Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP046610 Burkholderia contaminans strain XL73 plasmid unnamed1, complete sequence 0 crisprs csa3 0 0 1 0
NZ_CP046611 Burkholderia contaminans strain XL73 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP046608 Burkholderia contaminans strain XL73 chromosome 2, complete sequence 4 crisprs cas3,csa3,WYL,c2c9_V-U4,Cas14u_CAS-V,DinG 1 2 0 0
NZ_CP046607 Burkholderia contaminans strain XL73 chromosome 1, complete sequence 0 crisprs WYL 0 0 119 0
NZ_CP046609 Burkholderia contaminans strain XL73 chromosome 3, complete sequence 2 crisprs WYL,cas3,DEDDh,csa3,Cas14u_CAS-V,DinG 0 1 2 0

Results visualization

1. NZ_CP046610
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 80027 : 131684 48 Leptospira_phage(15.38%) transposase,integrase attL 99014:99032|attR 132581:132599
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP046608
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046608_1 302358-302551 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046608_2 302622-302877 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046608_3 305385-305839 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046608_4 3029591-3029796 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP046608_4 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder 3029749-3029770 22 NZ_CP046609.1 3383553-3383574 2 0.909

1. spacer 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder matches to position: 3383553-3383574, mismatch: 2, identity: 0.909

ggcgccgccgatcaccgagccc	CRISPR spacer
ggcgccgccgaacaccgcgccc	Protospacer
*********** ***** ****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP046608_4 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder 3029749-3029770 22 CP047036 Rhodobacter sphaeroides strain DSM 158 plasmid pDx, complete sequence 28933-28954 2 0.909
NZ_CP046608_4 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder 3029749-3029770 22 NZ_CP047042 Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pDx, complete sequence 28906-28927 2 0.909
NZ_CP046608_4 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder 3029749-3029770 22 NZ_CP047900 Pseudarthrobacter sp. YJ56 plasmid unnamed2, complete sequence 72688-72709 2 0.909
NZ_CP046608_4 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder 3029749-3029770 22 NZ_CP051473 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10DE, complete sequence 36889-36910 2 0.909
NZ_CP046608_4 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder 3029749-3029770 22 NZ_CP051473 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10DE, complete sequence 146015-146036 2 0.909
NZ_CP046608_4 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder 3029749-3029770 22 NZ_CP030276 Rhodobacter sphaeroides 2.4.1 plasmid pDE, complete sequence 36896-36917 2 0.909
NZ_CP046608_4 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder 3029749-3029770 22 NZ_CP030276 Rhodobacter sphaeroides 2.4.1 plasmid pDE, complete sequence 146039-146060 2 0.909
NZ_CP046608_4 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder 3029749-3029770 22 NZ_CP015289 Rhodobacter sphaeroides strain MBTLJ-20 plasmid a, complete sequence 80206-80227 2 0.909
NZ_CP046608_4 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder 3029749-3029770 22 NZ_CP015289 Rhodobacter sphaeroides strain MBTLJ-20 plasmid a, complete sequence 124016-124037 2 0.909
NZ_CP046608_4 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder 3029749-3029770 22 NZ_CP022195 Yangia pacifica strain YSBP01 plasmid unnamed5, complete sequence 21990-22011 2 0.909
NZ_CP046608_4 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder 3029749-3029770 22 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 498979-499000 2 0.909
NZ_CP046608_4 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder 3029749-3029770 22 NZ_CP015212 Rhodobacter sphaeroides strain MBTLJ-13 plasmid a, complete sequence 36199-36220 2 0.909
NZ_CP046608_4 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder 3029749-3029770 22 NZ_CP015212 Rhodobacter sphaeroides strain MBTLJ-13 plasmid a, complete sequence 145343-145364 2 0.909
NZ_CP046608_4 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder 3029749-3029770 22 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 515843-515864 3 0.864
NZ_CP046608_4 4.2|3029689|34|NZ_CP046608|CRISPRCasFinder 3029689-3029722 34 NC_015383 Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence 252421-252454 9 0.735
NZ_CP046608_4 4.2|3029689|34|NZ_CP046608|CRISPRCasFinder 3029689-3029722 34 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 40845-40878 10 0.706

1. spacer 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder matches to CP047036 (Rhodobacter sphaeroides strain DSM 158 plasmid pDx, complete sequence) position: , mismatch: 2, identity: 0.909

ggcgccgccgatcaccgagccc	CRISPR spacer
cgcgccgccgagcaccgagccc	Protospacer
 ********** **********

2. spacer 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder matches to NZ_CP047042 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pDx, complete sequence) position: , mismatch: 2, identity: 0.909

ggcgccgccgatcaccgagccc	CRISPR spacer
cgcgccgccgagcaccgagccc	Protospacer
 ********** **********

3. spacer 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder matches to NZ_CP047900 (Pseudarthrobacter sp. YJ56 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909

ggcgccgccgatcaccgagccc	CRISPR spacer
ggcgccgccgatcgccgagccg	Protospacer
*************.******* 

4. spacer 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder matches to NZ_CP051473 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10DE, complete sequence) position: , mismatch: 2, identity: 0.909

ggcgccgccgatcaccgagccc	CRISPR spacer
cgcgccgccgagcaccgagccc	Protospacer
 ********** **********

5. spacer 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder matches to NZ_CP051473 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10DE, complete sequence) position: , mismatch: 2, identity: 0.909

ggcgccgccgatcaccgagccc	CRISPR spacer
cgcgccgccgagcaccgagccc	Protospacer
 ********** **********

6. spacer 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder matches to NZ_CP030276 (Rhodobacter sphaeroides 2.4.1 plasmid pDE, complete sequence) position: , mismatch: 2, identity: 0.909

ggcgccgccgatcaccgagccc	CRISPR spacer
cgcgccgccgagcaccgagccc	Protospacer
 ********** **********

7. spacer 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder matches to NZ_CP030276 (Rhodobacter sphaeroides 2.4.1 plasmid pDE, complete sequence) position: , mismatch: 2, identity: 0.909

ggcgccgccgatcaccgagccc	CRISPR spacer
cgcgccgccgagcaccgagccc	Protospacer
 ********** **********

8. spacer 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder matches to NZ_CP015289 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid a, complete sequence) position: , mismatch: 2, identity: 0.909

ggcgccgccgatcaccgagccc	CRISPR spacer
cgcgccgccgagcaccgagccc	Protospacer
 ********** **********

9. spacer 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder matches to NZ_CP015289 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid a, complete sequence) position: , mismatch: 2, identity: 0.909

ggcgccgccgatcaccgagccc	CRISPR spacer
cgcgccgccgagcaccgagccc	Protospacer
 ********** **********

10. spacer 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder matches to NZ_CP022195 (Yangia pacifica strain YSBP01 plasmid unnamed5, complete sequence) position: , mismatch: 2, identity: 0.909

ggcgccgccgatcaccgagccc	CRISPR spacer
ggcgccgccgctcaccgagccg	Protospacer
********** ********** 

11. spacer 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 2, identity: 0.909

ggcgccgccgatcaccgagccc	CRISPR spacer
ggcgccgccgatcaccgtgccg	Protospacer
***************** *** 

12. spacer 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder matches to NZ_CP015212 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid a, complete sequence) position: , mismatch: 2, identity: 0.909

ggcgccgccgatcaccgagccc	CRISPR spacer
cgcgccgccgagcaccgagccc	Protospacer
 ********** **********

13. spacer 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder matches to NZ_CP015212 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid a, complete sequence) position: , mismatch: 2, identity: 0.909

ggcgccgccgatcaccgagccc	CRISPR spacer
cgcgccgccgagcaccgagccc	Protospacer
 ********** **********

14. spacer 4.3|3029749|22|NZ_CP046608|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864

ggcgccgccgatcaccgagccc	CRISPR spacer
ggcgccgccgatcaccgagttg	Protospacer
*******************.. 

15. spacer 4.2|3029689|34|NZ_CP046608|CRISPRCasFinder matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 9, identity: 0.735

gatcgcgccggtgcgctcgtgacggttcgacgtc--	CRISPR spacer
agccgcgccagtgcgctcgtgacgatt--gcctcca	Protospacer
...******.**************.**  .* **  

16. spacer 4.2|3029689|34|NZ_CP046608|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 10, identity: 0.706

gatcgcgccggtgcgctcgtgacggttcgacgtc	CRISPR spacer
cgacggtacggtgcgctcgtggcggatcgacgcg	Protospacer
 . **   *************.*** ******. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP046609
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046609_1 941042-941134 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046609_2 3399265-3399372 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP046609_2 2.1|3399295|48|NZ_CP046609|CRISPRCasFinder 3399295-3399342 48 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 450548-450595 7 0.854

1. spacer 2.1|3399295|48|NZ_CP046609|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.854

gcagaacagcccccacgctcacttcgttcgctgccccccgagggggcc	CRISPR spacer
atgaaacaacccccacgctcactgcgttcgctgccccccgagggggcg	Protospacer
....****.************** *********************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 453638 : 523638 59 Acinetobacter_phage(28.57%) tRNA,plate,integrase attL 463071:463087|attR 529397:529413
DBSCAN-SWA_2 970200 : 982245 8 Enterobacteria_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP046607
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 6759 4 Acidithiobacillus_phage(100.0%) transposase NA
DBSCAN-SWA_2 13935 : 14286 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_3 39332 : 43549 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_4 49484 : 52687 2 Pelagibacter_phage(50.0%) NA NA
DBSCAN-SWA_5 64543 : 65320 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_6 70875 : 71664 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_7 91616 : 93616 2 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_8 99014 : 109567 11 Puniceispirillum_phage(20.0%) NA NA
DBSCAN-SWA_9 115618 : 116476 1 Tetraselmis_viridis_virus(100.0%) NA NA
DBSCAN-SWA_10 141479 : 142175 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_11 148751 : 150050 1 Megavirus(100.0%) NA NA
DBSCAN-SWA_12 154313 : 158777 2 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_13 167950 : 169306 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_14 175423 : 176194 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_15 182458 : 182983 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_16 192600 : 194430 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_17 197629 : 202073 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_18 221255 : 222572 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_19 232516 : 234472 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_20 258168 : 258840 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_21 292315 : 300962 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_22 308474 : 311868 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_23 315955 : 320127 5 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_24 324126 : 324558 1 Macacine_betaherpesvirus(100.0%) NA NA
DBSCAN-SWA_25 327825 : 336057 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_26 346934 : 348548 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_27 361369 : 362929 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_28 367976 : 373237 4 Planktothrix_phage(33.33%) transposase NA
DBSCAN-SWA_29 376479 : 377970 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_30 387610 : 391609 5 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_31 399358 : 400723 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_32 408040 : 409585 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_33 419822 : 424726 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_34 445322 : 446804 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_35 454453 : 455992 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_36 460291 : 462178 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_37 472129 : 474595 2 Apis_mellifera_filamentous_virus(50.0%) NA NA
DBSCAN-SWA_38 485669 : 489274 4 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_39 494510 : 500662 6 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_40 504441 : 507276 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_41 511756 : 515494 2 Bathycoccus_sp._RCC1105_virus(50.0%) NA NA
DBSCAN-SWA_42 524602 : 530901 5 Planktothrix_phage(66.67%) NA NA
DBSCAN-SWA_43 543489 : 550270 5 Acanthamoeba_polyphaga_mimivirus(25.0%) holin NA
DBSCAN-SWA_44 577209 : 582260 2 Hepacivirus(50.0%) NA NA
DBSCAN-SWA_45 586571 : 587291 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_46 590292 : 591927 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_47 595697 : 598841 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_48 607488 : 608409 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_49 617911 : 620272 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_50 645665 : 646436 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_51 650697 : 654884 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_52 659205 : 662454 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_53 667980 : 668730 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_54 698427 : 702319 4 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_55 706573 : 707554 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_56 723529 : 724366 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_57 739045 : 741220 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_58 775786 : 778633 1 Agrobacterium_phage(100.0%) protease NA
DBSCAN-SWA_59 789828 : 790989 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_60 796580 : 798887 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_61 803642 : 803999 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_62 827407 : 828184 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_63 833100 : 834237 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_64 838268 : 839039 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_65 846113 : 846950 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_66 858384 : 859374 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_67 874230 : 874689 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_68 888762 : 892373 3 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_69 901846 : 907506 6 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_70 932341 : 939149 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_71 944057 : 945755 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_72 963656 : 964496 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_73 984724 : 987339 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_74 1002464 : 1003466 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_75 1007894 : 1012575 4 Aeromonas_phage(50.0%) NA NA
DBSCAN-SWA_76 1018692 : 1019262 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_77 1025800 : 1030024 5 Orpheovirus(50.0%) NA NA
DBSCAN-SWA_78 1033610 : 1040007 5 Indivirus(33.33%) NA NA
DBSCAN-SWA_79 1045526 : 1053502 6 uncultured_virus(40.0%) NA NA
DBSCAN-SWA_80 1058747 : 1060046 2 Leuconostoc_phage(50.0%) NA NA
DBSCAN-SWA_81 1065898 : 1066705 1 Feldmannia_irregularis_virus(100.0%) NA NA
DBSCAN-SWA_82 1070980 : 1072228 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_83 1075927 : 1077871 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_84 1102587 : 1103631 1 Shigella_phage(100.0%) NA NA
DBSCAN-SWA_85 1108422 : 1109856 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_86 1115544 : 1121630 4 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_87 1125827 : 1126451 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_88 1131745 : 1135520 5 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_89 1138557 : 1139106 1 Turkeypox_virus(100.0%) NA NA
DBSCAN-SWA_90 1145893 : 1151994 5 Escherichia_phage(33.33%) transposase NA
DBSCAN-SWA_91 1155746 : 1157243 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_92 1167912 : 1173807 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_93 1178636 : 1180397 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_94 1184317 : 1185259 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_95 1192969 : 1204861 11 Feldmannia_irregularis_virus(20.0%) NA NA
DBSCAN-SWA_96 1208212 : 1211301 3 Edwardsiella_phage(50.0%) NA NA
DBSCAN-SWA_97 1225044 : 1228608 3 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_98 1233267 : 1233978 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_99 1243344 : 1244919 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_100 1250903 : 1251917 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_101 1259180 : 1262541 3 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_102 1266203 : 1267316 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_103 1278673 : 1279666 1 Burkholderia_phage(100.0%) transposase NA
DBSCAN-SWA_104 1287431 : 1288838 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_105 1297776 : 1301640 4 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_106 1310181 : 1326053 11 Bacillus_virus(28.57%) NA NA
DBSCAN-SWA_107 1329369 : 1369930 8 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_108 1390915 : 1392381 2 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_109 1398272 : 1399670 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_110 1411782 : 1414884 2 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_111 1421643 : 1424030 2 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_112 1427845 : 1432111 4 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_113 1453220 : 1454186 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_114 1461177 : 1462263 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_115 1473471 : 1479778 5 Hokovirus(33.33%) NA NA
DBSCAN-SWA_116 1487144 : 1489254 2 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_117 1499972 : 1504081 2 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_118 1524800 : 1532492 5 Burkholderia_phage(33.33%) transposase,integrase NA
DBSCAN-SWA_119 1540185 : 1541214 1 Escherichia_phage(100.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage