.697
NZ_CP047242_2 2.16|163139|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 163139-163172 34 NC_010370 Laribacter hongkongensis plasmid pHLHK22, complete sequence 10312-10345 11 0.676
NZ_CP047242_2 2.16|163139|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 163139-163172 34 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 141147-141180 11 0.676
NZ_CP047242_3 3.18|699948|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 699948-699981 34 NC_031042 Salmonella phage NR01, complete genome 71992-72025 11 0.676
NZ_CP047242_3 3.27|700587|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 700587-700620 34 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 1016607-1016640 11 0.676
NZ_CP047242_11 11.7|3673282|34|NZ_CP047242|CRISPRCasFinder,CRT 3673282-3673315 34 NZ_CP046704 Nostoc sp. ATCC 53789 plasmid pNsp_a, complete sequence 108688-108721 11 0.676
NZ_CP047242_11 11.38|3675501|32|NZ_CP047242|CRISPRCasFinder,CRT 3675501-3675532 32 NZ_CP015111 Acinetobacter sp. TGL-Y2 plasmid unnamed1, complete sequence 210532-210563 11 0.656
NZ_CP047242_11 11.49|3673283|34|NZ_CP047242|PILER-CR 3673283-3673316 34 NZ_CP046704 Nostoc sp. ATCC 53789 plasmid pNsp_a, complete sequence 108688-108721 11 0.676
NZ_CP047242_11 11.80|3675502|32|NZ_CP047242|PILER-CR 3675502-3675533 32 NZ_CP015111 Acinetobacter sp. TGL-Y2 plasmid unnamed1, complete sequence 210532-210563 11 0.656
NZ_CP047242_2 2.27|163927|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT 163927-163960 34 MK448719 Streptococcus phage Javan255, complete genome 30912-30945 12 0.647
NZ_CP047242_5 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR 2525466-2525499 34 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 607842-607875 12 0.647

1. spacer 18.27|6135725|36|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to KU234532 (Nostoc phage N1, complete genome) position: , mismatch: 1, identity: 0.972

caggtatagaaacacctgtagtataggttttactag	CRISPR spacer
caggtatagaaacacctgtagtataggttttgctag	Protospacer
*******************************.****

2. spacer 18.29|6135873|36|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to KU234532 (Nostoc phage N1, complete genome) position: , mismatch: 1, identity: 0.972

acctaaagaagctttaaacgagattgtgaaaaaata	CRISPR spacer
gcctaaagaagctttaaacgagattgtgaaaaaata	Protospacer
.***********************************

3. spacer 14.1|5542624|25|NZ_CP047242|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 3, identity: 0.88

gggtgaagacgcgattcatcgcgtc	CRISPR spacer
agctgaagacgggattcatcgcgtc	Protospacer
.* ******** *************

4. spacer 5.32|2527273|32|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026685 (Nostoc sp. 'Peltigera membranacea cyanobiont' N6 plasmid pNPM3, complete sequence) position: , mismatch: 5, identity: 0.844

agcgcctctgaggttagcgcttctgaggttag	CRISPR spacer
tacccctctgaggttagccctactgaggttag	Protospacer
 .* ************** ** **********

5. spacer 5.32|2527273|32|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NC_009933 (Acaryochloris marina MBIC11017 plasmid pREB8, complete sequence) position: , mismatch: 6, identity: 0.812

agcgcctctgaggttagcgcttctgaggttag	CRISPR spacer
ggcgaagctgaggttggcgctgctgaggttag	Protospacer
.***   ********.***** **********

6. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to KT895374 (Bacillus phage vB_BpuM-BpSp, complete genome) position: , mismatch: 7, identity: 0.794

caataattattagtattatttccattttcctcct	CRISPR spacer
tcataattattaatattatttccatatttttctt	Protospacer
. **********.************ **..**.*

7. spacer 5.32|2527273|32|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NC_009933 (Acaryochloris marina MBIC11017 plasmid pREB8, complete sequence) position: , mismatch: 7, identity: 0.781

agcgcctctgaggttagcgcttctgaggttag	CRISPR spacer
ggcgaagctgaggttggcgctgctgaggttgg	Protospacer
.***   ********.***** ********.*

8. spacer 13.1|4002983|30|NZ_CP047242|PILER-CR matches to NC_015223 (Nitrosomonas sp. AL212 plasmid pNAL21201, complete sequence) position: , mismatch: 7, identity: 0.767

cttcacacattgccaaagacaatagacgta	CRISPR spacer
cttcactcattgccaaagactatatcggcg	Protospacer
****** ************* ***   *..

9. spacer 13.3|4002982|33|NZ_CP047242|CRT matches to NC_015223 (Nitrosomonas sp. AL212 plasmid pNAL21201, complete sequence) position: , mismatch: 7, identity: 0.788

gcttcacacattgccaaagacaatagacgtagc	CRISPR spacer
gcttcactcattgccaaagactatatcggcggc	Protospacer
******* ************* ***   *..**

10. spacer 13.6|4002982|34|NZ_CP047242|CRISPRCasFinder matches to NC_015223 (Nitrosomonas sp. AL212 plasmid pNAL21201, complete sequence) position: , mismatch: 7, identity: 0.794

gcttcacacattgccaaagacaatagacgtagca	CRISPR spacer
gcttcactcattgccaaagactatatcggcggca	Protospacer
******* ************* ***   *..***

11. spacer 2.16|163139|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.765

cggcggcgctgcggctggtggcgtactcacagat---	CRISPR spacer
cggaggcgctgcggctggtcgcgtac---cgggcccg	Protospacer
*** *************** ******   *.*..   

12. spacer 2.16|163139|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.765

cggcggcgctgcggctggtggcgtactcacagat---	CRISPR spacer
cggaggcgctgcggctggtcgcgtac---cgggcccg	Protospacer
*** *************** ******   *.*..   

13. spacer 2.16|163139|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030830 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750c, complete sequence) position: , mismatch: 8, identity: 0.765

cggcggcgctgcggctggtggcgt--actcacagat	CRISPR spacer
cggcggcactgcggccggtggcgtcaatcgtcag--	Protospacer
*******.*******.********  *..  ***  

14. spacer 2.19|163352|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046662 (Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence) position: , mismatch: 8, identity: 0.765

attttaaaatcggtgcaaccggagttcggctcaa--	CRISPR spacer
tttttaaaatcagttcaaccggagtct--ctaaagg	Protospacer
 **********.** **********..  ** **  

15. spacer 3.11|699455|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to CP033563 (Acinetobacter nosocomialis strain 2010S01-197 plasmid p2010S01-197-2, complete sequence) position: , mismatch: 8, identity: 0.765

actattctctgccgctaaatcaaaaacagagcta	CRISPR spacer
tgcattctcagccgctaaatcaaaatcagcaata	Protospacer
  .****** *************** *** . **

16. spacer 5.16|2526120|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 8, identity: 0.765

agactagtcccggcaaagtggcgg-aaacaggaac	CRISPR spacer
ccgctagtcccggcaaacaggcggaaaacaccaa-	Protospacer
  .**************  ***** *****  ** 

17. spacer 5.25|2526775|33|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN694789 (Marine virus AFVG_250M565, complete genome) position: , mismatch: 8, identity: 0.758

caggaattgcaaaatcttcaggttcattagtga	CRISPR spacer
tagttgctgcaaaatcttgagggtcattagtgt	Protospacer
.**  ..*********** *** ********* 

18. spacer 11.25|3674574|33|NZ_CP047242|CRISPRCasFinder,CRT matches to MN693370 (Marine virus AFVG_25M236, complete genome) position: , mismatch: 8, identity: 0.758

ctctaattaagttcatttttaattaaaatactc	CRISPR spacer
tatgtattaatttcattttaaattaaaatacgc	Protospacer
. .  ***** ******** *********** *

19. spacer 11.67|3674575|33|NZ_CP047242|PILER-CR matches to MN693370 (Marine virus AFVG_25M236, complete genome) position: , mismatch: 8, identity: 0.758

ctctaattaagttcatttttaattaaaatactc	CRISPR spacer
tatgtattaatttcattttaaattaaaatacgc	Protospacer
. .  ***** ******** *********** *

20. spacer 13.5|4003125|32|NZ_CP047242|CRT matches to MW057855 (Providencia phage PSTCR3, complete genome) position: , mismatch: 8, identity: 0.75

-gtgttactccttaaatctggatttaagccaca	CRISPR spacer
tacgtt-tgccctaaatgtggatttaagccact	Protospacer
 ..*** . **.***** ************** 

21. spacer 18.14|6134790|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to MN694598 (Marine virus AFVG_250M666, complete genome) position: , mismatch: 8, identity: 0.765

aacgaccc--agataaagccagcacaacaaccgcat	CRISPR spacer
--ccactcgtaggtaaagccagcacaaccaccgccc	Protospacer
  * **.*  **.*************** ***** .

22. spacer 18.14|6134790|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to MN693877 (Marine virus AFVG_250M566, complete genome) position: , mismatch: 8, identity: 0.765

aacgaccc--agataaagccagcacaacaaccgcat	CRISPR spacer
--ccactcgtaggtaaagccagcacaaccaccgccc	Protospacer
  * **.*  **.*************** ***** .

23. spacer 18.14|6134790|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to MN694162 (Marine virus AFVG_250M665, complete genome) position: , mismatch: 8, identity: 0.765

aacgaccc--agataaagccagcacaacaaccgcat	CRISPR spacer
--ccactcgtaggtaaagccagcacaaccaccgccc	Protospacer
  * **.*  **.*************** ***** .

24. spacer 18.14|6134790|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to MN693718 (Marine virus AFVG_250M664, complete genome) position: , mismatch: 8, identity: 0.765

aacgaccc--agataaagccagcacaacaaccgcat	CRISPR spacer
--ccactcgtaggtaaagccagcacaaccaccgccc	Protospacer
  * **.*  **.*************** ***** .

25. spacer 18.24|6135509|31|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to NC_014389 (Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence) position: , mismatch: 8, identity: 0.742

ctccaaggtgtatactatcaagtatttttag	CRISPR spacer
aacgttgttgtatattatcaagtatttttac	Protospacer
  *   * ******.*************** 

26. spacer 18.24|6135509|31|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR217721 (Candidatus Erwinia haradaeae strain ErCilaricifoliae isolate 3058 plasmid pBioThi) position: , mismatch: 8, identity: 0.742

ctccaaggtgtatactatcaagtatttttag	CRISPR spacer
ttgaaaggtgcatacgatcaagtatttccat	Protospacer
.*  ******.**** ***********..* 

27. spacer 2.16|163139|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.735

cggcggcgctgcggctggtggcgtactcacagat	CRISPR spacer
cggcggcggtgccgctggtggcgttgggaccggc	Protospacer
******** *** ***********    ** *..

28. spacer 2.16|163139|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.735

cggcggcgctgcggctggtggcgtactcacagat	CRISPR spacer
cggcggcggtgccgctggtggcgttgggaccggc	Protospacer
******** *** ***********    ** *..

29. spacer 2.25|163785|33|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

aaaagaaatttagcgacttctgcattctgttcg	CRISPR spacer
tggagaagtttagcgacttctgcaatcgcttta	Protospacer
 ..****.**************** **  **..

30. spacer 2.25|163785|33|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727

aaaagaaatttagcgacttctgcattctgttcg	CRISPR spacer
tggagaagtttagcgacttctgcaatcgcttta	Protospacer
 ..****.**************** **  **..

31. spacer 3.14|699668|33|NZ_CP047242|CRISPRCasFinder,CRT matches to NZ_CP017587 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ06, complete sequence) position: , mismatch: 9, identity: 0.727

gcacctgagatgacgcaagcagcaaaggcaagc	CRISPR spacer
gaggcagagatgtcgcaagcagcaaatgcagca	Protospacer
* . * ****** ************* ***.  

32. spacer 5.4|2525248|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to KX507046 (Vibrio phage S4-7, complete genome) position: , mismatch: 9, identity: 0.735

ctaacatcgccctagctaaaccaattaaattcaa	CRISPR spacer
acttcaacttcctagctaaaccatttaaattgaa	Protospacer
 .  ** * .************* ******* **

33. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY120365 (Salmonella enterica subsp. enterica serovar Typhimurium strain P111 plasmid pP111, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

34. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY075661 (Escherichia coli strain GD65 plasmid pGD65-3, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

35. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY693674 (Escherichia coli strain OM97 plasmid pOM97-mcr, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

36. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY075654 (Escherichia coli strain Lishui142 plasmid pLishui142-1, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

37. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU934209 (Salmonella enterica strain SC23 plasmid pSCS23, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

38. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY012274 (Escherichia coli strain 20COE13 plasmid pEc_20COE13, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

39. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX013539 (Escherichia coli strain BA77 plasmid pBA77-MCR-1, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

40. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX084393 (Escherichia coli strain 61 plasmid pECJS-61-63, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

41. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU922754 (Kluyvera ascorbata strain WCH1410 plasmid pMCR_1410, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

42. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX254342 (Escherichia coli strain JS-61 plasmid pECJS-61-63, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

43. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032990 (Escherichia coli strain W2-5 plasmid pMCR_W2-5, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

44. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to CP043014 (Escherichia coli strain 388755_gen plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

45. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011294 (Salmonella enterica subsp. diarizonae strain 11-01854 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

46. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011291 (Salmonella enterica subsp. diarizonae strain 11-01853 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

47. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010220 (Escherichia coli strain M18 plasmid A, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

48. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020548 (Escherichia coli strain ZJ3920 plasmid pZJ3920-3, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

49. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019254 (Escherichia coli strain 13KWH46 plasmid p13KWH46-4, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

50. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019277 (Escherichia coli strain 13P477T plasmid p13P477T-4, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

51. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MK574667 (Escherichia coli strain DRC-3 plasmid pDRC-3, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

52. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MK574668 (Escherichia coli strain HAB-6 plasmid pHAB-6, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

53. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MK574669 (Escherichia coli strain LSECO-1 plasmid pLSECO-1, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

54. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029184 (Escherichia coli strain H9Ecoli plasmid pMCR-H9, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

55. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232179 (Escherichia coli plasmid pAH59-106, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

56. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232180 (Escherichia coli plasmid pAH59-40, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

57. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232182 (Escherichia coli plasmid pAH59-57, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

58. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232183 (Escherichia coli plasmid pAH59-58, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

59. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232184 (Escherichia coli plasmid pAH81-109, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

60. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232185 (Escherichia coli plasmid pAH81-113, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

61. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232186 (Escherichia coli plasmid pAH81-39, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

62. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232188 (Escherichia coli plasmid pGD16-3, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

63. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232196 (Escherichia coli plasmid pHLJ109-11, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

64. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232198 (Escherichia coli plasmid pHLJ109-25, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

65. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232199 (Escherichia coli plasmid pHLJ109-28, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

66. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232200 (Escherichia coli plasmid pHLJ109-34, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

67. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232201 (Escherichia coli plasmid pHLJ109-70, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

68. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232203 (Escherichia coli plasmid pHLJ109-92, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

69. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232204 (Escherichia coli plasmid pHLJ111-101, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

70. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232205 (Escherichia coli plasmid pHLJ111-18, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

71. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232206 (Escherichia coli plasmid pHLJ111-20, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

72. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232207 (Escherichia coli plasmid pHLJ111-3, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

73. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232208 (Escherichia coli plasmid pHLJ111-5, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

74. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232210 (Escherichia coli plasmid pHLJ179-141, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

75. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232211 (Escherichia coli plasmid pHLJ179-167, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

76. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232212 (Escherichia fergusonii plasmid pHLJ179-32, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

77. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN232213 (Escherichia coli plasmid pHLJ179-34, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

78. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049356 (Escherichia coli strain T28R plasmid pT28R-3, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

79. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to CP019690 (Shigella sonnei strain 75/02 plasmid p75-02_2, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

80. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to LC511662 (Escherichia coli 2018-10-2CC plasmid p2018-10-2CC DNA, complete genome) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

81. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021176 (Escherichia coli strain 5CRE51 plasmid p5CRE51-MCR-1, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

82. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045521 (Salmonella enterica subsp. enterica serovar Anatum strain Sal-5091 plasmid pSal-5091_MCR64k, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

83. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024156 (Escherichia coli strain 14EC047 plasmid p14EC047a, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

84. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022452 (Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-2, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

85. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024148 (Escherichia coli strain 14EC033 plasmid p14EC033a, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

86. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033355 (Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-3, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

87. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024142 (Escherichia coli strain 14EC029 plasmid p14EC029a, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

88. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047579 (Escherichia coli strain 94EC plasmid p94EC-3, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

89. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN746292 (Escherichia coli strain GN2984 plasmid p778, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

90. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015913 (Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy1, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

91. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033254 (Salmonella enterica subsp. enterica strain CFSA244 plasmid pCFSA244-2, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

92. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to KY657478 (Escherichia coli plasmid pUSU-ECO-12704_4, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

93. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016187 (Escherichia coli strain S2.14 plasmid pS2.14-2, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

94. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to KY657476 (Escherichia coli plasmid pCREC-527_4, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

95. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016186 (Escherichia coli strain EC13 plasmid pEC13-1, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

96. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016185 (Escherichia coli strain EC5 plasmid pEC5-1, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

97. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MH176237 (Escherichia coli plasmid pmcr-JLF4, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

98. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024139 (Escherichia coli strain 14EC020 plasmid p14EC020a, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

99. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK571810 (Escherichia coli strain PK411 plasmid pPK411, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

100. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MN689940 (Escherichia coli strain LWY24J plasmid pLWY24J-mcr-1.1, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

101. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053083 (Escherichia coli strain HB37 plasmid pHB37-3, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

102. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH202956 (Escherichia coli strain HXH-5 plasmid pHXH-5, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

103. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH522412 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH13G1582 plasmid pSH13G1582, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

104. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF978388 (Escherichia coli strain GDT6F93 plasmid pHNGDF93, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

105. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF175188 (Escherichia coli strain ColR644SK1 plasmid pColR644SK1, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

106. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG808035 (Escherichia coli strain PK105 plasmid pPK105, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

107. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG825374 (Escherichia coli strain 1106 plasmid p1106-IncI2, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

108. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF175189 (Escherichia coli strain ColR598 plasmid pColR598_2, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

109. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG825380 (Escherichia coli strain 1108 plasmid p1108-MCR, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

110. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG594800 (Escherichia coli isolate 1724 plasmid p1724, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

111. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG598816 (Escherichia coli isolate 979 plasmid p979, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

112. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY829117 (Escherichia coli strain WCHEC050604 plasmid pMCR_WCHEC1604-IncI2, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

113. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY792081 (Escherichia coli strain EC-MCR1.8 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

114. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY795978 (Escherichia coli strain JIE3685 plasmid pJIE3685-1, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

115. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF521836 (Escherichia coli str. K-12 substr. MG1655 strain K-12 plasmid TP114, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

116. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG747472 (Klebsiella pneumoniae strain 09-20 plasmid pK09-20-mcr-1, complete sequence) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ttttccttattactattatttccatattccttat	Protospacer
.  *  ****** ************ *****. *

117. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN692959 (Marine virus AFVG_117M52, complete genome) position: , mismatch: 9, identity: 0.735

caataattattagtattatttccattttcctcct	CRISPR spacer
ccataaatattagtattgtttccattactattat	Protospacer
* **** **********.******** .. *. *

118. spacer 5.8|2525537|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MN994503 (Phage NBSal004, complete genome) position: , mismatch: 9, identity: 0.735

cagtacaagatgctaatacaattactattcaaaa	CRISPR spacer
ttaaaaagaatgctaatgctattactattcaaaa	Protospacer
. . * *..********.* **************

119. spacer 5.28|2526988|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014128 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.735

cattaaaa--ttcaaaaactaggtgcagacgatcgc	CRISPR spacer
--tcgagattttcaaaaagcaggtgcagacgatcat	Protospacer
  *..*.*  ******** .**************..

120. spacer 5.33|2527342|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014128 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.735

cattaaaa--ttcaaaaactaggtgcagacgatcgc	CRISPR spacer
--tcgagattttcaaaaagcaggtgcagacgatcat	Protospacer
  *..*.*  ******** .**************..

121. spacer 11.25|3674574|33|NZ_CP047242|CRISPRCasFinder,CRT matches to NC_007390 (Spiroplasma citri pSci4 plasmid) position: , mismatch: 9, identity: 0.727

ctctaattaagttcatttttaattaaaatactc	CRISPR spacer
ataaaattaattttatttttaattaaaattaat	Protospacer
 *  ****** **.***************   .

122. spacer 11.25|3674574|33|NZ_CP047242|CRISPRCasFinder,CRT matches to NC_028924 (Polaribacter phage P12002L, complete genome) position: , mismatch: 9, identity: 0.727

ctctaattaagttcatttttaattaaaatactc	CRISPR spacer
ggataattaagttattttttaattaaatttcaa	Protospacer
   **********  ************ * *  

123. spacer 11.25|3674574|33|NZ_CP047242|CRISPRCasFinder,CRT matches to NC_028763 (Polaribacter phage P12002S, complete genome) position: , mismatch: 9, identity: 0.727

ctctaattaagttcatttttaattaaaatactc	CRISPR spacer
ggataattaagttattttttaattaaatttcaa	Protospacer
   **********  ************ * *  

124. spacer 11.67|3674575|33|NZ_CP047242|PILER-CR matches to NC_007390 (Spiroplasma citri pSci4 plasmid) position: , mismatch: 9, identity: 0.727

ctctaattaagttcatttttaattaaaatactc	CRISPR spacer
ataaaattaattttatttttaattaaaattaat	Protospacer
 *  ****** **.***************   .

125. spacer 11.67|3674575|33|NZ_CP047242|PILER-CR matches to NC_028924 (Polaribacter phage P12002L, complete genome) position: , mismatch: 9, identity: 0.727

ctctaattaagttcatttttaattaaaatactc	CRISPR spacer
ggataattaagttattttttaattaaatttcaa	Protospacer
   **********  ************ * *  

126. spacer 11.67|3674575|33|NZ_CP047242|PILER-CR matches to NC_028763 (Polaribacter phage P12002S, complete genome) position: , mismatch: 9, identity: 0.727

ctctaattaagttcatttttaattaaaatactc	CRISPR spacer
ggataattaagttattttttaattaaatttcaa	Protospacer
   **********  ************ * *  

127. spacer 18.1|6133842|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to NC_003267 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120gamma, complete sequence) position: , mismatch: 9, identity: 0.735

---ttgtgcgtcttttaagtgggggatataagcgaat	CRISPR spacer
cccccgta---tttttaatcgggggatataagcgaat	Protospacer
   ..**.   .****** .*****************

128. spacer 18.1|6133842|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to NC_003276 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence) position: , mismatch: 9, identity: 0.735

---ttgtgcgtcttttaagtgggggatataagcgaat	CRISPR spacer
cccccgta---tttttaatcgggggatataagcgaat	Protospacer
   ..**.   .****** .*****************

129. spacer 18.1|6133842|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to NC_003276 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence) position: , mismatch: 9, identity: 0.735

---ttgtgcgtcttttaagtgggggatataagcgaat	CRISPR spacer
cccccgta---tttttaatcgggggatataagcgaat	Protospacer
   ..**.   .****** .*****************

130. spacer 18.1|6133842|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to KU234533 (Nostoc phage A1, complete genome) position: , mismatch: 9, identity: 0.735

---ttgtgcgtcttttaagtgggggatataagcgaat	CRISPR spacer
cccccgta---tttttaatcgggggatataagcgaat	Protospacer
   ..**.   .****** .*****************

131. spacer 3.27|700587|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 10, identity: 0.706

ctagcgatcgccgccgcctttaccccttctaaat---	CRISPR spacer
tggacgatttccgccgcctttaccccttt---atcca	Protospacer
. ..****. ******************.   **   

132. spacer 5.8|2525537|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MG251392 (Salmonella virus VSe102, complete genome) position: , mismatch: 10, identity: 0.706

cagtacaagatgctaatacaattactattcaaaa	CRISPR spacer
ttaagaagaatgctaatgctattactattcaaaa	Protospacer
. . . *..********.* **************

133. spacer 5.8|2525537|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MG251391 (Salmonella virus VSe11, complete genome) position: , mismatch: 10, identity: 0.706

cagtacaagatgctaatacaattactattcaaaa	CRISPR spacer
ttaagaagaatgctaatgctattactattcaaaa	Protospacer
. . . *..********.* **************

134. spacer 5.8|2525537|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to LR597658 (Escherichia phage VpaE1_ev108 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.706

cagtacaagatgctaatacaattactattcaaaa	CRISPR spacer
ttaagaagaatgctaatgctattactattcaaaa	Protospacer
. . . *..********.* **************

135. spacer 5.8|2525537|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to CP031020 (Lactobacillus helveticus isolate NWC_2_4 plasmid pNWC_2_4, complete sequence) position: , mismatch: 10, identity: 0.706

cagtacaagatgctaatacaattactattcaaaa	CRISPR spacer
tgaaacaagatgctaaaaccattactatgaacat	Protospacer
... ************ ** ********  * * 

136. spacer 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MF399199 (Acinetobacter baumannii strain D46 plasmid pD46-4, complete sequence) position: , mismatch: 10, identity: 0.706

aattattttcttgattggctgctgtatggctttg	CRISPR spacer
acctatgttcttgatgggctgctgtatcacgagt	Protospacer
* .*** ******** *********** .*    

137. spacer 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040051 (Acinetobacter baumannii strain VB16141 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

aattattttcttgattggctgctgtatggctttg	CRISPR spacer
acctatgttcttgatgggctgctgtatcacgagt	Protospacer
* .*** ******** *********** .*    

138. spacer 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014650 (Acinetobacter baumannii strain IOMTU433 plasmid pIOMTU433, complete sequence) position: , mismatch: 10, identity: 0.706

aattattttcttgattggctgctgtatggctttg	CRISPR spacer
acctatgttcttgatgggctgctgtatcacgagt	Protospacer
* .*** ******** *********** .*    

139. spacer 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to MK531536 (Acinetobacter baumannii strain MC1 plasmid pMC1.1, complete sequence) position: , mismatch: 10, identity: 0.706

aattattttcttgattggctgctgtatggctttg	CRISPR spacer
acctatgttcttgatgggctgctgtatcacgagt	Protospacer
* .*** ******** *********** .*    

140. spacer 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP019743 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA3, complete sequence) position: , mismatch: 10, identity: 0.706

aattattttcttgattggctgctgtatggctttg	CRISPR spacer
acctatgttcttgatgggctgctgtatcacgagt	Protospacer
* .*** ******** *********** .*    

141. spacer 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to CP040054 (Acinetobacter baumannii strain VB35179 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

aattattttcttgattggctgctgtatggctttg	CRISPR spacer
acctatgttcttgatgggctgctgtatcacgagt	Protospacer
* .*** ******** *********** .*    

142. spacer 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050433 (Acinetobacter baumannii strain PM194229 plasmid pPM194229_1, complete sequence) position: , mismatch: 10, identity: 0.706

aattattttcttgattggctgctgtatggctttg	CRISPR spacer
acctatgttcttgatgggctgctgtatcacgagt	Protospacer
* .*** ******** *********** .*    

143. spacer 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038025 (Acinetobacter radioresistens strain DD78 plasmid pAR3, complete sequence) position: , mismatch: 10, identity: 0.706

aattattttcttgattggctgctgtatggctttg	CRISPR spacer
acctatgttcttgatgggctgctgtatcacgagt	Protospacer
* .*** ******** *********** .*    

144. spacer 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038025 (Acinetobacter radioresistens strain DD78 plasmid pAR3, complete sequence) position: , mismatch: 10, identity: 0.706

aattattttcttgattggctgctgtatggctttg	CRISPR spacer
acctatgttcttgatgggctgctgtatcacgagt	Protospacer
* .*** ******** *********** .*    

145. spacer 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014652 (Acinetobacter sp. DUT-2 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

aattattttcttgattggctgctgtatggctttg	CRISPR spacer
acctatgttcttgatgggctgctgtatcacgagt	Protospacer
* .*** ******** *********** .*    

146. spacer 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU744946 (Acinetobacter baumannii strain A297 (RUH875) plasmid pA297-3 clone Global clone 1 (GC1), complete sequence) position: , mismatch: 10, identity: 0.706

aattattttcttgattggctgctgtatggctttg	CRISPR spacer
acctatgttcttgatgggctgctgtatcacgagt	Protospacer
* .*** ******** *********** .*    

147. spacer 5.21|2526480|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022285 (Acinetobacter baumannii strain 7804 plasmid pAba7804b, complete sequence) position: , mismatch: 10, identity: 0.706

aattattttcttgattggctgctgtatggctttg	CRISPR spacer
acctatgttcttgatgggctgctgtatcacgagt	Protospacer
* .*** ******** *********** .*    

148. spacer 5.29|2527059|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

cagaaaaaagatagaagccgatttgcgggaagac	CRISPR spacer
ggctcggcagataaaagacgatttgcgggaagac	Protospacer
 .   .. *****.*** ****************

149. spacer 5.34|2527413|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

cagaaaaaagatagaagccgatttgcgggaagac	CRISPR spacer
ggctcggcagataaaagacgatttgcgggaagac	Protospacer
 .   .. *****.*** ****************

150. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP045758 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

151. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP047309 (Citrobacter freundii strain L75 plasmid pCf76, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

152. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP037736 (Citrobacter freundii strain CAV1857 plasmid pCAV1857-105, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

153. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP045760 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000661 plasmid pCFSAN000661, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

154. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP019187 (Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 plasmid pATCC10729_01, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

155. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_LS992176 (Citrobacter freundii isolate Citrobacter freundii str. E2614 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

156. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP045755 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid p1CFSAN000752, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

157. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NC_021871 (Salmonella bongori N268-08 plasmid RM1, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

158. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP039470 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001112 plasmid pCFSAN001112, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

159. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP039485 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000952 plasmid pCFSAN000952, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

160. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP039494 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669_1, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

161. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP039466 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001118 plasmid pCFSAN001118, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

162. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP039468 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001115 plasmid pCFSAN001115, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

163. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP030210 (Salmonella enterica strain SA20044414 plasmid pSA20044414.1, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

164. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NC_019125 (Salmonella enterica subsp. salamae plasmid pSGSC3045-121, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

165. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

166. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

167. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP039464 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001140 plasmid pCFSAN001140, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

168. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP039472 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000970 plasmid pCFSAN000970, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

169. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP039474 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 plasmid pCFSAN000968_1, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

170. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP039492 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000700 plasmid pCFSAN000700, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

171. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP011595 (Klebsiella oxytoca strain CAV1099 plasmid pKPC_CAV1099, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

172. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP011654 (Citrobacter freundii strain CAV1741 plasmid pCAV1741-101, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

173. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP011610 (Citrobacter freundii strain CAV1321 plasmid pCAV1321-135, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

174. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP039483 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000954 plasmid pCFSAN000954, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

175. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP039479 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000960 plasmid pCFSAN000960, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

176. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to CP039501 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000189 plasmid pCFSAN000189, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

177. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP034178 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000189 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

178. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP039481 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000958 plasmid pCFSAN000958, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

179. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP039488 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000753 plasmid pCFSAN000753, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

180. spacer 8.2|2913224|32|NZ_CP047242|PILER-CR matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ccaacttatctagaatggatgcagcctttcaa	CRISPR spacer
taaacttatccagaatgtatgcagcatccttt	Protospacer
. ********.****** ******* *...  

181. spacer 11.25|3674574|33|NZ_CP047242|CRISPRCasFinder,CRT matches to NZ_CP032092 (Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697

ctctaattaagttcatttttaattaaaatactc	CRISPR spacer
aacatattaagtttgtttttaattaaaatttcg	Protospacer
  *  ********..************** .. 

182. spacer 11.25|3674574|33|NZ_CP047242|CRISPRCasFinder,CRT matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

ctctaattaagttcatttttaattaaaatactc	CRISPR spacer
gcttaaataagtttatttttaattaaagacagc	Protospacer
 ..*** ******.*************.    *

183. spacer 11.67|3674575|33|NZ_CP047242|PILER-CR matches to NZ_CP032092 (Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697

ctctaattaagttcatttttaattaaaatactc	CRISPR spacer
aacatattaagtttgtttttaattaaaatttcg	Protospacer
  *  ********..************** .. 

184. spacer 11.67|3674575|33|NZ_CP047242|PILER-CR matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

ctctaattaagttcatttttaattaaaatactc	CRISPR spacer
gcttaaataagtttatttttaattaaagacagc	Protospacer
 ..*** ******.*************.    *

185. spacer 18.31|6136017|33|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034112 (Staphylococcus epidermidis strain CDC120 plasmid pSTA491, complete sequence) position: , mismatch: 10, identity: 0.697

aagttttccatttaagtgctaaagcaataacaa	CRISPR spacer
atagcaataatttaagtgttaaagcaattacaa	Protospacer
* . .  . *********.********* ****

186. spacer 2.16|163139|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to NC_010370 (Laribacter hongkongensis plasmid pHLHK22, complete sequence) position: , mismatch: 11, identity: 0.676

cggcggcgctgcggctggtggcgtactcacagat	CRISPR spacer
gggaggcgttgcggctggtggcgtagcgctggcg	Protospacer
 ** ****.**************** .  ..*  

187. spacer 2.16|163139|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 11, identity: 0.676

cggcggcgctgcggctggtggcgtactcacagat	CRISPR spacer
agttcacgctgcggctgatcgcgtactcacgcgg	Protospacer
 * . .***********.* **********. . 

188. spacer 3.18|699948|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NC_031042 (Salmonella phage NR01, complete genome) position: , mismatch: 11, identity: 0.676

agtggtatctttggcacaatcttcaggattgtcg	CRISPR spacer
ggtggtaactttggcactatcttcactagccaga	Protospacer
.****** ********* *******  * .   .

189. spacer 3.27|700587|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 11, identity: 0.676

ctagcgatcgccgccgcctttaccccttctaaat	CRISPR spacer
gaagcgatcgccgcctccttttccccggaggacg	Protospacer
  ************* ***** ****    .*  

190. spacer 11.7|3673282|34|NZ_CP047242|CRISPRCasFinder,CRT matches to NZ_CP046704 (Nostoc sp. ATCC 53789 plasmid pNsp_a, complete sequence) position: , mismatch: 11, identity: 0.676

taggtcaggatttgttaacaaaatatccgtttcg	CRISPR spacer
agggtgaggatttgttaactaaatatttgccaaa	Protospacer
 .*** ************* ******..*..  .

191. spacer 11.38|3675501|32|NZ_CP047242|CRISPRCasFinder,CRT matches to NZ_CP015111 (Acinetobacter sp. TGL-Y2 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

caactttatatatagttttcacccctaatgat	CRISPR spacer
gccatttatttatagttttaacccctagaata	Protospacer
    ***** ********* *******. .  

192. spacer 11.49|3673283|34|NZ_CP047242|PILER-CR matches to NZ_CP046704 (Nostoc sp. ATCC 53789 plasmid pNsp_a, complete sequence) position: , mismatch: 11, identity: 0.676

taggtcaggatttgttaacaaaatatccgtttcg	CRISPR spacer
agggtgaggatttgttaactaaatatttgccaaa	Protospacer
 .*** ************* ******..*..  .

193. spacer 11.80|3675502|32|NZ_CP047242|PILER-CR matches to NZ_CP015111 (Acinetobacter sp. TGL-Y2 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

caactttatatatagttttcacccctaatgat	CRISPR spacer
gccatttatttatagttttaacccctagaata	Protospacer
    ***** ********* *******. .  

194. spacer 2.27|163927|34|NZ_CP047242|PILER-CR,CRISPRCasFinder,CRT matches to MK448719 (Streptococcus phage Javan255, complete genome) position: , mismatch: 12, identity: 0.647

ggaagcgtcgctaaaactcaagctattttagaaa	CRISPR spacer
attgcgacggctaaagctcaggctattttagaag	Protospacer
.  .  .. ******.****.************.

195. spacer 5.7|2525466|34|NZ_CP047242|CRISPRCasFinder,CRT,PILER-CR matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 12, identity: 0.647

caataattattagtattatttccattttcctcct	CRISPR spacer
tcataattatgaatattatttccattgatgataa	Protospacer
. ******** *.*************  .  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP047244
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047244_1 83503-83614 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047244_1 1.1|83540|38|NZ_CP047244|CRISPRCasFinder 83540-83577 38 NC_007412 Trichormus variabilis ATCC 29413 plasmid C, complete sequence 155971-156008 0 1.0
NZ_CP047244_1 1.1|83540|38|NZ_CP047244|CRISPRCasFinder 83540-83577 38 NZ_CP047244 Trichormus variabilis 0441 plasmid unnamed2, complete sequence 83540-83577 0 1.0

1. spacer 1.1|83540|38|NZ_CP047244|CRISPRCasFinder matches to NC_007412 (Trichormus variabilis ATCC 29413 plasmid C, complete sequence) position: , mismatch: 0, identity: 1.0

gattgagactcagccgttagttgttgaacatactttaa	CRISPR spacer
gattgagactcagccgttagttgttgaacatactttaa	Protospacer
**************************************

2. spacer 1.1|83540|38|NZ_CP047244|CRISPRCasFinder matches to NZ_CP047244 (Trichormus variabilis 0441 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gattgagactcagccgttagttgttgaacatactttaa	CRISPR spacer
gattgagactcagccgttagttgttgaacatactttaa	Protospacer
**************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 113736 : 131767 19 Klosneuvirus(33.33%) protease,transposase,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP047243
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP047243_1 63552-63720 TypeII NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP047243_1 1.1|63576|20|NZ_CP047243|CRISPRCasFinder 63576-63595 20 NC_007410 Trichormus variabilis ATCC 29413 plasmid A, complete sequence 53518-53537 0 1.0
NZ_CP047243_1 1.1|63576|20|NZ_CP047243|CRISPRCasFinder 63576-63595 20 NC_007410 Trichormus variabilis ATCC 29413 plasmid A, complete sequence 53529-53548 0 1.0
NZ_CP047243_1 1.1|63576|20|NZ_CP047243|CRISPRCasFinder 63576-63595 20 NC_007410 Trichormus variabilis ATCC 29413 plasmid A, complete sequence 53540-53559 0 1.0
NZ_CP047243_1 1.1|63576|20|NZ_CP047243|CRISPRCasFinder 63576-63595 20 NC_007410 Trichormus variabilis ATCC 29413 plasmid A, complete sequence 53608-53627 0 1.0
NZ_CP047243_1 1.1|63576|20|NZ_CP047243|CRISPRCasFinder 63576-63595 20 NZ_CP047243 Trichormus variabilis 0441 plasmid unnamed1, complete sequence 63565-63584 0 1.0
NZ_CP047243_1 1.1|63576|20|NZ_CP047243|CRISPRCasFinder 63576-63595 20 NZ_CP047243 Trichormus variabilis 0441 plasmid unnamed1, complete sequence 63576-63595 0 1.0
NZ_CP047243_1 1.1|63576|20|NZ_CP047243|CRISPRCasFinder 63576-63595 20 NZ_CP047243 Trichormus variabilis 0441 plasmid unnamed1, complete sequence 63587-63606 0 1.0
NZ_CP047243_1 1.1|63576|20|NZ_CP047243|CRISPRCasFinder 63576-63595 20 NZ_CP047243 Trichormus variabilis 0441 plasmid unnamed1, complete sequence 63655-63674 0 1.0
NZ_CP047243_1 1.2|63620|33|NZ_CP047243|CRISPRCasFinder 63620-63652 33 NC_007410 Trichormus variabilis ATCC 29413 plasmid A, complete sequence 53573-53605 0 1.0
NZ_CP047243_1 1.2|63620|33|NZ_CP047243|CRISPRCasFinder 63620-63652 33 NZ_CP047243 Trichormus variabilis 0441 plasmid unnamed1, complete sequence 63620-63652 0 1.0
NZ_CP047243_1 1.3|63677|20|NZ_CP047243|CRISPRCasFinder 63677-63696 20 NC_007410 Trichormus variabilis ATCC 29413 plasmid A, complete sequence 53630-53649 0 1.0
NZ_CP047243_1 1.3|63677|20|NZ_CP047243|CRISPRCasFinder 63677-63696 20 NZ_CP047243 Trichormus variabilis 0441 plasmid unnamed1, complete sequence 63677-63696 0 1.0
NZ_CP047243_1 1.2|63620|33|NZ_CP047243|CRISPRCasFinder 63620-63652 33 NZ_CP014276 Martelella sp. AD-3 plasmid unnamed1, complete sequence 182738-182770 9 0.727

1. spacer 1.1|63576|20|NZ_CP047243|CRISPRCasFinder matches to NC_007410 (Trichormus variabilis ATCC 29413 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaacacccccgaaacacc	CRISPR spacer
cgaaacacccccgaaacacc	Protospacer
********************

2. spacer 1.1|63576|20|NZ_CP047243|CRISPRCasFinder matches to NC_007410 (Trichormus variabilis ATCC 29413 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaacacccccgaaacacc	CRISPR spacer
cgaaacacccccgaaacacc	Protospacer
********************

3. spacer 1.1|63576|20|NZ_CP047243|CRISPRCasFinder matches to NC_007410 (Trichormus variabilis ATCC 29413 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaacacccccgaaacacc	CRISPR spacer
cgaaacacccccgaaacacc	Protospacer
********************

4. spacer 1.1|63576|20|NZ_CP047243|CRISPRCasFinder matches to NC_007410 (Trichormus variabilis ATCC 29413 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaacacccccgaaacacc	CRISPR spacer
cgaaacacccccgaaacacc	Protospacer
********************

5. spacer 1.1|63576|20|NZ_CP047243|CRISPRCasFinder matches to NZ_CP047243 (Trichormus variabilis 0441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaacacccccgaaacacc	CRISPR spacer
cgaaacacccccgaaacacc	Protospacer
********************

6. spacer 1.1|63576|20|NZ_CP047243|CRISPRCasFinder matches to NZ_CP047243 (Trichormus variabilis 0441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaacacccccgaaacacc	CRISPR spacer
cgaaacacccccgaaacacc	Protospacer
********************

7. spacer 1.1|63576|20|NZ_CP047243|CRISPRCasFinder matches to NZ_CP047243 (Trichormus variabilis 0441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaacacccccgaaacacc	CRISPR spacer
cgaaacacccccgaaacacc	Protospacer
********************

8. spacer 1.1|63576|20|NZ_CP047243|CRISPRCasFinder matches to NZ_CP047243 (Trichormus variabilis 0441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaacacccccgaaacacc	CRISPR spacer
cgaaacacccccgaaacacc	Protospacer
********************

9. spacer 1.2|63620|33|NZ_CP047243|CRISPRCasFinder matches to NC_007410 (Trichormus variabilis ATCC 29413 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

tggaagttttgggaaagcgtttccaattttgct	CRISPR spacer
tggaagttttgggaaagcgtttccaattttgct	Protospacer
*********************************

10. spacer 1.2|63620|33|NZ_CP047243|CRISPRCasFinder matches to NZ_CP047243 (Trichormus variabilis 0441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggaagttttgggaaagcgtttccaattttgct	CRISPR spacer
tggaagttttgggaaagcgtttccaattttgct	Protospacer
*********************************

11. spacer 1.3|63677|20|NZ_CP047243|CRISPRCasFinder matches to NC_007410 (Trichormus variabilis ATCC 29413 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

tgaagaacccccggttaacc	CRISPR spacer
tgaagaacccccggttaacc	Protospacer
********************

12. spacer 1.3|63677|20|NZ_CP047243|CRISPRCasFinder matches to NZ_CP047243 (Trichormus variabilis 0441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaagaacccccggttaacc	CRISPR spacer
tgaagaacccccggttaacc	Protospacer
********************

13. spacer 1.2|63620|33|NZ_CP047243|CRISPRCasFinder matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

tggaagttttgggaaagcgtttccaattttgct	CRISPR spacer
tggaagtttcgggaaagcgttgccagcgcaccg	Protospacer
*********.*********** ***.. .  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 3178 4 Lake_Baikal_phage(100.0%) protease NA
DBSCAN-SWA_2 22494 : 24357 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_3 106556 : 108507 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_4 119051 : 120726 2 Geobacillus_virus(50.0%) transposase NA
DBSCAN-SWA_5 125940 : 147832 16 Paramecium_bursaria_Chlorella_virus(14.29%) transposase NA
DBSCAN-SWA_6 163942 : 164974 1 Bacillus_phage(100.0%) integrase attL 158057:158069|attR 165101:165113
DBSCAN-SWA_7 177692 : 184388 7 Planktothrix_phage(33.33%) transposase NA
DBSCAN-SWA_8 187738 : 191378 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_9 212977 : 225018 12 Acinetobacter_phage(25.0%) integrase attL 210772:210786|attR 229396:229410
DBSCAN-SWA_10 228898 : 239230 9 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_11 243171 : 243801 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_12 248330 : 261821 8 Acinetobacter_phage(50.0%) tRNA,transposase NA
DBSCAN-SWA_13 270086 : 272231 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_14 275591 : 282509 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_15 296710 : 298333 1 Phormidium_phage(100.0%) NA NA
DBSCAN-SWA_16 305117 : 313754 5 Aeromonas_phage(33.33%) transposase NA
DBSCAN-SWA_17 317230 : 317914 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_18 329765 : 335543 4 Pacmanvirus(50.0%) NA NA
DBSCAN-SWA_19 338655 : 339462 1 uncultured_marine_virus(100.0%) NA NA
DBSCAN-SWA_20 350728 : 350959 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_21 354224 : 361048 8 Bacteriophage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage