Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP046904 Massilia flava strain DSM 26639 chromosome, complete genome 13 crisprs DEDDh,csa3,WYL,DinG,cas3,RT 1 1 2 0

Results visualization

1. NZ_CP046904
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046904_1 47072-47307 Orphan NA
2 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046904_2 813656-813804 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046904_3 1598496-1598578 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046904_4 2458682-2458825 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046904_5 2740128-2740222 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046904_6 3140794-3140876 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046904_7 4983547-4983655 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046904_8 5371283-5371417 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046904_9 5486268-5486356 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046904_10 5737991-5738104 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046904_11 6509804-6509906 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046904_12 6797313-6797388 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046904_13 6838685-6838773 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP046904_9 9.1|5486297|31|NZ_CP046904|CRISPRCasFinder 5486297-5486327 31 NZ_CP046904.1 2243077-2243107 2 0.935
NZ_CP046904_9 9.1|5486297|31|NZ_CP046904|CRISPRCasFinder 5486297-5486327 31 NZ_CP046904.1 2436993-2437023 2 0.935
NZ_CP046904_9 9.1|5486297|31|NZ_CP046904|CRISPRCasFinder 5486297-5486327 31 NZ_CP046904.1 2501472-2501502 2 0.935
NZ_CP046904_9 9.1|5486297|31|NZ_CP046904|CRISPRCasFinder 5486297-5486327 31 NZ_CP046904.1 3659982-3660012 2 0.935
NZ_CP046904_9 9.1|5486297|31|NZ_CP046904|CRISPRCasFinder 5486297-5486327 31 NZ_CP046904.1 4491638-4491668 2 0.935

1. spacer 9.1|5486297|31|NZ_CP046904|CRISPRCasFinder matches to position: 2243077-2243107, mismatch: 2, identity: 0.935

ccctgtggggtcagaccccagcgggacacgg	CRISPR spacer
ccctctggggtcagaccccagagggacacgg	Protospacer
**** **************** *********

2. spacer 9.1|5486297|31|NZ_CP046904|CRISPRCasFinder matches to position: 2436993-2437023, mismatch: 2, identity: 0.935

ccctgtggggtcagaccccagcgggacacgg	CRISPR spacer
ccctctggggtcagaccccagagggacacgg	Protospacer
**** **************** *********

3. spacer 9.1|5486297|31|NZ_CP046904|CRISPRCasFinder matches to position: 2501472-2501502, mismatch: 2, identity: 0.935

ccctgtggggtcagaccccagcgggacacgg	CRISPR spacer
ccctctggggtcagaccccagagggacacgg	Protospacer
**** **************** *********

4. spacer 9.1|5486297|31|NZ_CP046904|CRISPRCasFinder matches to position: 3659982-3660012, mismatch: 2, identity: 0.935

ccctgtggggtcagaccccagcgggacacgg	CRISPR spacer
ccttctggggtcagaccccagcgggacacgg	Protospacer
**.* **************************

5. spacer 9.1|5486297|31|NZ_CP046904|CRISPRCasFinder matches to position: 4491638-4491668, mismatch: 2, identity: 0.935

ccctgtggggtcagaccccagcgggacacgg	CRISPR spacer
ccctctggggtcagaccccagagggacacgg	Protospacer
**** **************** *********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP046904_6 6.1|3140818|35|NZ_CP046904|CRISPRCasFinder 3140818-3140852 35 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 934423-934457 10 0.714

1. spacer 6.1|3140818|35|NZ_CP046904|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

tcccgccggacctgtggtccggctgcctggcacca	CRISPR spacer
cgctgccggacctgttgtccggccgcctggacttc	Protospacer
. *.*********** *******.******  .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4068149 : 4120083 58 Pseudomonas_phage(12.5%) integrase,protease,holin,transposase attL 4071412:4071431|attR 4130877:4130896
DBSCAN-SWA_2 6736556 : 6752622 25 Pseudomonas_phage(46.15%) terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage