1. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
2. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
4. spacer 3.15|1574859|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
5. spacer 3.15|1574859|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 3.15|1574859|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 3.15|1574859|22|NZ_CP046728|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 3.2|1573932|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
9. spacer 3.2|1573932|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
10. spacer 3.2|1573932|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
11. spacer 3.2|1573932|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
12. spacer 3.2|1573932|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
13. spacer 3.3|1573986|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
14. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
15. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
16. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
17. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
18. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
19. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
20. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
21. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
22. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
23. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
24. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
25. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
26. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
27. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
28. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
29. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
30. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
31. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
32. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
33. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
34. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
35. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
36. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
37. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
38. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
39. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
40. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
41. spacer 3.4|1574040|22|NZ_CP046728|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
42. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
43. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
44. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
45. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
46. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
47. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
48. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
49. spacer 3.15|1574859|22|NZ_CP046728|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
50. spacer 5.5|2073796|24|NZ_CP046728|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
51. spacer 5.5|2073796|24|NZ_CP046728|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
52. spacer 1.1|364907|27|NZ_CP046728|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
53. spacer 1.1|364907|27|NZ_CP046728|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
54. spacer 1.7|365303|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
55. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
56. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
57. spacer 3.1|1573872|28|NZ_CP046728|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
58. spacer 3.1|1573872|28|NZ_CP046728|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
59. spacer 3.1|1573872|28|NZ_CP046728|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
60. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
61. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
62. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
63. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
64. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
65. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
66. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
67. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
68. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
69. spacer 3.14|1574802|25|NZ_CP046728|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgccaccgacccccccttgc CRISPR spacer
ttttccgacaccgacccccccttga Protospacer
.** *** ****************
70. spacer 5.5|2073796|24|NZ_CP046728|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
71. spacer 5.5|2073796|24|NZ_CP046728|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
72. spacer 5.5|2073796|24|NZ_CP046728|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
73. spacer 1.1|364907|27|NZ_CP046728|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
74. spacer 1.1|364907|27|NZ_CP046728|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
75. spacer 1.7|365303|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
76. spacer 1.7|365303|27|NZ_CP046728|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
77. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
78. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
79. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
80. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
81. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
82. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
83. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
84. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
85. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
86. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
87. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
88. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
89. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
90. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
91. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
92. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
93. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
94. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
95. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
96. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
97. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
98. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
99. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
100. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
101. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
102. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
103. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
104. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
105. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
106. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
107. spacer 3.1|1573872|28|NZ_CP046728|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
108. spacer 3.1|1573872|28|NZ_CP046728|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
109. spacer 3.1|1573872|28|NZ_CP046728|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
110. spacer 3.1|1573872|28|NZ_CP046728|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
111. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
112. spacer 3.5|1574094|25|NZ_CP046728|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
113. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
114. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
115. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
116. spacer 3.13|1574736|34|NZ_CP046728|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
117. spacer 1.1|364907|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
118. spacer 1.6|365237|33|NZ_CP046728|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
119. spacer 1.7|365303|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
120. spacer 1.9|365453|27|NZ_CP046728|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
121. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
122. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
123. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
124. spacer 1.10|365513|27|NZ_CP046728|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
125. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
126. spacer 3.1|1573872|28|NZ_CP046728|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
127. spacer 3.1|1573872|28|NZ_CP046728|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
128. spacer 3.1|1573872|28|NZ_CP046728|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
129. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
130. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
131. spacer 3.13|1574736|34|NZ_CP046728|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
132. spacer 11.12|3939490|30|NZ_CP046728|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8
gcggtgggcagcgtcggtaacgccgggatc CRISPR spacer
ccggtgggcatcgtcggtgacgccggacgc Protospacer
********* *******.*******. *
133. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.818
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcagcgccaccggcggggccggcggcgactc Protospacer
*. .*** *****************.******
134. spacer 12.8|3955196|36|NZ_CP046728|CRT matches to NZ_CP054842 (Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.833
tagcagcggtgccggcggcaccaacggctccggcgg- CRISPR spacer
ccgcatcggtgccggcggcaccatcggc-acggcggc Protospacer
. *** ***************** **** ******
135. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.818
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcagcgccaccggcggggccggcggcgactc Protospacer
*. .*** *****************.******
136. spacer 1.4|365102|27|NZ_CP046728|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
137. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
138. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
139. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
140. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
141. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
142. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
143. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
144. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
145. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
146. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
147. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
148. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
149. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
150. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
151. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
152. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
153. spacer 3.1|1573872|28|NZ_CP046728|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
154. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
155. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
156. spacer 5.3|2073706|30|NZ_CP046728|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
157. spacer 5.3|2073706|30|NZ_CP046728|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
158. spacer 5.3|2073706|30|NZ_CP046728|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
159. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ttgagatccgcgacgatgggtgtggcgccggc Protospacer
** .********.**** ***********
160. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ttcccgcaggcgacggtgcgggcggcgccggc Protospacer
**..* * ********* ***.*********
161. spacer 11.12|3939490|30|NZ_CP046728|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 7, identity: 0.767
gcggtgggcagcgtcggtaacgccgggatc CRISPR spacer
gatcagagaagcgacggtaacgccgggatc Protospacer
* *.* **** ****************
162. spacer 12.3|3954806|36|NZ_CP046728|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
caacggcggggccggcggtagcggcggcgcaggcgc Protospacer
**.************************ ** ..* .
163. spacer 12.3|3954806|36|NZ_CP046728|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcggcgggctctt Protospacer
*********** ******.******** * ***
164. spacer 12.3|3954806|36|NZ_CP046728|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
165. spacer 12.3|3954806|36|NZ_CP046728|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
166. spacer 12.3|3954806|36|NZ_CP046728|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
167. spacer 12.3|3954806|36|NZ_CP046728|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
168. spacer 12.3|3954806|36|NZ_CP046728|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
169. spacer 12.3|3954806|36|NZ_CP046728|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
170. spacer 12.3|3954806|36|NZ_CP046728|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
171. spacer 12.3|3954806|36|NZ_CP046728|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
172. spacer 12.3|3954806|36|NZ_CP046728|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
173. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.788
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcggcgc Protospacer
*****.****.************* . **.* *
174. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.788
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcggcgc Protospacer
*****.****.************* . **.* *
175. spacer 1.6|365237|33|NZ_CP046728|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
176. spacer 1.6|365237|33|NZ_CP046728|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
177. spacer 1.6|365237|33|NZ_CP046728|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
178. spacer 1.6|365237|33|NZ_CP046728|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
179. spacer 1.6|365237|33|NZ_CP046728|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
180. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
181. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
182. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
183. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
184. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
185. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
186. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
187. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
188. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
189. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
190. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
191. spacer 5.3|2073706|30|NZ_CP046728|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
192. spacer 5.3|2073706|30|NZ_CP046728|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
193. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agcgcggccgcgtcggtgggggtggcgcccgc Protospacer
. * ***** **************** **
194. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 8, identity: 0.75
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcaccaccgcggcggtgcgggtggcgccggc Protospacer
. . *. *****.***** *************
195. spacer 11.9|3939259|39|NZ_CP046728|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.795
gccggt-ggcgccggcggggccggcgggcagggcggtagc CRISPR spacer
-ctgatcggcgccggcggggccgccggccagggcgatgcc Protospacer
*.*.* **************** *** *******.*. *
196. spacer 11.12|3939490|30|NZ_CP046728|CRT matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 8, identity: 0.733
gcggtgggcagcgtcggtaacgccgggatc CRISPR spacer
gcggtgagcagcgtcggtagcgcgccaacg Protospacer
******.************.*** .*.
197. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggccccggcggtgccggcgataccga Protospacer
*.******** ******* ********.. *
198. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggcggcggcgccggcggggccggcggcgggac Protospacer
*.. ******.***************.**. *
199. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
200. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
201. spacer 12.8|3955196|36|NZ_CP046728|CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 8, identity: 0.778
tagcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gcgctgatgcgccggcgacaccaaaggctccggcgg Protospacer
** * *.*******.****** ***********
202. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggccccggcggtgccggcgataccga Protospacer
*.******** ******* ********.. *
203. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggcggcggcgccggcggggccggcggcgggac Protospacer
*.. ******.***************.**. *
204. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
205. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
206. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gatcgccggcaccggcggcaccaccggccagcc Protospacer
* ******************** ****.
207. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gatcgccggcaccggcggcaccaccggccagcc Protospacer
* ******************** ****.
208. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
acccgccggcaccggcggcgccaacggatcgaa Protospacer
****************.******* ** ..
209. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
aggcggcggcaccggcggcaccaccggctggcg Protospacer
..** ***************** ***** *
210. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cgaagcctgcaccggcggcacccacggcacaaa Protospacer
*.* *** ************** ***** * ..
211. spacer 1.6|365237|33|NZ_CP046728|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
212. spacer 1.6|365237|33|NZ_CP046728|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
213. spacer 1.6|365237|33|NZ_CP046728|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
214. spacer 1.6|365237|33|NZ_CP046728|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
215. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
216. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
217. spacer 2.1|690431|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
218. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
219. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
220. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
221. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
222. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
223. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
224. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
225. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
226. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
227. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
228. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gcccccggcgtgacggtggaggtggcgccggc Protospacer
...*. **.********.************
229. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
230. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc Protospacer
... *. * ******* ** ************
231. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc Protospacer
... *. * ******* ** ************
232. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gtggcggtggcggcggtgggggtggcggcggc Protospacer
* * . ***.************** ****
233. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
tgcgaccgggcgacggtggaggtggcgccagc Protospacer
* . .* **********.*********.**
234. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
caacattcagcgacggtgggtgtggcggcggc Protospacer
. . *.* *********** ****** ****
235. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcacgacggcggcggtgcgggtggcgccggc Protospacer
. . * * ***.***** *************
236. spacer 11.9|3939259|39|NZ_CP046728|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.769
gccggt-ggcgccggcggggccggcgggcagggcggtagc CRISPR spacer
-ctgatcggcgccggcggggccgccggccagggcgacgcc Protospacer
*.*.* **************** *** *******... *
237. spacer 11.9|3939259|39|NZ_CP046728|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.769
gccggt-ggcgccggcggggccggcgggcagggcggtagc CRISPR spacer
-ctgatcggcgccggcggggccgccggccagggcgacgcc Protospacer
*.*.* **************** *** *******... *
238. spacer 11.9|3939259|39|NZ_CP046728|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.769
gccggtggcgccggcggggccggcgggcagggcggtagc CRISPR spacer
ggcccgggcgacggcggggccgtcgggcagggcgctccc Protospacer
* * **** *********** *********** * *
239. spacer 11.12|3939490|30|NZ_CP046728|CRT matches to NC_012725 (Burkholderia glumae BGR1 plasmid bglu_4p, complete sequence) position: , mismatch: 9, identity: 0.7
gcggtgggcagcgtcggtaacgccgggatc CRISPR spacer
gatttgggcagagtcggtaacgccgaatgg Protospacer
* ******* *************..
240. spacer 12.3|3954806|36|NZ_CP046728|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcgtgcagcgctg Protospacer
*********** ******.******* * .**
241. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
tggtgacggcaccggcggtgccggcggcgatgc Protospacer
... *.************ *******.***. *
242. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggccgcggcaccggcggggccgccgccgatca Protospacer
*.. ****************** ** ***..
243. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
244. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
245. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
246. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
247. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
248. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
249. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
250. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
251. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
252. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
253. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggtacccggcaccgccgaggccggcgacgagtt Protospacer
. * ******** **.************ *.
254. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
255. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
256. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
257. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
258. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
259. spacer 12.11|3955424|36|NZ_CP046728|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.75
ggccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct Protospacer
*********** ******* ****** **.*
260. spacer 12.11|3955424|36|NZ_CP046728|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.75
ggccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct Protospacer
*********** ******* ****** **.*
261. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
tggtgacggcaccggcggtgccggcggcgatgc Protospacer
... *.************ *******.***. *
262. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggccgcggcaccggcggggccgccgccgatca Protospacer
*.. ****************** ** ***..
263. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
264. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
265. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
266. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
267. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
268. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
269. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
270. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
271. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
272. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
273. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggtacccggcaccgccgaggccggcgacgagtt Protospacer
. * ******** **.************ *.
274. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
275. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
276. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
277. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
278. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
279. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gagcgccgccaccgacggcaccaacggcctgca Protospacer
*.***** *****.*************.. .
280. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to NZ_CP041197 (Pseudarthrobacter sp. NIBRBAC000502770 plasmid pMK-1, complete sequence) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
agccccctgcaccggcggaaccaacggctaagc Protospacer
. * ** ********** ********** *
281. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to MK524502 (Microbacterium phage TimoTea, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
tgacaacggccccggcggcaccaccggctcata Protospacer
..**. **** ************ ****** .
282. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to NZ_CP042515 (Serratia marcescens strain E28 plasmid pE28_003) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
ctccttcggcttcggcggcaccaacggctcgct Protospacer
* * .**** .******************
283. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to KT281796 (Mycobacterium phage Zakhe101, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
284. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to AY129335 (Mycobacterium virus Corndog, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
285. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to MN428058 (Mycobacterium phage Krili, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
286. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to NC_004685 (Mycobacterium phage Corndog, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
287. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to JN698993 (Mycobacterium phage Firecracker, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
288. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to MN585964 (Mycobacterium phage Blessica, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
289. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to NC_022057 (Mycobacterium phage Catdawg, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
290. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to MT818425 (Mycobacterium phage NiebruSaylor, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
291. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to NC_022325 (Mycobacterium phage Dylan, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
292. spacer 12.16|3955805|33|NZ_CP046728|CRT matches to MN428052 (Mycobacterium phage Smooch, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
293. spacer 12.19|3956030|36|NZ_CP046728|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.75
ggccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct Protospacer
*********** ******* ****** **.*
294. spacer 12.19|3956030|36|NZ_CP046728|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.75
ggccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct Protospacer
*********** ******* ****** **.*
295. spacer 1.6|365237|33|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
296. spacer 1.6|365237|33|NZ_CP046728|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
297. spacer 1.6|365237|33|NZ_CP046728|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
298. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
299. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
300. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
301. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
302. spacer 3.10|1574487|31|NZ_CP046728|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
303. spacer 3.13|1574736|34|NZ_CP046728|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
304. spacer 7.9|3114635|35|NZ_CP046728|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
305. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
aggacggccgcggcggtggcggtggcgccgta Protospacer
* *****.****** **********
306. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ctgctggccgcgacggtgctggtggcgccgat Protospacer
.* .. *********** **********..
307. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
tcgcggatcgggatggtgggggtggcgccgga Protospacer
*. . .** **.*****************
308. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gcgagggcggcgacggtgggcgtgtcgccggc Protospacer
. * *********** *** *******
309. spacer 12.3|3954806|36|NZ_CP046728|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 10, identity: 0.722
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ggccggcggggccggcgggaccggcggggccggggg Protospacer
. *************** * **********..
310. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gacgcgcggcaccggctggtccggcgacgcgcg Protospacer
* . *********** ** ********* .
311. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcaggcggcgccggcgaggccggcgaggggca Protospacer
. *******.******.********* *. .
312. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gacgcgcggcaccggctggtccggcgacgcgcg Protospacer
* . *********** ** ********* .
313. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcaggcggcgccggcgaggccggcgaggggca Protospacer
. *******.******.********* *. .
314. spacer 9.6|3744134|32|NZ_CP046728|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcagcagcgcgacggtgtcggtggcgccggt Protospacer
. . . ********** ***********.
315. spacer 12.3|3954806|36|NZ_CP046728|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
316. spacer 12.3|3954806|36|NZ_CP046728|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
317. spacer 12.5|3954959|33|NZ_CP046728|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 11, identity: 0.667
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcccggccgcaccggcggtgccggcgaccgagg Protospacer
*** ********** ********* .
318. spacer 12.13|3955568|33|NZ_CP046728|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 11, identity: 0.667
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcccggccgcaccggcggtgccggcgaccgagg Protospacer
*** ********** ********* .