Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP044379 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP044378 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 1 crisprs RT,DEDDh 2 41 10 0
NZ_CP044376 Klebsiella pneumoniae strain 2018S06-082 chromosome, complete genome 2 crisprs DEDDh,csa3,RT,cas3 0 0 4 0

Results visualization

1. NZ_CP044378
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 18476 : 52161 27 Salmonella_phage(41.67%) integrase,transposase attL 22722:22752|attR 48100:48130
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP044377
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044377_1 37300-38594 Orphan NA
21 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044378.1 124308-124339 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP044378.1 56243-56274 1 0.969

1. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to position: 124308-124339, mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

2. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to position: 56243-56274, mismatch: 1, identity: 0.969

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcag	Protospacer
*** ****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 306137-306168 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP019902 Raoultella planticola strain GODA plasmid unnamed3, complete sequence 4647-4678 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53121-53152 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32453-32484 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17641-17672 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17702-17733 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP025945 Escherichia coli strain SCEC020023 plasmid p1_020023, complete sequence 7737-7768 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 251827-251858 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 115043-115074 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 201064-201095 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7634-7665 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7694-7725 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223968-223999 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25434-25465 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33519-33550 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30341-30372 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 30600-30631 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32453-32484 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221198-221229 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28069-28100 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 139046-139077 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 7758-7789 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300579-300610 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP029779 Klebsiella pneumoniae strain WCHKP020034 plasmid p1_020034, complete sequence 3002-3033 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136334-136365 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30091-30122 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62331-62362 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332609-332640 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229687-229718 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28336-28367 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313822-313853 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 10971-11002 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 3767-3798 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142564-142595 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37329-37360 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243834-243865 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114771-114802 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 144825-144856 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168178-168209 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP038459 Escherichia coli strain EC-129 plasmid pEC129_6, complete sequence 2472-2503 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254623-254654 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30091-30122 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32453-32484 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53655-53686 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132575-132606 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132210-132241 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29357-29388 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 42784-42815 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100575-100606 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57061-57092 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85368-85399 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 30155-30186 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32479-32510 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130323-130354 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28312-28343 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130407-130438 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42999-43030 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59840-59871 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149403-149434 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53243-53274 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8566-8597 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24709-24740 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5152-5183 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17519-17550 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30220-30251 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 251888-251919 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114982-115013 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 201003-201034 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7815-7846 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223846-223877 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227617-227648 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221320-221351 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28191-28222 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138924-138955 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 7880-7911 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300457-300488 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8160-8191 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136395-136426 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62392-62423 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332731-332762 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229748-229779 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28519-28550 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313761-313792 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277747-277778 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30216-30247 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11154-11185 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 3828-3859 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42138-42169 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95652-95683 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 128123-128154 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37390-37421 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243712-243743 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114710-114741 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117545-117576 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 144947-144978 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30158-30189 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60651-60682 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254562-254593 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53716-53747 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102289-102320 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 54807-54838 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132697-132728 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 48770-48801 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 279312-279343 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29479-29510 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 42845-42876 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57244-57275 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85246-85277 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 30033-30064 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130445-130476 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130529-130560 0 1.0
NZ_CP044377_1 1.2|37390|32|NZ_CP044377|CRISPRCasFinder 37390-37421 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59779-59810 0 1.0
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37451-37481 0 1.0
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 42906-42936 0 1.0
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130506-130536 0 1.0
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130590-130620 0 1.0
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243652-243682 0 1.0
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254503-254533 0 1.0
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29973-30003 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114861-114891 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 200882-200912 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300336-300366 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8039-8069 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313640-313670 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243592-243622 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114589-114619 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75807-75837 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254442-254472 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42878-42908 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59658-59688 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53365-53395 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252010-252040 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31528-31558 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227739-227769 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28313-28343 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136517-136547 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62514-62544 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332853-332883 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229870-229900 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28641-28671 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11276-11306 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 3949-3979 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42260-42290 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37511-37541 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145069-145099 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53838-53868 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132819-132849 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132332-132362 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29601-29631 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 42967-42997 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57366-57396 0 1.0
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28556-28586 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 306015-306046 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149281-149312 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32575-32606 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8444-8475 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24831-24862 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5274-5305 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17397-17428 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30342-30373 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7934-7965 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25556-25587 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33641-33672 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30463-30494 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32575-32606 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138802-138833 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8000-8031 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30213-30244 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277625-277656 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30338-30369 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142442-142473 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95530-95561 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 128001-128032 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37571-37602 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243529-243560 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117423-117454 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30280-30311 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168300-168331 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60773-60804 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254380-254411 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30213-30244 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32575-32606 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102411-102442 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 54929-54960 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 48892-48923 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43028-43059 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100453-100484 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85124-85155 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29911-29942 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32540-32571 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130567-130598 0 1.0
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130651-130682 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32636-32660 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24892-24916 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5335-5359 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30403-30427 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7995-8019 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25617-25641 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33702-33726 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30524-30548 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32636-32660 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8060-8084 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30274-30298 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP024491 Klebsiella pneumoniae strain INF249 plasmid unnamed2, complete sequence 2740-2764 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30399-30423 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37632-37656 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30341-30365 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168361-168385 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60834-60858 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30274-30298 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32636-32660 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102472-102496 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 54990-55014 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 48953-48977 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43089-43113 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32601-32625 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130628-130652 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130712-130736 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305961-305985 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149227-149251 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP019902 Raoultella planticola strain GODA plasmid unnamed3, complete sequence 4425-4449 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8390-8414 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17343-17367 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138748-138772 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP029779 Klebsiella pneumoniae strain WCHKP020034 plasmid p1_020034, complete sequence 2780-2804 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95476-95500 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127947-127971 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243475-243499 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117369-117393 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254326-254350 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100399-100423 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85070-85094 0 1.0
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29857-29881 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305900-305931 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149166-149197 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53487-53518 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32690-32721 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8329-8360 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24946-24977 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5389-5420 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30457-30488 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252131-252162 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114738-114769 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 200759-200790 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223785-223816 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25671-25702 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33756-33787 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31650-31681 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30578-30609 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32690-32721 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227861-227892 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221381-221412 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28435-28466 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138687-138718 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8114-8145 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300213-300244 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 7916-7947 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136639-136670 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30328-30359 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62636-62667 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332975-333006 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229992-230023 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28763-28794 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313517-313548 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277564-277595 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30453-30484 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11398-11429 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 4071-4102 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42382-42413 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95415-95446 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127886-127917 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37686-37717 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243414-243445 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114466-114497 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117308-117339 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145191-145222 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30395-30426 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168415-168446 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75684-75715 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60888-60919 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254265-254296 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30328-30359 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32690-32721 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53960-53991 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102526-102557 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55044-55075 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132941-132972 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49007-49038 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132454-132485 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29723-29754 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43143-43174 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100338-100369 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57488-57519 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85009-85040 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29796-29827 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32655-32686 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130682-130713 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28678-28709 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130766-130797 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42755-42786 0 1.0
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59535-59566 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305840-305870 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149106-149136 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53548-53578 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32751-32781 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8269-8299 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25007-25037 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5450-5480 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 323031-323061 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33374-33404 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30518-30548 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252192-252222 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114678-114708 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 200699-200729 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25732-25762 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33817-33847 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31711-31741 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30639-30669 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32751-32781 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227922-227952 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28496-28526 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138627-138657 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300153-300183 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 7856-7886 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136700-136730 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30389-30419 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62697-62727 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 333036-333066 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 230053-230083 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28824-28854 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313458-313488 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277504-277534 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30514-30544 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11459-11489 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 4131-4161 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42443-42473 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142382-142412 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95355-95385 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127826-127856 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37747-37777 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243354-243384 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114406-114436 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117248-117278 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145252-145282 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30456-30486 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168476-168506 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75624-75654 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60949-60979 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254206-254236 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30389-30419 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32751-32781 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 54021-54051 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102587-102617 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55105-55135 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 133002-133032 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49068-49098 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132515-132545 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33375-33405 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29784-29814 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43204-43234 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100278-100308 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57549-57579 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84949-84979 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29736-29766 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32716-32746 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130743-130773 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28739-28769 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130827-130857 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42695-42725 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59475-59505 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 MK416022 Klebsiella phage ST846-OXA48phi9.2, complete genome 21170-21200 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 MK448237 Klebsiella phage ST974-OXA48phi18.2, complete genome 24973-25003 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 KY271399 Klebsiella phage 5 LV-2017, complete genome 18200-18230 0 1.0
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 MK422450 Klebsiella phage ST13-OXA48phi12.4, complete genome 28530-28560 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305778-305809 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32812-32843 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252253-252284 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 325946-325977 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114616-114647 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 159024-159055 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25793-25824 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33878-33909 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31772-31803 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30700-30731 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32812-32843 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 228043-228074 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28557-28588 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138565-138596 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 10961-10992 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 7734-7765 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136761-136792 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30450-30481 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62758-62789 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 230114-230145 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28885-28916 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 115847-115878 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313397-313428 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30575-30606 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11520-11551 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 4192-4223 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42504-42535 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142320-142351 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127764-127795 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37807-37838 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243292-243323 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114344-114375 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30517-30548 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168537-168568 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254145-254176 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30450-30481 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32812-32843 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 54082-54113 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 133063-133094 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132576-132607 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29845-29876 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43265-43296 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57609-57640 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84520-84551 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84887-84918 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29674-29705 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32777-32808 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130804-130835 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28800-28831 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130888-130919 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42633-42664 0 1.0
NZ_CP044377_1 1.9|37807|32|NZ_CP044377|CRISPRCasFinder 37807-37838 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59414-59445 0 1.0
NZ_CP044377_1 1.10|37868|32|NZ_CP044377|CRISPRCasFinder 37868-37899 32 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 322544-322575 0 1.0
NZ_CP044377_1 1.10|37868|32|NZ_CP044377|CRISPRCasFinder 37868-37899 32 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 32887-32918 0 1.0
NZ_CP044377_1 1.10|37868|32|NZ_CP044377|CRISPRCasFinder 37868-37899 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138504-138535 0 1.0
NZ_CP044377_1 1.10|37868|32|NZ_CP044377|CRISPRCasFinder 37868-37899 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277442-277473 0 1.0
NZ_CP044377_1 1.10|37868|32|NZ_CP044377|CRISPRCasFinder 37868-37899 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30636-30667 0 1.0
NZ_CP044377_1 1.10|37868|32|NZ_CP044377|CRISPRCasFinder 37868-37899 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127703-127734 0 1.0
NZ_CP044377_1 1.10|37868|32|NZ_CP044377|CRISPRCasFinder 37868-37899 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37868-37899 0 1.0
NZ_CP044377_1 1.10|37868|32|NZ_CP044377|CRISPRCasFinder 37868-37899 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243231-243262 0 1.0
NZ_CP044377_1 1.10|37868|32|NZ_CP044377|CRISPRCasFinder 37868-37899 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30578-30609 0 1.0
NZ_CP044377_1 1.10|37868|32|NZ_CP044377|CRISPRCasFinder 37868-37899 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254084-254115 0 1.0
NZ_CP044377_1 1.10|37868|32|NZ_CP044377|CRISPRCasFinder 37868-37899 32 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 32888-32919 0 1.0
NZ_CP044377_1 1.10|37868|32|NZ_CP044377|CRISPRCasFinder 37868-37899 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43326-43357 0 1.0
NZ_CP044377_1 1.10|37868|32|NZ_CP044377|CRISPRCasFinder 37868-37899 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100216-100247 0 1.0
NZ_CP044377_1 1.10|37868|32|NZ_CP044377|CRISPRCasFinder 37868-37899 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84459-84490 0 1.0
NZ_CP044377_1 1.10|37868|32|NZ_CP044377|CRISPRCasFinder 37868-37899 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84826-84857 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25068-25098 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5511-5541 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 322970-323000 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33313-33343 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30579-30609 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30697-30727 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37929-37959 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30639-30669 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61010-61040 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102648-102678 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55166-55196 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49129-49159 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33314-33344 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43387-43417 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149045-149075 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8208-8238 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138444-138474 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277382-277412 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95294-95324 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127643-127673 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117187-117217 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100156-100186 0 1.0
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84766-84796 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305718-305748 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32873-32903 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17283-17313 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8049-8079 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25854-25884 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33939-33969 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30761-30791 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32873-32903 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8236-8266 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30511-30541 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142260-142290 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37989-38019 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243112-243142 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168598-168628 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253963-253993 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30511-30541 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32873-32903 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43448-43478 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100095-100125 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32838-32868 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130865-130895 0 1.0
NZ_CP044377_1 1.12|37989|31|NZ_CP044377|CRISPRCasFinder 37989-38019 31 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130949-130979 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305658-305688 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32933-32963 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17223-17253 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8109-8139 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25914-25944 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33999-34029 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30821-30851 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32933-32963 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8295-8325 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30571-30601 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142200-142230 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38049-38079 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243052-243082 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168658-168688 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253903-253933 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30571-30601 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32933-32963 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43508-43538 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100035-100065 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32898-32928 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130925-130955 0 1.0
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131009-131039 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148983-149014 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8146-8177 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25129-25160 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5572-5603 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 322788-322819 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33131-33162 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17161-17192 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30640-30671 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8170-8201 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138382-138413 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8356-8387 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277320-277351 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30758-30789 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95232-95263 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127581-127612 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38109-38140 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242990-243021 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117125-117156 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188768-188799 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61071-61102 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253842-253873 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 284105-284136 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102709-102740 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55227-55258 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49190-49221 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33132-33163 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43569-43600 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99973-100004 0 1.0
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84704-84735 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148921-148953 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8084-8116 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25190-25222 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5633-5665 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17099-17131 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30701-30733 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8231-8263 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138320-138352 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8416-8448 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277258-277290 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30819-30851 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95170-95202 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 263861-263893 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127519-127551 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38170-38202 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242929-242961 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117063-117095 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61132-61164 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253780-253812 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102770-102802 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55288-55320 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49251-49283 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43630-43662 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99911-99943 0 1.0
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84642-84674 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305596-305627 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148860-148891 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32994-33025 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8023-8054 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25252-25283 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5695-5726 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17038-17069 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30763-30794 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8293-8324 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25975-26006 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 34060-34091 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30882-30913 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32994-33025 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138259-138290 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8477-8508 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30632-30663 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277197-277228 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30881-30912 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142138-142169 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95109-95140 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 263923-263954 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127458-127489 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38232-38263 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242868-242899 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117002-117033 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30700-30731 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168719-168750 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61194-61225 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253719-253750 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30632-30663 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32994-33025 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102832-102863 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55350-55381 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49313-49344 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43692-43723 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99850-99881 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84581-84612 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32959-32990 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130986-131017 0 1.0
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131070-131101 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305534-305565 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 33056-33087 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 26037-26068 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 34122-34153 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30944-30975 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 33056-33087 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30694-30725 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142076-142107 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38293-38324 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242807-242838 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168781-168812 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253658-253689 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30694-30725 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 33056-33087 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43754-43785 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 33021-33052 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 131048-131079 0 1.0
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131132-131163 0 1.0
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38354-38385 0 1.0
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242746-242777 0 1.0
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253597-253628 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305414-305443 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148616-148645 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 33178-33207 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 7779-7808 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25498-25527 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5941-5970 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 323213-323242 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33556-33585 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 16855-16884 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 31009-31038 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8477-8506 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 26159-26188 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 34244-34273 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 31066-31095 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 33178-33207 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138014-138043 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8661-8690 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30816-30845 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 31127-31156 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 141956-141985 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 94865-94894 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 264108-264137 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127214-127243 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38415-38444 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242687-242716 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 116758-116787 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30946-30975 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168903-168932 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188648-188677 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61440-61469 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253538-253567 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30816-30845 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 283985-284014 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 33178-33207 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 103078-103107 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55596-55625 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49559-49588 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33557-33586 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43876-43905 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99545-99574 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84216-84245 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29554-29583 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 33143-33172 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 131170-131199 0 1.0
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131254-131283 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_014312 Klebsiella pneumoniae plasmid pKP048, complete sequence 108001-108032 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305352-305383 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KY270850 Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence 37100-37131 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KY270849 Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence 77872-77903 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KY174332 Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence 92501-92532 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP032195 Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence 57431-57462 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 67176-67207 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KX236178 Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence 43631-43662 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP040995 Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence 69082-69113 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 60376-60407 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148554-148585 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 104966-104997 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 113808-113839 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 145894-145925 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP028805 Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence 62268-62299 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 33238-33269 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP041928 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence 175980-176011 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 7717-7748 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25558-25589 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 6001-6032 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 323273-323304 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33616-33647 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 16793-16824 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP025468 Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence 54458-54489 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 136621-136652 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 31069-31100 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 136935-136966 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_023334 Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence 135693-135724 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 166562-166593 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP015135 Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence 96530-96561 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN891683 Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence 60377-60408 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP041949 Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence 107609-107640 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 135537-135568 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_FO834904 Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence 31523-31554 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8537-8568 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP029591 Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence 6183-6214 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 50757-50788 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 26219-26250 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 34304-34335 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_016966 Klebsiella pneumoniae plasmid pUUH239.2, complete sequence 139290-139321 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 127083-127114 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 126281-126312 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP009275 Klebsiella variicola strain DX120E plasmid pKV1, complete sequence 100194-100225 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 6523-6554 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 81595-81626 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 31126-31157 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 71054-71085 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP012572 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence 68282-68313 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 118319-118350 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 136621-136652 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP036193 Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence 119000-119031 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 33238-33269 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 303969-304000 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 72164-72195 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP031851 Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence 104605-104636 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 138481-138512 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 137952-137983 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8721-8752 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP027044 Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence 20785-20816 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052526 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence 113092-113123 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044038 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence 27939-27970 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 97826-97857 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_022609 Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence 73595-73626 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 40227-40258 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052287 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence 170380-170411 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018999 Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence 72171-72202 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_011281 Klebsiella variicola strain 342 plasmid pKP91, complete sequence 79296-79327 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30876-30907 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 68281-68312 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP034322 Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence 104971-105002 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP050379 Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence 181513-181544 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP035907 Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence 119008-119039 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP025516 Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence 119641-119672 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP024459 Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence 140585-140616 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 99780-99811 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 31187-31218 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP023916 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence 62028-62059 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 158086-158117 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP020903 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence 165526-165557 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026163 Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence 117965-117996 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052535 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence 128459-128490 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_LR025093 Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence 36053-36084 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP042521 Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence 129935-129966 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP032836 Klebsiella pneumoniae strain INF237 plasmid pINF237_03, complete sequence 52308-52339 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 141894-141925 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 94803-94834 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 264168-264199 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP032186 Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence 19258-19289 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127152-127183 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN842291 Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence 97207-97238 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044390 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence 123087-123118 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044394 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence 122056-122087 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 106260-106291 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38474-38505 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044378 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence 124308-124339 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242625-242656 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044382 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence 97595-97626 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP042883 Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence 127742-127773 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 116696-116727 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 31006-31037 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 148957-148988 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052435 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence 83356-83387 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052438 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence 41476-41507 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168963-168994 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_016846 Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence 65672-65703 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188586-188617 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_LR025089 Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence 41282-41313 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61500-61531 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253477-253508 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044387 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence 118818-118849 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30876-30907 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 149489-149520 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 283923-283954 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 33238-33269 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_LR792629 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_II 144016-144047 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_LR792630 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I 31523-31554 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP036188 Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence 153223-153254 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MK649823 Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence 56849-56880 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MK649827 Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence 53712-53743 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MK649828 Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence 126630-126661 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MK649829 Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence 147256-147287 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_LT994840 Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence 21409-21440 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 103138-103169 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044049 Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence 74608-74639 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55656-55687 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN891678 Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-KPC, complete sequence 54498-54529 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_LR130540 Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2 125610-125641 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49619-49650 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33617-33648 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 119162-119193 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MH909340 Klebsiella pneumoniae strain A1763 plasmid pA1763-KPC, complete sequence 68220-68251 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MK413718 Klebsiella pneumoniae strain 427113 plasmid p427113-2, complete sequence 35897-35928 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MH477636 Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence 56046-56077 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MK036887 Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence 74191-74222 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43936-43967 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99483-99514 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_019390 Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence 171715-171746 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP014777 Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence 109297-109328 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84154-84185 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29492-29523 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN824000 Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence 170377-170408 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 33203-33234 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MG288676 Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence 120679-120710 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MG736312 Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence 92895-92926 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 131230-131261 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131314-131345 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 81649-81680 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP035204 Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence 63247-63278 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN661404 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence 62362-62393 0 1.0
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MT108210 Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence 81109-81140 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 306131-306168 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17635-17672 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17696-17733 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 115037-115074 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 201058-201095 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223962-223999 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 139040-139077 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300573-300610 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313816-313853 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142558-142595 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243828-243865 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114765-114802 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254617-254654 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100569-100606 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85362-85399 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 30149-30186 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42993-43030 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59834-59871 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53121-53158 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32453-32490 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 251827-251864 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7634-7671 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7694-7731 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25434-25471 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33519-33556 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30341-30378 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 30600-30637 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32453-32490 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221198-221235 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28069-28106 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 7758-7795 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136334-136371 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30091-30128 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62331-62368 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332609-332646 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229687-229724 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28336-28373 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 10971-11008 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 3767-3804 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37329-37366 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 144825-144862 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168178-168215 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30091-30128 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32453-32490 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53655-53692 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132575-132612 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132210-132247 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29357-29394 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 42784-42821 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57061-57098 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32479-32516 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130323-130360 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28312-28349 0 1.0
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130407-130444 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149397-149434 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53243-53280 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8560-8597 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24709-24746 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5152-5189 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17513-17550 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30220-30257 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 251888-251925 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114976-115013 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 200997-201034 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7815-7852 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223840-223877 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227617-227654 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221320-221357 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28191-28228 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138918-138955 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 7880-7917 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300451-300488 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8154-8191 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136395-136432 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62392-62429 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332731-332768 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229748-229785 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28519-28556 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313755-313792 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277741-277778 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30216-30253 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11154-11191 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 3828-3865 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42138-42175 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95646-95683 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 128117-128154 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37390-37427 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243706-243743 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114704-114741 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117539-117576 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 144947-144984 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30158-30195 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60651-60688 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254556-254593 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53716-53753 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102289-102326 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 54807-54844 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132697-132734 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 48770-48807 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 279306-279343 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29479-29516 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 42845-42882 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57244-57281 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85240-85277 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 30027-30064 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130445-130482 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130529-130566 0 1.0
NZ_CP044377_1 1.22|37390|38|NZ_CP044377|CRT 37390-37427 38 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59773-59810 0 1.0
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37451-37487 0 1.0
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 42906-42942 0 1.0
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130506-130542 0 1.0
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130590-130626 0 1.0
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243646-243682 0 1.0
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254497-254533 0 1.0
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29967-30003 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114855-114891 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 200876-200912 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300330-300366 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8033-8069 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313634-313670 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114583-114619 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75801-75837 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254436-254472 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42872-42908 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59652-59688 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53365-53401 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252010-252046 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31528-31564 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227739-227775 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28313-28349 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136517-136553 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62514-62550 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332853-332889 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229870-229906 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28641-28677 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11276-11312 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 3949-3985 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42260-42296 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37511-37547 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145069-145105 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53838-53874 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132819-132855 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132332-132368 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29601-29637 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 42967-43003 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57366-57402 0 1.0
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28556-28592 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 306009-306046 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17391-17428 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138796-138833 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142436-142473 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243523-243560 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254374-254411 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100447-100484 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85118-85155 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29905-29942 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32575-32612 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7934-7971 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25556-25593 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33641-33678 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30463-30500 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32575-32612 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8000-8037 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30213-30250 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37571-37608 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168300-168337 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30213-30250 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32575-32612 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43028-43065 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32540-32577 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130567-130604 0 1.0
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130651-130688 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305955-305985 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149221-149251 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8384-8414 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17337-17367 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138742-138772 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95470-95500 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127941-127971 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243469-243499 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117363-117393 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254320-254350 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100393-100423 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85064-85094 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29851-29881 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32636-32666 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24892-24922 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5335-5365 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30403-30433 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7995-8025 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25617-25647 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33702-33732 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30524-30554 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32636-32666 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8060-8090 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30274-30304 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30399-30429 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37632-37662 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30341-30371 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168361-168391 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60834-60864 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30274-30304 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32636-32666 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102472-102502 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 54990-55020 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 48953-48983 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43089-43119 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32601-32631 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130628-130658 0 1.0
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130712-130742 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53487-53524 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32690-32727 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24946-24983 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5389-5426 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30457-30494 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252131-252168 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25671-25708 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33756-33793 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31650-31687 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30578-30615 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32690-32727 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227861-227898 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221381-221418 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28435-28472 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8114-8151 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136639-136676 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30328-30365 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62636-62673 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332975-333012 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229992-230029 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28763-28800 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30453-30490 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11398-11435 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 4071-4108 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42382-42419 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37686-37723 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145191-145228 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30395-30432 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168415-168452 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60888-60925 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30328-30365 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32690-32727 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53960-53997 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102526-102563 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55044-55081 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132941-132978 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49007-49044 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132454-132491 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29723-29760 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43143-43180 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57488-57525 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32655-32692 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130682-130719 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28678-28715 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130766-130803 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305894-305931 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149160-149197 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8323-8360 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114732-114769 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 200753-200790 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223779-223816 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138681-138718 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300207-300244 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 7910-7947 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313511-313548 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277558-277595 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95409-95446 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127880-127917 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243408-243445 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114460-114497 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117302-117339 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75678-75715 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254259-254296 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100332-100369 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85003-85040 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29790-29827 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42749-42786 0 1.0
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59529-59566 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305834-305870 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149100-149136 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8263-8299 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114672-114708 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 200693-200729 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138621-138657 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300147-300183 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 7850-7886 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313452-313488 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277498-277534 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142376-142412 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95349-95385 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127820-127856 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243348-243384 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114400-114436 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117242-117278 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75618-75654 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254200-254236 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100272-100308 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84943-84979 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29730-29766 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42689-42725 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59469-59505 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53548-53584 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32751-32787 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25007-25043 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5450-5486 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 323031-323067 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33374-33410 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30518-30554 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252192-252228 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25732-25768 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33817-33853 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31711-31747 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30639-30675 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32751-32787 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227922-227958 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28496-28532 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136700-136736 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30389-30425 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62697-62733 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 333036-333072 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 230053-230089 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28824-28860 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30514-30550 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11459-11495 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 4131-4167 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42443-42479 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37747-37783 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145252-145288 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30456-30492 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168476-168512 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60949-60985 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30389-30425 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32751-32787 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 54021-54057 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102587-102623 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55105-55141 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 133002-133038 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49068-49104 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132515-132551 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33375-33411 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29784-29820 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43204-43240 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57549-57585 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32716-32752 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130743-130779 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28739-28775 0 1.0
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130827-130863 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32812-32849 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252253-252290 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 325946-325983 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 159024-159061 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25793-25830 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33878-33915 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31772-31809 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30700-30737 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32812-32849 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 228043-228080 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28557-28594 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136761-136798 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30450-30487 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62758-62795 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 230114-230151 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28885-28922 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 115847-115884 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30575-30612 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11520-11557 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 4192-4229 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42504-42541 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37807-37844 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30517-30554 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168537-168574 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30450-30487 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32812-32849 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 54082-54119 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 133063-133100 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132576-132613 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29845-29882 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43265-43302 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57609-57646 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32777-32814 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130804-130841 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28800-28837 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130888-130925 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305772-305809 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114610-114647 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138559-138596 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 10955-10992 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 7728-7765 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313391-313428 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142314-142351 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127758-127795 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243286-243323 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114338-114375 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254139-254176 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84514-84551 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84881-84918 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29668-29705 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42627-42664 0 1.0
NZ_CP044377_1 1.29|37807|38|NZ_CP044377|CRT 37807-37844 38 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59408-59445 0 1.0
NZ_CP044377_1 1.30|37868|38|NZ_CP044377|CRT 37868-37905 38 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138498-138535 0 1.0
NZ_CP044377_1 1.30|37868|38|NZ_CP044377|CRT 37868-37905 38 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277436-277473 0 1.0
NZ_CP044377_1 1.30|37868|38|NZ_CP044377|CRT 37868-37905 38 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127697-127734 0 1.0
NZ_CP044377_1 1.30|37868|38|NZ_CP044377|CRT 37868-37905 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243225-243262 0 1.0
NZ_CP044377_1 1.30|37868|38|NZ_CP044377|CRT 37868-37905 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254078-254115 0 1.0
NZ_CP044377_1 1.30|37868|38|NZ_CP044377|CRT 37868-37905 38 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100210-100247 0 1.0
NZ_CP044377_1 1.30|37868|38|NZ_CP044377|CRT 37868-37905 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84453-84490 0 1.0
NZ_CP044377_1 1.30|37868|38|NZ_CP044377|CRT 37868-37905 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84820-84857 0 1.0
NZ_CP044377_1 1.30|37868|38|NZ_CP044377|CRT 37868-37905 38 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 322544-322581 0 1.0
NZ_CP044377_1 1.30|37868|38|NZ_CP044377|CRT 37868-37905 38 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 32887-32924 0 1.0
NZ_CP044377_1 1.30|37868|38|NZ_CP044377|CRT 37868-37905 38 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30636-30673 0 1.0
NZ_CP044377_1 1.30|37868|38|NZ_CP044377|CRT 37868-37905 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37868-37905 0 1.0
NZ_CP044377_1 1.30|37868|38|NZ_CP044377|CRT 37868-37905 38 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30578-30615 0 1.0
NZ_CP044377_1 1.30|37868|38|NZ_CP044377|CRT 37868-37905 38 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 32888-32925 0 1.0
NZ_CP044377_1 1.30|37868|38|NZ_CP044377|CRT 37868-37905 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43326-43363 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25068-25104 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5511-5547 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 322970-323006 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33313-33349 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30579-30615 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30697-30733 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37929-37965 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30639-30675 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61010-61046 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102648-102684 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55166-55202 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49129-49165 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33314-33350 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43387-43423 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149039-149075 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8202-8238 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138438-138474 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277376-277412 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95288-95324 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127637-127673 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117181-117217 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100150-100186 0 1.0
NZ_CP044377_1 1.31|37929|37|NZ_CP044377|CRT 37929-37965 37 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84760-84796 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305712-305748 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32873-32909 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17277-17313 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8049-8085 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25854-25890 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33939-33975 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30761-30797 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32873-32909 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8236-8272 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30511-30547 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142254-142290 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37989-38025 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243106-243142 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168598-168634 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253957-253993 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30511-30547 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32873-32909 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43448-43484 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100089-100125 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32838-32874 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130865-130901 0 1.0
NZ_CP044377_1 1.32|37989|37|NZ_CP044377|CRT 37989-38025 37 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130949-130985 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32933-32969 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8109-8145 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25914-25950 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33999-34035 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30821-30857 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32933-32969 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8295-8331 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30571-30607 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38049-38085 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168658-168694 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30571-30607 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32933-32969 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43508-43544 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32898-32934 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130925-130961 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131009-131045 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305652-305688 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17217-17253 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142194-142230 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243046-243082 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253897-253933 0 1.0
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100029-100065 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148977-149014 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8140-8177 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25129-25166 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5572-5609 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 322788-322825 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33131-33168 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17155-17192 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30640-30677 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8170-8207 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138376-138413 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8356-8393 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277314-277351 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30758-30795 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95226-95263 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127575-127612 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38109-38146 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242984-243021 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117119-117156 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188762-188799 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61071-61108 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253836-253873 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 284099-284136 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102709-102746 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55227-55264 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49190-49227 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33132-33169 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43569-43606 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99967-100004 0 1.0
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84698-84735 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148915-148953 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8078-8116 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25190-25228 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5633-5671 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17093-17131 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30701-30739 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8231-8269 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138314-138352 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8416-8454 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277252-277290 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30819-30857 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95164-95202 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 263861-263899 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127513-127551 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38170-38208 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242923-242961 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117057-117095 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61132-61170 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253774-253812 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102770-102808 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55288-55326 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49251-49289 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43630-43668 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99905-99943 0 1.0
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84636-84674 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305590-305627 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148854-148891 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32994-33031 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8017-8054 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25252-25289 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5695-5732 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17032-17069 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30763-30800 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8293-8330 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25975-26012 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 34060-34097 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30882-30919 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32994-33031 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138253-138290 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8477-8514 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30632-30669 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277191-277228 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30881-30918 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142132-142169 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95103-95140 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 263923-263960 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127452-127489 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38232-38269 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242862-242899 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 116996-117033 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30700-30737 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168719-168756 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61194-61231 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253713-253750 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30632-30669 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32994-33031 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102832-102869 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55350-55387 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49313-49350 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43692-43729 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99844-99881 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84575-84612 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32959-32996 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130986-131023 0 1.0
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131070-131107 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305529-305565 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142071-142107 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242802-242838 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253653-253689 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 33056-33092 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 26037-26073 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 34122-34158 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30944-30980 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 33056-33092 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30694-30730 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38293-38329 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168781-168817 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30694-30730 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 33056-33092 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43754-43790 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 33021-33057 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 131048-131084 0 1.0
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131132-131168 0 1.0
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38353-38390 0 1.0
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242741-242778 0 1.0
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253592-253629 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305409-305444 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148611-148646 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 33177-33212 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 7774-7809 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25497-25532 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5940-5975 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 16850-16885 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 31008-31043 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8476-8511 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 26158-26193 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 34243-34278 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 31065-31100 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 33177-33212 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138009-138044 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8660-8695 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30815-30850 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 31126-31161 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 141951-141986 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 94860-94895 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 264107-264142 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127209-127244 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38414-38449 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242682-242717 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 116753-116788 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30945-30980 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168902-168937 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61439-61474 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253533-253568 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30815-30850 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 33177-33212 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 103077-103112 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55595-55630 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49558-49593 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43875-43910 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99540-99575 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84211-84246 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29549-29584 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 33142-33177 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 131169-131204 0 1.0
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131253-131288 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305347-305384 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148549-148586 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 33237-33274 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 7712-7749 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25557-25594 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 6000-6037 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 323272-323309 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33615-33652 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 16788-16825 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 31068-31105 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8536-8573 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 26218-26255 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 34303-34340 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 31125-31162 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 33237-33274 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 137947-137984 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8720-8757 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30875-30912 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 31186-31223 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 141889-141926 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 94798-94835 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 264167-264204 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127147-127184 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38473-38510 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242620-242657 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 116691-116728 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 31005-31042 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168962-168999 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188581-188618 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61499-61536 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253472-253509 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30875-30912 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 283918-283955 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 33237-33274 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 103137-103174 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55655-55692 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49618-49655 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33616-33653 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43935-43972 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99478-99515 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84149-84186 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29487-29524 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 33202-33239 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 131229-131266 0 1.0
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131313-131350 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305286-305323 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148488-148525 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 7651-7688 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 16727-16764 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 137886-137923 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 276946-276983 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 141828-141865 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 94737-94774 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127086-127123 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 242559-242596 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 116630-116667 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 253411-253448 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99417-99454 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84088-84125 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29426-29463 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP034040 Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence 31412-31449 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 33298-33335 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25618-25655 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 6061-6098 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 31129-31166 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8597-8634 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 26279-26316 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 34364-34401 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 31186-31223 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 33298-33335 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8781-8818 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30936-30973 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 31247-31284 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 264228-264265 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 38534-38571 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 31066-31103 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 169023-169060 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61560-61597 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30936-30973 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 33298-33335 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 103198-103235 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55716-55753 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49679-49716 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43996-44033 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 33263-33300 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 131290-131327 0 1.0
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131374-131411 0 1.0
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227495-227526 1 0.969
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8282-8313 1 0.969
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_CP050828 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-2, complete sequence 8408-8439 1 0.969
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53304-53334 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24770-24800 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5213-5243 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30281-30311 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 251949-251979 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227678-227708 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28252-28282 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136456-136486 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62453-62483 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332792-332822 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229809-229839 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28580-28610 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30277-30307 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11215-11245 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 3889-3919 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42199-42229 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145008-145038 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30219-30249 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60712-60742 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53777-53807 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102350-102380 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 54868-54898 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132758-132788 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 48831-48861 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29540-29570 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57305-57335 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28495-28525 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149343-149373 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8506-8536 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114922-114952 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 200943-200973 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138864-138894 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300397-300427 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8100-8130 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313701-313731 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277687-277717 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95592-95622 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 128063-128093 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114650-114680 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117485-117515 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75868-75898 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85186-85216 1 0.968
NZ_CP044377_1 1.3|37451|31|NZ_CP044377|CRISPRCasFinder 37451-37481 31 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59719-59749 1 0.968
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 47736-47767 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 51858-51889 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP012994 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence 89482-89513 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 59948-59979 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 59947-59978 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 121304-121335 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP041645 Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence 28955-28986 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_FO834905 Klebsiella pneumoniae strain Kp52.145 plasmid II, complete sequence 70479-70510 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP012989 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence 20391-20422 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 51833-51864 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 89428-89459 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 106560-106591 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP031815 Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence 45101-45132 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 91892-91923 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP030066 Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence 96685-96716 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 73039-73070 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 203897-203928 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 64954-64985 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 32127-32158 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP032173 Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence 20609-20640 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 148084-148115 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 130786-130817 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_LR792629 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_II 68783-68814 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 78853-78884 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP025683 Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence 85964-85995 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 98428-98459 1 0.969
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP035203 Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence 121053-121084 1 0.969
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8175-8205 1 0.968
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243171-243201 1 0.968
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254024-254054 1 0.968
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188891-188921 1 0.968
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 284228-284258 1 0.968
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP026163 Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence 57598-57629 1 0.969
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP044390 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence 53913-53944 1 0.969
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP044394 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence 53975-54006 1 0.969
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 84891-84922 1 0.969
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP044378 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence 56243-56274 1 0.969
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP044382 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence 30261-30292 1 0.969
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP044387 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence 48467-48498 1 0.969
NZ_CP044377_1 1.14|38109|32|NZ_CP044377|CRISPRCasFinder 38109-38140 32 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 28651-28682 1 0.969
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NZ_CP022925 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B 22871-22902 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148736-148767 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 7899-7930 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25376-25407 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5819-5850 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 322241-322272 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 32584-32615 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30887-30918 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP048109 Klebsiella michiganensis strain BD177 plasmid unnamed1 144123-144154 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138134-138165 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277073-277104 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 31005-31036 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 94985-95016 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127334-127365 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 116878-116909 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30824-30855 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61318-61349 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102956-102987 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55474-55505 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49437-49468 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 32585-32616 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99665-99696 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99726-99757 1 0.969
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84336-84367 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305473-305504 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148675-148706 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 33117-33148 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 7838-7869 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25437-25468 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5880-5911 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 323153-323184 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33496-33527 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 16914-16945 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30948-30979 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 325824-325855 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8416-8447 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 158902-158933 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 26098-26129 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 34183-34214 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 31005-31036 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 33117-33148 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138073-138104 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8601-8632 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 11083-11114 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30755-30786 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 115725-115756 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277012-277043 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 31066-31097 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NC_016980 Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence 240165-240196 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142015-142046 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 94924-94955 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 264047-264078 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127273-127304 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 116817-116848 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30885-30916 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168842-168873 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188707-188738 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61379-61410 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30755-30786 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 284044-284075 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 33117-33148 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 103017-103048 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP044049 Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence 207770-207801 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55535-55566 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49498-49529 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33497-33528 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43815-43846 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99604-99635 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84275-84306 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29613-29644 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 33082-33113 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 131109-131140 1 0.969
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131193-131224 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 97049-97080 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026280 Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence 79497-79528 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 34081-34112 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 72947-72978 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 173730-173761 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 109128-109159 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 88236-88267 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 113985-114016 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 45986-46017 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KY271407 Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence 65578-65609 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP032198 Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence 28384-28415 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KX636095 Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence 264340-264371 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 89347-89378 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 87633-87664 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 7561-7592 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 89347-89378 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 102637-102668 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KP125893 Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence 98787-98818 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KU295132 Escherichia coli strain BK34397 plasmid pBK34397, complete sequence 77673-77704 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 91695-91726 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP021753 Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence 30778-30809 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 61575-61606 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 70051-70082 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 45921-45952 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 37023-37054 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 67801-67832 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 165090-165121 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 48383-48414 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 23345-23376 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP048351 Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence 121869-121900 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP034282 Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence 168216-168247 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP037744 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence 74432-74463 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 196468-196499 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 155292-155323 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 86989-87020 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 54782-54813 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 5601-5632 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 160910-160941 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 93159-93190 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 165773-165804 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 47801-47832 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 225045-225076 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 79451-79482 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 60415-60446 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 195533-195564 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 41107-41138 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP020523 Escherichia coli strain 190 plasmid unnamed2, complete sequence 71604-71635 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052566 Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence 108252-108283 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 73830-73861 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_021502 Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence 114682-114713 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP028954 Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence 39058-39089 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 7583-7614 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 93277-93308 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP033628 Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence 85729-85760 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 46038-46069 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_019389 Klebsiella pneumoniae plasmid pKDO1, complete sequence 53234-53265 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_023332 Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence 136526-136557 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 HG969996 Klebsiella pneumoniae plasmid pIT-12C47, complete sequence 77704-77735 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 92493-92524 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 HG969998 Klebsiella pneumoniae plasmid pIT-11C07, complete sequence 82684-82715 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 128775-128806 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP025039 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence 99162-99193 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP025040 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence 31953-31984 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 195424-195455 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP034777 Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence 81383-81414 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 89348-89379 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 83867-83898 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP031811 Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence 135487-135518 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 360016-360047 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 121086-121117 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN891675 Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence 63167-63198 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 70819-70850 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 44590-44621 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP027056 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB 87947-87978 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 266012-266043 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 5601-5632 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 226209-226240 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_019155 Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence 45232-45263 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_019165 Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence 47974-48005 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 26917-26948 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_015154 Klebsiella pneumoniae plasmid pc15-k, complete sequence 75081-75112 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 90173-90204 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP028177 Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence 93112-93143 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 62365-62396 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP023840 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence 39929-39960 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018815 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence 139050-139081 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052148 Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence 153991-154022 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 93157-93188 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026271 Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence 70270-70301 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018992 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence 29115-29146 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 38609-38640 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 89348-89379 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP027614 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence 47902-47933 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP027616 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence 9250-9281 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 38088-38119 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 74525-74556 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 62373-62404 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 45980-46011 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 233597-233628 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 42976-43007 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP021959 Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence 39381-39412 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_025131 Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence 41108-41139 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 41639-41670 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP047680 Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence 64367-64398 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP029583 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence 71972-72003 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 66976-67007 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 179264-179295 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_LT991960 Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3 41738-41769 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP041640 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence 131852-131883 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 20844-20875 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 123054-123085 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 121153-121184 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 71689-71720 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 200797-200828 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 189992-190023 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026174 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence 7033-7064 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026181 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence 36901-36932 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 63691-63722 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 26022-26053 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 88691-88722 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 93159-93190 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 206771-206802 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP010363 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence 127218-127249 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 64284-64315 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP041648 Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence 98010-98041 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP021166 Klebsiella pneumoniae strain 203 plasmid p203, complete sequence 124685-124716 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 37929-37960 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 132033-132064 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 KY940546 Klebsiella pneumoniae plasmid pUCLA3, complete sequence 65783-65814 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 60380-60411 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP021545 Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence 114167-114198 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 50030-50061 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP021686 Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence 1852-1883 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP024040 Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence 74672-74703 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 233919-233950 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP033947 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence 102747-102778 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 190769-190800 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 KT896504 Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence 131216-131247 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 194382-194413 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052525 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence 112814-112845 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP017851 Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence 64494-64525 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_AP019690 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence 63597-63628 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP017286 Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence 78912-78943 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 LT009689 Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence 46177-46208 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 149894-149925 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP028553 Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence 73458-73489 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP009879 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence 94326-94357 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 93159-93190 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP046950 Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence 149066-149097 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP046952 Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence 74062-74093 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP046942 Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697 92567-92598 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP046943 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed4 9520-9551 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP006922 Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence 42522-42553 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP032181 Citrobacter freundii strain AR_0116 plasmid unnamed3, complete sequence 53224-53255 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP009115 Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence 62249-62280 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 74851-74882 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP048381 Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence 126036-126067 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026396 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence 90621-90652 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052288 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence 137178-137209 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP017281 Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence 61344-61375 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 178017-178048 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP022825 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence 73295-73326 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP025966 Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence 85458-85489 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP020064 Klebsiella pneumoniae strain AR_0117 plasmid unitig_3, complete sequence 41508-41539 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP015387 Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence 41108-41139 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 41639-41670 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP024516 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence 189026-189057 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 170339-170370 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052276 Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence 138411-138442 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 82057-82088 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 195416-195447 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP034131 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence 111959-111990 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 105680-105711 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 194227-194258 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052298 Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence 140485-140516 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_021199 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence 41838-41869 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP046382 Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence 149100-149131 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP046384 Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence 74062-74093 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052540 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence 52213-52244 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018670 Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence 153220-153251 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP030342 Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence 107719-107750 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 116730-116761 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 145362-145393 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 252902-252933 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MF116002 Uncultured bacterium plasmid pLGP4 clone J53, complete sequence 163366-163397 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 121905-121936 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP045678 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence 50089-50120 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052441 Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence 202872-202903 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052534 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence 217890-217921 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026212 Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence 15620-15651 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP021857 Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence 102586-102617 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP024500 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence 204839-204870 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP029724 Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence 155586-155617 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP034137 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence 126424-126455 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN824002 Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence 191036-191067 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 81545-81576 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 93372-93403 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP024508 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence 189572-189603 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP024510 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence 73541-73572 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP032189 Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence 72637-72668 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 17856-17887 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN823985 Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence 90214-90245 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 18328-18359 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 216046-216077 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052506 Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence 153991-154022 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052214 Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence 131637-131668 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP015824 Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence 12971-13002 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 67436-67467 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044395 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence 75352-75383 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 223348-223379 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 72729-72760 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052504 Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence 199441-199472 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052263 Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence 131887-131918 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 109267-109298 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP011621 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence 33761-33792 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 38185-38216 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP027158 Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence 76630-76661 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP025010 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence 79139-79170 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 122025-122056 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 192660-192691 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052521 Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence 199634-199665 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP023948 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence 149100-149131 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 179408-179439 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP041937 Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence 44793-44824 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052436 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence 86994-87025 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052140 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence 114802-114833 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 HG969995 Klebsiella pneumoniae plasmid pIT-01C03, complete sequence 93162-93193 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP035211 Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence 101749-101780 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 84798-84829 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP024544 Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence 49273-49304 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP035124 Escherichia coli strain EC25 plasmid pEC25-1, complete sequence 23080-23111 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052499 Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence 194398-194429 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 51629-51660 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 63900-63931 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 16663-16694 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP024483 Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence 204842-204873 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP034085 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence 71692-71723 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP054266 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence 43607-43638 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 93142-93173 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_023905 Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence 95567-95598 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 93160-93191 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 45921-45952 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP021951 Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence 2638-2669 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP028717 Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence 30787-30818 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 136969-137000 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_AP019401 Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence 81041-81072 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 93160-93191 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 28516-28547 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 2457-2488 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 58503-58534 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 61575-61606 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026717 Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence 52418-52449 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052243 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence 207950-207981 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP028389 Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence 122248-122279 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MK649824 Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence 99569-99600 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MK649826 Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence 211366-211397 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP015383 Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence 156454-156485 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP030071 Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence 76809-76840 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 86079-86110 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 46676-46707 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052173 Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence 235000-235031 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 71090-71121 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP015393 Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence 124446-124477 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP027696 Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence 151230-151261 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_LT882698 Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence 283860-283891 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018955 Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence 6071-6102 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP047634 Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence 132770-132801 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP047635 Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence 107385-107416 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052337 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence 184733-184764 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052307 Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence 138260-138291 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MK262711 Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence 5883-5914 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MK104259 Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence 98189-98220 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MK167987 Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence 117978-118009 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 127599-127630 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 64967-64998 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MN543570 Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence 96780-96811 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP044045 Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence 38116-38147 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN657251 Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence 61945-61976 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052279 Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence 215164-215195 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 81959-81990 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 194134-194165 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 42877-42908 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MH464586 Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence 70416-70447 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN657248 Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence 101968-101999 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 178972-179003 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 36952-36983 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MF156708 Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence 95906-95937 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MF156696 Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence 206143-206174 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MG462728 Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence 156500-156531 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP035536 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence 67674-67705 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KY271404 Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence 205273-205304 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KY271406 Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence 55081-55112 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KY495890 Klebsiella pneumoniae strain 301 plasmid pKP301cro, complete sequence 26033-26064 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MF150084 Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence 187880-187911 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MG252894 Klebsiella pneumoniae strain Kpn-35963cz plasmid pKpn-35963cz, complete sequence 121836-121867 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MG764551 Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence 232541-232572 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_MG288683 Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence 89428-89459 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 LR134219 Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3 183577-183608 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP033755 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence 55003-55034 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 140525-140556 1 0.969
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP054255 Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence 59591-59622 1 0.969
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8276-8313 1 0.974
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227495-227532 1 0.974
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53304-53340 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24770-24806 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5213-5249 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30281-30317 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 251949-251985 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227678-227714 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28252-28288 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136456-136492 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62453-62489 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332792-332828 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229809-229845 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28580-28616 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30277-30313 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11215-11251 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 3889-3925 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42199-42235 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145008-145044 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30219-30255 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60712-60748 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53777-53813 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102350-102386 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 54868-54904 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132758-132794 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 48831-48867 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29540-29576 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57305-57341 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28495-28531 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149337-149373 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8500-8536 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114916-114952 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 200937-200973 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138858-138894 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300391-300427 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8094-8130 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313695-313731 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277681-277717 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95586-95622 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 128057-128093 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114644-114680 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117479-117515 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75862-75898 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85180-85216 1 0.973
NZ_CP044377_1 1.23|37451|37|NZ_CP044377|CRT 37451-37487 37 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59713-59749 1 0.973
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149275-149312 1 0.974
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8438-8475 1 0.974
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277619-277656 1 0.974
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95524-95561 1 0.974
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127995-128032 1 0.974
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117417-117454 1 0.974
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24831-24868 1 0.974
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5274-5311 1 0.974
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30342-30379 1 0.974
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30338-30375 1 0.974
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30280-30317 1 0.974
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60773-60810 1 0.974
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102411-102448 1 0.974
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 54929-54966 1 0.974
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 48892-48929 1 0.974
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8175-8211 1 0.973
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188885-188921 1 0.973
NZ_CP044377_1 1.33|38049|37|NZ_CP044377|CRT 38049-38085 37 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 284222-284258 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148731-148767 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 7894-7930 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP048109 Klebsiella michiganensis strain BD177 plasmid unnamed1 144118-144154 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138129-138165 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277068-277104 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 94980-95016 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127329-127365 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 116873-116909 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99660-99696 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99721-99757 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84331-84367 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25376-25412 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5819-5855 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 322241-322277 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 32584-32620 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30887-30923 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 31005-31041 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30824-30860 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61318-61354 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102956-102992 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55474-55510 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49437-49473 1 0.973
NZ_CP044377_1 1.37|38293|37|NZ_CP044377|CRT 38293-38329 37 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 32585-32621 1 0.973
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305468-305505 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 148670-148707 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 33116-33153 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 7833-7870 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 25436-25473 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5879-5916 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 323152-323189 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33495-33532 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 16909-16946 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30947-30984 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 325823-325860 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 8415-8452 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 158901-158938 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 26097-26134 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 34182-34219 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 31004-31041 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 33116-33153 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138068-138105 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8600-8637 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 11078-11115 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30754-30791 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 115724-115761 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277007-277044 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 31065-31102 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NC_016980 Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence 240160-240197 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142010-142047 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 94919-94956 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 264046-264083 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127268-127305 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 116812-116849 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30884-30921 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168841-168878 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188702-188739 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 61378-61415 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30754-30791 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 284039-284076 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 33116-33153 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 103016-103053 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55534-55571 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49497-49534 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33496-33533 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43814-43851 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 99599-99636 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 84270-84307 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29608-29645 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 33081-33118 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 131108-131145 1 0.974
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 131192-131229 1 0.974
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 323212-323247 1 0.972
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33555-33590 1 0.972
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188643-188678 1 0.972
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 283980-284015 1 0.972
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33556-33591 1 0.972
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP048109 Klebsiella michiganensis strain BD177 plasmid unnamed1 143935-143972 1 0.974
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 188337-188374 1 0.974
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 283674-283711 1 0.974
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 323455-323492 1 0.974
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 33798-33835 1 0.974
NZ_CP044377_1 1.41|38534|38|NZ_CP044377|CRT 38534-38571 38 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 33799-33836 1 0.974
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17459-17489 2 0.935
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7875-7905 2 0.935
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 7940-7970 2 0.935
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 284001-284032 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 167075-167106 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 259539-259570 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 46994-47025 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 158226-158257 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 57565-57596 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 56500-56531 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 113496-113527 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 34619-34650 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 55238-55269 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 238828-238859 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 103758-103789 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 67741-67772 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 213366-213397 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 52453-52484 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 192224-192255 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 224220-224251 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 55238-55269 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 56499-56530 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 73206-73237 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 72326-72357 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 62708-62739 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 5774-5805 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 56464-56495 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 155940-155971 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 156024-156055 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 94690-94721 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP034040 Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence 56856-56887 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP034040 Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence 30624-30655 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 150061-150092 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 208345-208376 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 123864-123895 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 62562-62593 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 53127-53158 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP031790 Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence 175199-175230 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP042869 Escherichia coli strain ATCC BAA-196 plasmid unnamed2, complete sequence 43893-43924 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 267005-267036 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 57611-57642 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 155462-155493 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 18345-18376 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 102543-102574 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 169018-169049 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 68447-68478 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 304526-304557 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 37552-37583 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 112844-112875 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 113505-113536 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 161172-161203 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_MK413719 Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence 111678-111709 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 160684-160715 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 93688-93719 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 160137-160168 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 50195-50226 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 12613-12644 2 0.938
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP028952 Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence 338520-338551 2 0.938
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP036322 Klebsiella pneumoniae strain VBA2172 plasmid pCol440I 6124-6148 2 0.92
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP038459 Escherichia coli strain EC-129 plasmid pEC129_6, complete sequence 2707-2731 2 0.92
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP044044 Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed2, complete sequence 6858-6882 2 0.92
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP025945 Escherichia coli strain SCEC020023 plasmid p1_020023, complete sequence 7509-7533 2 0.92
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP033949 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p3, complete sequence 4966-4990 2 0.92
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP034676 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_6kb, complete sequence 393-417 2 0.92
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP023840 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence 109028-109059 2 0.938
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP029583 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence 2873-2904 2 0.938
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP017851 Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence 21051-21082 2 0.938
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP017286 Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence 35469-35500 2 0.938
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP011587 Enterobacter asburiae strain CAV1043 plasmid pCAV1043-51, complete sequence 43562-43593 2 0.938
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP017281 Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence 17901-17932 2 0.938
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NC_011281 Klebsiella variicola strain 342 plasmid pKP91, complete sequence 67978-68009 2 0.938
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NC_021199 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence 138432-138463 2 0.938
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 128487-128518 2 0.938
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP024484 Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence 22387-22418 2 0.938
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 83959-83990 2 0.938
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 322423-322455 2 0.939
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 32766-32798 2 0.939
NZ_CP044377_1 1.15|38170|33|NZ_CP044377|CRISPRCasFinder 38170-38202 33 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 32767-32799 2 0.939
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 MK416007 Klebsiella phage ST405-OXA48phi1.2, complete genome 7776-7807 2 0.938
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 115286-115315 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 177243-177272 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 799-828 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 23252-23281 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 90076-90105 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 90712-90741 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP042535 Citrobacter freundii strain E51 plasmid pE51_001, complete sequence 192281-192310 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 150302-150331 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 92587-92616 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 103804-103833 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 34191-34220 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 136785-136814 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 333142-333171 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP013339 Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence 150847-150876 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP046613 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence 55463-55492 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 86408-86437 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP026720 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 plasmid unitig_2_pilon, complete sequence 73804-73833 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 122973-123002 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP018017 Kosakonia radicincitans DSM 16656 plasmid pKrDSM16656L, complete sequence 176086-176115 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 118750-118779 2 0.933
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NZ_CP028952 Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence 174398-174427 2 0.933
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 326890-326921 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 LK391770 Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67 53124-53155 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KY454639 Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence 97480-97511 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 75048-75079 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP015754 Klebsiella pneumoniae strain W14 plasmid unnamed1, complete sequence 115434-115465 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP021946 Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence 36620-36651 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 106868-106899 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP016160 Klebsiella pneumoniae strain TH1 isolate TH1 plasmid unnamed1, complete sequence 143322-143353 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 6896-6927 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 179752-179783 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP050837 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence 46182-46213 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 89403-89434 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 44885-44916 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026135 Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence 95873-95904 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 140537-140568 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 123886-123917 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 16736-16767 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 105168-105199 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_AP018754 Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence 59303-59334 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 104320-104351 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 193235-193266 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 139855-139886 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP035637 Enterobacter cloacae strain EN3600 plasmid unnamed5, complete sequence 56152-56183 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 172534-172565 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 275721-275752 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP033627 Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence 143320-143351 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 14339-14370 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 143345-143376 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 12424-12455 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 138500-138531 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 34156-34187 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP011981 Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence 104952-104983 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 107230-107261 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP011990 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence 19158-19189 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 138903-138934 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP027054 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII 156378-156409 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 MG700548 Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence 102024-102055 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 140537-140568 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 164236-164267 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 136621-136652 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 11685-11716 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 115021-115052 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 143864-143895 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 151431-151462 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 11762-11793 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP022692 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence 163725-163756 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 72651-72682 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP033823 Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence 108520-108551 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 170007-170038 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 103154-103185 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 151190-151221 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 165829-165860 2 0.938
NZ_CP044377_1 1.20|38474|32|NZ_CP044377|CRISPRCasFinder 38474-38505 32 NZ_CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 190870-190901 2 0.938
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17453-17489 2 0.946
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7875-7911 2 0.946
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 7940-7976 2 0.946
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP034040 Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence 30624-30661 2 0.947
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 322423-322461 2 0.949
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 32766-32804 2 0.949
NZ_CP044377_1 1.35|38170|39|NZ_CP044377|CRT 38170-38208 39 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 32767-32805 2 0.949
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 52516-52547 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 55644-55675 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 86795-86826 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 27997-28028 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 272857-272888 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 17354-17385 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 91000-91031 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 13497-13528 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 217844-217875 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 290303-290334 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 157366-157397 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 85273-85304 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 252629-252660 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 141031-141062 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 292792-292823 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NC_016980 Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence 217074-217105 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 287557-287588 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 24795-24826 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 91829-91860 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 77698-77729 3 0.906
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 37708-37739 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP018674 Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence 43520-43551 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_KR822246 Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence 5208-5239 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_KJ958926 Klebsiella pneumoniae strain Kpn-3002cz plasmid pB-3002cz, complete sequence 4882-4913 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_LN824135 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671 32898-32929 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP015502 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence 24918-24949 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP025214 Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence 10160-10191 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP025214 Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence 79984-80015 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP012569 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3.X, complete sequence 27705-27736 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP024835 Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_1, complete sequence 20164-20195 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP021687 Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence 74196-74227 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP021720 Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence 195576-195607 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 27095-27126 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP024839 Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_1, complete sequence 68250-68281 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP036446 Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence 43913-43944 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP012564 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3, complete sequence 32775-32806 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP024431 Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence 30482-30513 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 MN792917 Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENM30_NDM1, complete sequence 37625-37656 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP050374 Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence 9942-9973 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP050361 Klebsiella pneumoniae strain 47733 plasmid p47733_ARR2, complete sequence 37962-37993 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 4858-4889 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP032188 Klebsiella pneumoniae strain AR_0075 plasmid unnamed3, complete sequence 45171-45202 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP020050 Escherichia coli strain AR_0118 plasmid unitig_2, complete sequence 103264-103295 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 NZ_CP021758 Klebsiella pneumoniae strain AR_0138 plasmid tig00000001, complete sequence 66379-66410 3 0.906
NZ_CP044377_1 1.7|37686|32|NZ_CP044377|CRISPRCasFinder 37686-37717 32 MN688131 Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENC1, complete sequence 30882-30913 3 0.906
NZ_CP044377_1 1.18|38354|32|NZ_CP044377|CRISPRCasFinder 38354-38385 32 NZ_CP036439 Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence 63083-63114 3 0.906
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243586-243622 3 0.919
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 MK416022 Klebsiella phage ST846-OXA48phi9.2, complete genome 21164-21200 4 0.892
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 MK448237 Klebsiella phage ST974-OXA48phi18.2, complete genome 24967-25003 4 0.892
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 KY271399 Klebsiella phage 5 LV-2017, complete genome 18194-18230 4 0.892
NZ_CP044377_1 1.28|37747|37|NZ_CP044377|CRT 37747-37783 37 MK422450 Klebsiella phage ST13-OXA48phi12.4, complete genome 28530-28566 4 0.892
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 NZ_CP022925 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B 22871-22908 4 0.895
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP044049 Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence 207769-207806 4 0.895
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 115285-115320 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 177238-177273 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 798-833 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 23251-23286 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 90071-90106 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 90711-90746 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP042535 Citrobacter freundii strain E51 plasmid pE51_001, complete sequence 192276-192311 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 150301-150336 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 92586-92621 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 103803-103838 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 34186-34221 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 136784-136819 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 333137-333172 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP013339 Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence 150842-150877 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP046613 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence 55458-55493 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 86403-86438 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP026720 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 plasmid unitig_2_pilon, complete sequence 73799-73834 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 122972-123007 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP018017 Kosakonia radicincitans DSM 16656 plasmid pKrDSM16656L, complete sequence 176081-176116 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 118749-118784 4 0.889
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NZ_CP028952 Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence 174397-174432 4 0.889
NZ_CP044377_1 1.1|37329|32|NZ_CP044377|CRISPRCasFinder 37329-37360 32 NZ_FO704549 Xenorhabdus doucetiae strain FRM16 plasmid XD_p, complete sequence 2602-2633 5 0.844
NZ_CP044377_1 1.6|37632|25|NZ_CP044377|CRISPRCasFinder 37632-37656 25 NZ_CP050824 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-2, complete sequence 4659-4678 5 0.8
NZ_CP044377_1 1.19|38415|30|NZ_CP044377|CRISPRCasFinder 38415-38444 30 NC_025028 Uncultured bacterium pMCBF6 plasmid pMCBF6, complete sequence 41081-41110 5 0.833
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP038459 Escherichia coli strain EC-129 plasmid pEC129_6, complete sequence 2466-2503 5 0.868
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP019902 Raoultella planticola strain GODA plasmid unnamed3, complete sequence 4647-4682 5 0.868
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP025945 Escherichia coli strain SCEC020023 plasmid p1_020023, complete sequence 7737-7774 5 0.868
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP029779 Klebsiella pneumoniae strain WCHKP020034 plasmid p1_020034, complete sequence 3002-3039 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 51852-51889 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP012994 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence 89476-89513 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 59942-59979 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 59941-59978 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP041645 Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence 28949-28986 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_FO834905 Klebsiella pneumoniae strain Kp52.145 plasmid II, complete sequence 70473-70510 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 51827-51864 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP031815 Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence 45095-45132 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 73033-73070 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 32121-32158 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP032173 Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence 20603-20640 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 130780-130817 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 78847-78884 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 98422-98459 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP035203 Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence 121047-121084 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 47736-47773 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 121304-121341 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP012989 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence 20391-20428 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 89428-89465 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 106560-106597 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 91892-91929 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP030066 Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence 96685-96722 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 203897-203934 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 64954-64991 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 148084-148121 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_LR792629 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_II 68783-68820 5 0.868
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP025683 Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence 85964-86001 5 0.868
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP019902 Raoultella planticola strain GODA plasmid unnamed3, complete sequence 4419-4449 5 0.839
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP029779 Klebsiella pneumoniae strain WCHKP020034 plasmid p1_020034, complete sequence 2774-2804 5 0.839
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP024491 Klebsiella pneumoniae strain INF249 plasmid unnamed2, complete sequence 2740-2770 5 0.839
NZ_CP044377_1 1.36|38232|38|NZ_CP044377|CRT 38232-38269 38 MK416007 Klebsiella phage ST405-OXA48phi1.2, complete genome 7776-7813 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_014312 Klebsiella pneumoniae plasmid pKP048, complete sequence 108000-108037 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KY270850 Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence 37095-37132 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KY270849 Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence 77871-77908 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KY174332 Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence 92500-92537 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP032195 Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence 57430-57467 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 67175-67212 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KX236178 Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence 43630-43667 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP040995 Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence 69077-69114 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 60371-60408 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 104965-105002 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 113807-113844 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 145889-145926 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP028805 Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence 62267-62304 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP041928 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence 175979-176016 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP025468 Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence 54453-54490 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 136616-136653 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 136934-136971 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_023334 Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence 135692-135729 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 166557-166594 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP015135 Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence 96525-96562 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN891683 Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence 60376-60413 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP041949 Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence 107604-107641 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 135532-135569 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_FO834904 Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence 31522-31559 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP029591 Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence 6182-6219 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 50752-50789 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_016966 Klebsiella pneumoniae plasmid pUUH239.2, complete sequence 139289-139326 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 127078-127115 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 126276-126313 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP009275 Klebsiella variicola strain DX120E plasmid pKV1, complete sequence 100193-100230 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 6518-6555 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 81590-81627 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 71049-71086 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP012572 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence 68281-68318 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 118314-118351 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 136616-136653 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP036193 Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence 118999-119036 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 303964-304001 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 72163-72200 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP031851 Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence 104600-104637 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 138476-138513 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP027044 Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence 20780-20817 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052526 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence 113091-113128 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP044038 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence 27938-27975 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 97821-97858 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_022609 Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence 73594-73631 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 40222-40259 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052287 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence 170379-170416 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018999 Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence 72170-72207 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_011281 Klebsiella variicola strain 342 plasmid pKP91, complete sequence 79295-79332 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 68280-68317 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP034322 Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence 104970-105007 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP050379 Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence 181512-181549 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP035907 Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence 119007-119044 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP025516 Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence 119636-119673 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP024459 Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence 140580-140617 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 99779-99816 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP023916 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence 62027-62064 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 158081-158118 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP020903 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence 165525-165562 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026163 Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence 117960-117997 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052535 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence 128458-128495 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_LR025093 Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence 36048-36085 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP042521 Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence 129930-129967 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP032836 Klebsiella pneumoniae strain INF237 plasmid pINF237_03, complete sequence 52307-52344 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP032186 Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence 19257-19294 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN842291 Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence 97202-97239 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP044390 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence 123086-123123 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP044394 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence 122055-122092 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 106259-106296 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP044378 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence 124307-124344 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP044382 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence 97594-97631 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP042883 Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence 127737-127774 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 148952-148989 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052435 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence 83351-83388 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052438 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence 41475-41512 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_016846 Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence 65667-65704 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_LR025089 Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence 41281-41318 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP044387 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence 118817-118854 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 149484-149521 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_LR792629 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_II 144011-144048 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_LR792630 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I 31522-31559 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP036188 Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence 153222-153259 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MK649823 Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence 56848-56885 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MK649827 Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence 53707-53744 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MK649828 Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence 126625-126662 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MK649829 Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence 147251-147288 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_LT994840 Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence 21404-21441 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP044049 Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence 74603-74640 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN891678 Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-KPC, complete sequence 54493-54530 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_LR130540 Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2 125605-125642 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 119157-119194 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MH909340 Klebsiella pneumoniae strain A1763 plasmid pA1763-KPC, complete sequence 68215-68252 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MK413718 Klebsiella pneumoniae strain 427113 plasmid p427113-2, complete sequence 35892-35929 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MH477636 Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence 56041-56078 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MK036887 Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence 74190-74227 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_019390 Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence 171714-171751 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP014777 Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence 109296-109333 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN824000 Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence 170372-170409 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MG288676 Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence 120678-120715 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MG736312 Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence 92890-92927 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 81648-81685 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP035204 Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence 63242-63279 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN661404 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence 62361-62398 5 0.868
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MT108210 Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence 81104-81141 5 0.868
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP028385 Providencia heimbachae strain 99101 plasmid unnamed, complete sequence 89464-89494 6 0.806
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_CP050828 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-2, complete sequence 8402-8439 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 284001-284038 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 259539-259576 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 113496-113533 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 213366-213403 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 224220-224257 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 72326-72363 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 62708-62745 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 5774-5811 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 167075-167112 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 46988-47025 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 158226-158263 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 57559-57596 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 56494-56531 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 34613-34650 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 55232-55269 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 67735-67772 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 192218-192255 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 55232-55269 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 56493-56530 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 73200-73237 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 56458-56495 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 155934-155971 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 156018-156055 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 238828-238865 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 103758-103795 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 52447-52484 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP034040 Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence 56850-56887 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 94684-94721 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 150055-150092 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 62556-62593 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 53121-53158 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 266999-267036 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 57605-57642 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 68441-68478 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 304520-304557 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 37546-37583 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 112838-112875 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 161166-161203 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_MK413719 Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence 111672-111709 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 160678-160715 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 50189-50226 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP028952 Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence 338514-338551 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 208345-208382 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 123864-123901 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP031790 Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence 175199-175236 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP042869 Escherichia coli strain ATCC BAA-196 plasmid unnamed2, complete sequence 43893-43930 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 155462-155499 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 18345-18382 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 102543-102580 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 169018-169055 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 113505-113542 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 93688-93725 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 160137-160174 6 0.842
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 12613-12650 6 0.842
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP025945 Escherichia coli strain SCEC020023 plasmid p1_020023, complete sequence 7503-7533 6 0.806
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP033949 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p3, complete sequence 4960-4990 6 0.806
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP034676 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_6kb, complete sequence 387-417 6 0.806
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP036322 Klebsiella pneumoniae strain VBA2172 plasmid pCol440I 6124-6154 6 0.806
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP038459 Escherichia coli strain EC-129 plasmid pEC129_6, complete sequence 2707-2737 6 0.806
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP044044 Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed2, complete sequence 6858-6888 6 0.806
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP044390 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence 53913-53950 6 0.842
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP044394 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence 53975-54012 6 0.842
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP044378 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence 56243-56280 6 0.842
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP044382 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence 30261-30298 6 0.842
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP044387 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence 48467-48504 6 0.842
NZ_CP044377_1 1.38|38353|38|NZ_CP044377|CRT 38353-38390 38 NZ_CP036439 Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence 63078-63115 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 97044-97081 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026280 Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence 79496-79533 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 34080-34117 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 72946-72983 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 173725-173762 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 109127-109164 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 88235-88272 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 113984-114021 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 45981-46018 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KY271407 Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence 65577-65614 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP032198 Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence 28383-28420 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KX636095 Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence 264335-264372 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 89346-89383 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 87632-87669 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 7556-7593 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 89346-89383 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 102632-102669 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KP125893 Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence 98786-98823 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KU295132 Escherichia coli strain BK34397 plasmid pBK34397, complete sequence 77672-77709 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 91690-91727 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP021753 Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence 30777-30814 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 61574-61611 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 70050-70087 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 45920-45957 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 37022-37059 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 67800-67837 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 165085-165122 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 48378-48415 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 23344-23381 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP048351 Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence 121868-121905 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP034282 Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence 168215-168252 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP037744 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence 74427-74464 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 196463-196500 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 155291-155328 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 86988-87025 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 54777-54814 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 5600-5637 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 160905-160942 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 93158-93195 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 165768-165805 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 47800-47837 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 225044-225081 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 79446-79483 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 60410-60447 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 195528-195565 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 41106-41143 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP020523 Escherichia coli strain 190 plasmid unnamed2, complete sequence 71603-71640 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052566 Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence 108251-108288 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 73829-73866 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_021502 Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence 114681-114718 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP028954 Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence 39053-39090 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 7582-7619 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 93272-93309 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP033628 Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence 85728-85765 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 46033-46070 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_019389 Klebsiella pneumoniae plasmid pKDO1, complete sequence 53233-53270 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_023332 Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence 136525-136562 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 HG969996 Klebsiella pneumoniae plasmid pIT-12C47, complete sequence 77703-77740 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 92492-92529 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 HG969998 Klebsiella pneumoniae plasmid pIT-11C07, complete sequence 82683-82720 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 128774-128811 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP025039 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence 99161-99198 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP025040 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence 31952-31989 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 195419-195456 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP034777 Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence 81382-81419 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 89347-89384 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 83862-83899 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP031811 Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence 135482-135519 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 360011-360048 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 121085-121122 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN891675 Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence 63162-63199 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 70818-70855 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 44589-44626 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP027056 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB 87946-87983 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 266007-266044 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 5600-5637 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 226204-226241 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_019155 Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence 45227-45264 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_019165 Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence 47969-48006 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 26912-26949 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_015154 Klebsiella pneumoniae plasmid pc15-k, complete sequence 75080-75117 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 90172-90209 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP028177 Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence 93107-93144 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 62360-62397 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP023840 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence 39928-39965 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018815 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence 139045-139082 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052148 Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence 153986-154023 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 93156-93193 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026271 Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence 70265-70302 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018992 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence 29114-29151 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 38604-38641 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 89347-89384 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP027614 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence 47901-47938 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP027616 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence 9245-9282 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 38083-38120 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 74520-74557 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 62368-62405 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 45975-46012 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 233592-233629 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 42975-43012 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP021959 Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence 39380-39417 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_025131 Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence 41107-41144 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 41638-41675 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP047680 Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence 64362-64399 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP029583 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence 71967-72004 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 66975-67012 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 179259-179296 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_LT991960 Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3 41737-41774 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP041640 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence 131851-131888 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 20843-20880 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 123049-123086 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 121148-121185 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 71684-71721 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 200792-200829 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 189987-190024 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026174 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence 7028-7065 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026181 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence 36900-36937 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 63690-63727 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 26021-26058 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 88690-88727 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 93158-93195 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 206766-206803 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP010363 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence 127217-127254 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 64279-64316 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP041648 Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence 98005-98042 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP021166 Klebsiella pneumoniae strain 203 plasmid p203, complete sequence 124684-124721 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 37928-37965 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 132032-132069 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 KY940546 Klebsiella pneumoniae plasmid pUCLA3, complete sequence 65782-65819 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 60379-60416 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP021545 Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence 114166-114203 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 50029-50066 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP021686 Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence 1847-1884 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP024040 Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence 74667-74704 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 233918-233955 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP033947 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence 102742-102779 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 190764-190801 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 KT896504 Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence 131211-131248 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 194377-194414 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052525 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence 112809-112846 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP017851 Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence 64493-64530 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_AP019690 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence 63596-63633 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP017286 Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence 78911-78948 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 LT009689 Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence 46172-46209 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 149893-149930 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP028553 Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence 73453-73490 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP009879 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence 94321-94358 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 93158-93195 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP046950 Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence 149061-149098 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP046952 Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence 74057-74094 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP046942 Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697 92562-92599 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP046943 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed4 9519-9556 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP006922 Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence 42521-42558 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP032181 Citrobacter freundii strain AR_0116 plasmid unnamed3, complete sequence 53219-53256 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP009115 Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence 62244-62281 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 74850-74887 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP048381 Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence 126031-126068 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026396 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence 90616-90653 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052288 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence 137177-137214 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP017281 Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence 61343-61380 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 178012-178049 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP022825 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence 73294-73331 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP025966 Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence 85453-85490 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP020064 Klebsiella pneumoniae strain AR_0117 plasmid unitig_3, complete sequence 41503-41540 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP015387 Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence 41107-41144 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 41638-41675 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP024516 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence 189021-189058 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 170338-170375 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052276 Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence 138406-138443 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 82056-82093 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 195415-195452 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP034131 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence 111958-111995 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 105679-105716 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 194222-194259 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052298 Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence 140480-140517 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_021199 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence 41837-41874 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP046382 Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence 149095-149132 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP046384 Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence 74057-74094 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052540 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence 52208-52245 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018670 Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence 153215-153252 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP030342 Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence 107714-107751 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 116729-116766 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 145361-145398 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 252897-252934 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MF116002 Uncultured bacterium plasmid pLGP4 clone J53, complete sequence 163361-163398 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 121904-121941 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP045678 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence 50084-50121 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052441 Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence 202867-202904 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052534 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence 217885-217922 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026212 Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence 15615-15652 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP021857 Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence 102585-102622 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP024500 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence 204834-204871 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP029724 Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence 155581-155618 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP034137 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence 126423-126460 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN824002 Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence 191035-191072 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 81544-81581 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 93371-93408 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP024508 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence 189567-189604 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP024510 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence 73540-73577 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP032189 Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence 72632-72669 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 17855-17892 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN823985 Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence 90209-90246 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 18327-18364 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 216045-216082 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052506 Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence 153986-154023 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052214 Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence 131632-131669 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP015824 Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence 12970-13007 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 67435-67472 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP044395 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence 75347-75384 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 223343-223380 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 72728-72765 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052504 Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence 199436-199473 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052263 Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence 131882-131919 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 109266-109303 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP011621 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence 33760-33797 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 38184-38221 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP027158 Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence 76625-76662 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP025010 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence 79134-79171 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 122024-122061 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 192659-192696 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052521 Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence 199629-199666 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP023948 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence 149099-149136 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 179403-179440 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP041937 Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence 44792-44829 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052436 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence 86993-87030 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052140 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence 114797-114834 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 HG969995 Klebsiella pneumoniae plasmid pIT-01C03, complete sequence 93161-93198 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP035211 Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence 101744-101781 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 84797-84834 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP024544 Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence 49272-49309 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP035124 Escherichia coli strain EC25 plasmid pEC25-1, complete sequence 23075-23112 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052499 Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence 194393-194430 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 51628-51665 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 63899-63936 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 16662-16699 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP024483 Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence 204837-204874 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP034085 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence 71687-71724 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP054266 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence 43606-43643 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 93141-93178 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_023905 Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence 95566-95603 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 93159-93196 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 45920-45957 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP021951 Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence 2637-2674 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP028717 Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence 30782-30819 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 136968-137005 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_AP019401 Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence 81036-81073 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 93159-93196 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 28515-28552 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 2456-2493 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 58502-58539 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 61574-61611 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026717 Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence 52413-52450 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052243 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence 207945-207982 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP028389 Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence 122243-122280 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MK649824 Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence 99568-99605 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MK649826 Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence 211361-211398 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP015383 Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence 156453-156490 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP030071 Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence 76804-76841 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 86078-86115 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 46675-46712 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052173 Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence 234995-235032 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 71089-71126 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP015393 Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence 124441-124478 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP027696 Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence 151229-151266 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_LT882698 Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence 283859-283896 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018955 Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence 6066-6103 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP047634 Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence 132765-132802 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP047635 Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence 107380-107417 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052337 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence 184728-184765 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052307 Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence 138255-138292 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MK262711 Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence 5882-5919 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MK104259 Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence 98188-98225 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MK167987 Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence 117973-118010 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 127598-127635 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 64966-65003 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MN543570 Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence 96775-96812 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP044045 Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence 38111-38148 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN657251 Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence 61940-61977 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052279 Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence 215159-215196 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 81958-81995 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 194129-194166 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 42876-42913 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MH464586 Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence 70411-70448 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN657248 Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence 101967-102004 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 178971-179008 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 36951-36988 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MF156708 Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence 95905-95942 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MF156696 Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence 206138-206175 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MG462728 Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence 156495-156532 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP035536 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence 67673-67710 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KY271404 Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence 205272-205309 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KY271406 Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence 55076-55113 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KY495890 Klebsiella pneumoniae strain 301 plasmid pKP301cro, complete sequence 26028-26065 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MF150084 Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence 187875-187912 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MG252894 Klebsiella pneumoniae strain Kpn-35963cz plasmid pKpn-35963cz, complete sequence 121831-121868 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MG764551 Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence 232536-232573 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_MG288683 Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence 89427-89464 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 LR134219 Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3 183576-183613 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP033755 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence 55002-55039 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 140524-140561 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP054255 Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence 59586-59623 6 0.842
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP035637 Enterobacter cloacae strain EN3600 plasmid unnamed5, complete sequence 56147-56184 6 0.842
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 CP013001 Bacillus thuringiensis strain XL6 plasmid, complete sequence 160869-160900 7 0.781
NZ_CP044377_1 1.5|37571|32|NZ_CP044377|CRISPRCasFinder 37571-37602 32 NC_011775 Bacillus cereus G9842 plasmid pG9842_209, complete sequence 162044-162075 7 0.781
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_CP017943 Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence 403631-403662 7 0.781
NZ_CP044377_1 1.17|38293|32|NZ_CP044377|CRISPRCasFinder 38293-38324 32 NZ_LR723673 Rhizobium flavum strain YW14 plasmid 4 55419-55450 7 0.781
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 52510-52547 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 55638-55675 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 86789-86826 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 27991-28028 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 272851-272888 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 17348-17385 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 13491-13528 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 157360-157397 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 85267-85304 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 252623-252660 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 141025-141062 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 24789-24826 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 77692-77729 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 91000-91037 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 217844-217881 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 290303-290340 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 292792-292829 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NC_016980 Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence 217074-217111 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 287557-287594 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 91829-91866 7 0.816
NZ_CP044377_1 1.25|37571|38|NZ_CP044377|CRT 37571-37608 38 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 37708-37745 7 0.816
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 CP000617 Burkholderia vietnamiensis G4 plasmid pBVIE01, complete sequence 47338-47368 7 0.774
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP023840 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence 109028-109065 7 0.816
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP017851 Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence 21051-21088 7 0.816
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP017286 Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence 35469-35506 7 0.816
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP011587 Enterobacter asburiae strain CAV1043 plasmid pCAV1043-51, complete sequence 43562-43599 7 0.816
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP017281 Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence 17901-17938 7 0.816
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NC_011281 Klebsiella variicola strain 342 plasmid pKP91, complete sequence 67978-68015 7 0.816
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NC_021199 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence 138432-138469 7 0.816
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP024484 Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence 22387-22424 7 0.816
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 83959-83996 7 0.816
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP029583 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence 2867-2904 7 0.816
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 128481-128518 7 0.816
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP026163 Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence 57592-57629 7 0.816
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 84891-84928 7 0.816
NZ_CP044377_1 1.34|38109|38|NZ_CP044377|CRT 38109-38146 38 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 28645-28682 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 326885-326922 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 LK391770 Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67 53119-53156 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KY454639 Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence 97475-97512 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 75047-75084 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP015754 Klebsiella pneumoniae strain W14 plasmid unnamed1, complete sequence 115429-115466 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP021946 Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence 36619-36656 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 106867-106904 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP016160 Klebsiella pneumoniae strain TH1 isolate TH1 plasmid unnamed1, complete sequence 143317-143354 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 6895-6932 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 179747-179784 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP050837 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence 46181-46218 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 89398-89435 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 44880-44917 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026135 Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence 95872-95909 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 140536-140573 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 123881-123918 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 16735-16772 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 105163-105200 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_AP018754 Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence 59298-59335 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 104315-104352 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 193234-193271 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 139854-139891 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 172529-172566 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 275720-275757 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP033627 Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence 143315-143352 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 14338-14375 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 143344-143381 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 12423-12460 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 138495-138532 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 34155-34192 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP011981 Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence 104951-104988 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 107225-107262 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP011990 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence 19157-19194 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 138898-138935 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP027054 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII 156377-156414 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 MG700548 Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence 102023-102060 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 140536-140573 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 164231-164268 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 136616-136653 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 11684-11721 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 115016-115053 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 143859-143896 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 151426-151463 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 11757-11794 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP022692 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence 163720-163757 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 72646-72683 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP033823 Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence 108515-108552 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 170006-170043 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 103153-103190 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 151189-151226 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 165824-165861 7 0.816
NZ_CP044377_1 1.40|38473|38|NZ_CP044377|CRT 38473-38510 38 NZ_CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 190865-190902 7 0.816
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 MT741943 Acinetobacter phage Meroveus, complete genome 146497-146527 8 0.742
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 NC_049511 Acinetobacter phage AM101, complete genome 146165-146195 8 0.742
NZ_CP044377_1 1.11|37929|31|NZ_CP044377|CRISPRCasFinder 37929-37959 31 MT409116 Acinetobacter phage Octan, complete genome 145574-145604 8 0.742
NZ_CP044377_1 1.16|38232|32|NZ_CP044377|CRISPRCasFinder 38232-38263 32 NC_019898 Thermobacillus composti KWC4 plasmid pTHECO01, complete sequence 116623-116654 8 0.75
NZ_CP044377_1 1.21|37329|38|NZ_CP044377|CRT 37329-37366 38 NZ_FO704549 Xenorhabdus doucetiae strain FRM16 plasmid XD_p, complete sequence 2602-2639 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP015502 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence 24918-24955 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP012569 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3.X, complete sequence 27705-27742 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP024835 Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_1, complete sequence 20164-20201 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 27095-27132 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP024839 Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_1, complete sequence 68250-68287 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP012564 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3, complete sequence 32775-32812 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 MN792917 Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENM30_NDM1, complete sequence 37625-37662 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP050374 Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence 9942-9979 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP050361 Klebsiella pneumoniae strain 47733 plasmid p47733_ARR2, complete sequence 37962-37999 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP032188 Klebsiella pneumoniae strain AR_0075 plasmid unnamed3, complete sequence 45171-45208 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP020050 Escherichia coli strain AR_0118 plasmid unitig_2, complete sequence 103264-103301 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP021758 Klebsiella pneumoniae strain AR_0138 plasmid tig00000001, complete sequence 66379-66416 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 MN688131 Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENC1, complete sequence 30882-30919 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP018674 Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence 43514-43551 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_KR822246 Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence 5202-5239 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_KJ958926 Klebsiella pneumoniae strain Kpn-3002cz plasmid pB-3002cz, complete sequence 4876-4913 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_LN824135 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671 32892-32929 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP025214 Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence 10154-10191 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP025214 Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence 79978-80015 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP021687 Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence 74190-74227 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP021720 Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence 195570-195607 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP036446 Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence 43907-43944 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NZ_CP024431 Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence 30476-30513 8 0.789
NZ_CP044377_1 1.27|37686|38|NZ_CP044377|CRT 37686-37723 38 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 4852-4889 8 0.789
NZ_CP044377_1 1.4|37511|31|NZ_CP044377|CRISPRCasFinder 37511-37541 31 NZ_CP030844 Acidisarcina polymorpha strain SBC82 plasmid pACPOL3, complete sequence 49093-49123 9 0.71
NZ_CP044377_1 1.8|37747|31|NZ_CP044377|CRISPRCasFinder 37747-37777 31 NC_019739 Microcoleus sp. PCC 7113 plasmid pMIC7113.01, complete sequence 94386-94416 9 0.71
NZ_CP044377_1 1.13|38049|31|NZ_CP044377|CRISPRCasFinder 38049-38079 31 KU594606 Cyanophage S-RIM32 isolate RW_108_0702, complete genome 51022-51052 9 0.71
NZ_CP044377_1 1.26|37632|31|NZ_CP044377|CRT 37632-37662 31 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 4552-4582 10 0.677
NZ_CP044377_1 1.39|38414|36|NZ_CP044377|CRT 38414-38449 36 NC_025028 Uncultured bacterium pMCBF6 plasmid pMCBF6, complete sequence 41080-41115 10 0.722
NZ_CP044377_1 1.24|37511|37|NZ_CP044377|CRT 37511-37547 37 NZ_CP028385 Providencia heimbachae strain 99101 plasmid unnamed, complete sequence 89458-89494 11 0.703

1. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

2. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP019902 (Raoultella planticola strain GODA plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

3. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

4. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

5. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

6. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

7. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025945 (Escherichia coli strain SCEC020023 plasmid p1_020023, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

8. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

9. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

10. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

11. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

12. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

13. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

14. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

15. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

16. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

17. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

18. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

19. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

20. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

21. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

22. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

23. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

24. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP029779 (Klebsiella pneumoniae strain WCHKP020034 plasmid p1_020034, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

25. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

26. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

27. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

28. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

29. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

30. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

31. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

32. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

33. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

34. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

35. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

36. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

37. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

38. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

39. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

40. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP038459 (Escherichia coli strain EC-129 plasmid pEC129_6, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

41. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

42. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

43. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

44. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

45. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

46. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

47. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

48. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

49. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

50. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

51. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

52. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

53. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

54. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

55. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

56. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

57. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

58. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

59. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

60. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

61. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

62. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

63. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

64. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

65. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

66. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

67. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

68. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

69. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

70. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

71. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

72. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

73. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

74. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

75. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

76. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

77. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

78. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

79. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

80. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

81. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

82. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

83. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

84. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

85. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

86. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

87. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

88. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

89. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

90. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

91. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

92. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

93. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

94. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

95. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

96. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

97. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

98. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

99. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

100. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

101. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

102. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

103. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

104. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

105. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

106. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

107. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

108. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

109. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

110. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

111. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

112. spacer 1.2|37390|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

113. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacgtataccttttgcacagtgtt	Protospacer
*******************************

114. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacgtataccttttgcacagtgtt	Protospacer
*******************************

115. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacgtataccttttgcacagtgtt	Protospacer
*******************************

116. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacgtataccttttgcacagtgtt	Protospacer
*******************************

117. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacgtataccttttgcacagtgtt	Protospacer
*******************************

118. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacgtataccttttgcacagtgtt	Protospacer
*******************************

119. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacgtataccttttgcacagtgtt	Protospacer
*******************************

120. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

121. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

122. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

123. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

124. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

125. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

126. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

127. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

128. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

129. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

130. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

131. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

132. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

133. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

134. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

135. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

136. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

137. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

138. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

139. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

140. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

141. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

142. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

143. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

144. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

145. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

146. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

147. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

148. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

149. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

150. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

151. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

152. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagg	Protospacer
*******************************

153. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

154. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

155. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

156. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

157. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

158. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

159. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

160. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

161. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

162. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

163. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

164. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

165. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

166. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

167. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

168. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

169. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

170. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

171. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

172. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

173. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

174. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

175. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

176. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

177. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

178. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

179. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

180. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

181. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

182. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

183. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

184. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

185. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

186. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

187. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

188. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

189. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

190. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

191. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

192. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaat	Protospacer
********************************

193. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

194. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

195. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

196. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

197. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

198. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

199. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

200. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

201. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

202. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

203. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

204. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024491 (Klebsiella pneumoniae strain INF249 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

205. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

206. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

207. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

208. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

209. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

210. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

211. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

212. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

213. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

214. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

215. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

216. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

217. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

218. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

219. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

220. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

221. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP019902 (Raoultella planticola strain GODA plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

222. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

223. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

224. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

225. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP029779 (Klebsiella pneumoniae strain WCHKP020034 plasmid p1_020034, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

226. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

227. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

228. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

229. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

230. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

231. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

232. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

233. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggc	CRISPR spacer
aacatcagtggaaatccactgcggc	Protospacer
*************************

234. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

235. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

236. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

237. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

238. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

239. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

240. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

241. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

242. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

243. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

244. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

245. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

246. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

247. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

248. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

249. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

250. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

251. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

252. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

253. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

254. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

255. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

256. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

257. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

258. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

259. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

260. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

261. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

262. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

263. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

264. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

265. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

266. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

267. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

268. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

269. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

270. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

271. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

272. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

273. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

274. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

275. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

276. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

277. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

278. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

279. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

280. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

281. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

282. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

283. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

284. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

285. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

286. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

287. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

288. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

289. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

290. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

291. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

292. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

293. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

294. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

295. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

296. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

297. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

298. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

299. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

300. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

301. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

302. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

303. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

304. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

305. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

306. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

307. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

308. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

309. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

310. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

311. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

312. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

313. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

314. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

315. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

316. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

317. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

318. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

319. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

320. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

321. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

322. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

323. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

324. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

325. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

326. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

327. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

328. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

329. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

330. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

331. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

332. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

333. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

334. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

335. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

336. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

337. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

338. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

339. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

340. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

341. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

342. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

343. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

344. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

345. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

346. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

347. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

348. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

349. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

350. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

351. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

352. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

353. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

354. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

355. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

356. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

357. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

358. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

359. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

360. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

361. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

362. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

363. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

364. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

365. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

366. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

367. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

368. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

369. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

370. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

371. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to MK416022 (Klebsiella phage ST846-OXA48phi9.2, complete genome) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

372. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to MK448237 (Klebsiella phage ST974-OXA48phi18.2, complete genome) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

373. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to KY271399 (Klebsiella phage 5 LV-2017, complete genome) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

374. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to MK422450 (Klebsiella phage ST13-OXA48phi12.4, complete genome) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggt	Protospacer
*******************************

375. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

376. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

377. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

378. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

379. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

380. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

381. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

382. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

383. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

384. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

385. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

386. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

387. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

388. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

389. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

390. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

391. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

392. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

393. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

394. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

395. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

396. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

397. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

398. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

399. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

400. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

401. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

402. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

403. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

404. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

405. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

406. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

407. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

408. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

409. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

410. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

411. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

412. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

413. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

414. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

415. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

416. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

417. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

418. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

419. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

420. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

421. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

422. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

423. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

424. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

425. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

426. spacer 1.9|37807|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagta	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagta	Protospacer
********************************

427. spacer 1.10|37868|32|NZ_CP044377|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagg	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagg	Protospacer
********************************

428. spacer 1.10|37868|32|NZ_CP044377|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagg	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagg	Protospacer
********************************

429. spacer 1.10|37868|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagg	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagg	Protospacer
********************************

430. spacer 1.10|37868|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagg	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagg	Protospacer
********************************

431. spacer 1.10|37868|32|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagg	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagg	Protospacer
********************************

432. spacer 1.10|37868|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagg	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagg	Protospacer
********************************

433. spacer 1.10|37868|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagg	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagg	Protospacer
********************************

434. spacer 1.10|37868|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagg	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagg	Protospacer
********************************

435. spacer 1.10|37868|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagg	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagg	Protospacer
********************************

436. spacer 1.10|37868|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagg	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagg	Protospacer
********************************

437. spacer 1.10|37868|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagg	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagg	Protospacer
********************************

438. spacer 1.10|37868|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagg	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagg	Protospacer
********************************

439. spacer 1.10|37868|32|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagg	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagg	Protospacer
********************************

440. spacer 1.10|37868|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagg	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagg	Protospacer
********************************

441. spacer 1.10|37868|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagg	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagg	Protospacer
********************************

442. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

443. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

444. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

445. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

446. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

447. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

448. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

449. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

450. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

451. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

452. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

453. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

454. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

455. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

456. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

457. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

458. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

459. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

460. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

461. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

462. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

463. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

464. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgttt	Protospacer
*******************************

465. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

466. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

467. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

468. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

469. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

470. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

471. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

472. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

473. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

474. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

475. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

476. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

477. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

478. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

479. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

480. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

481. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

482. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

483. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

484. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

485. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

486. spacer 1.12|37989|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctct	CRISPR spacer
caggttatactggcaaaacgtcgatggctct	Protospacer
*******************************

487. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

488. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

489. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

490. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

491. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

492. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

493. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

494. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

495. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

496. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

497. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

498. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

499. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

500. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

501. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

502. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

503. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

504. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

505. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

506. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

507. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

508. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtc	Protospacer
*******************************

509. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

510. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

511. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

512. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

513. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

514. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

515. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

516. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

517. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

518. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

519. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

520. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

521. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

522. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

523. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

524. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

525. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

526. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

527. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

528. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

529. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

530. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

531. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

532. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

533. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

534. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

535. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

536. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

537. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcag	Protospacer
********************************

538. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

539. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

540. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

541. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

542. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

543. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

544. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

545. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

546. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

547. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

548. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

549. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

550. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

551. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

552. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

553. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

554. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

555. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

556. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

557. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

558. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

559. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

560. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

561. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

562. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatg	Protospacer
*********************************

563. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

564. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

565. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

566. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

567. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

568. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

569. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

570. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

571. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

572. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

573. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

574. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

575. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

576. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

577. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

578. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

579. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

580. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

581. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

582. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

583. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

584. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

585. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

586. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

587. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

588. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

589. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

590. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

591. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

592. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

593. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

594. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

595. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

596. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

597. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

598. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

599. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

600. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

601. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

602. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatg	Protospacer
********************************

603. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

604. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

605. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

606. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

607. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

608. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

609. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

610. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

611. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

612. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

613. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

614. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

615. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

616. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

617. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

618. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

619. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

620. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttc	Protospacer
********************************

621. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccgggagaactggctgaata	Protospacer
********************************

622. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccgggagaactggctgaata	Protospacer
********************************

623. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccgggagaactggctgaata	Protospacer
********************************

624. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

625. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

626. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

627. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

628. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

629. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

630. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

631. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

632. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

633. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

634. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

635. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

636. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

637. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

638. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

639. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

640. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

641. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

642. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

643. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

644. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

645. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

646. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

647. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

648. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

649. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

650. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

651. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

652. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

653. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

654. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

655. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

656. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

657. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

658. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

659. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

660. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

661. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

662. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

663. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

664. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

665. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

666. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

667. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

668. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccctgcactaagacgctggtggtcgcca	Protospacer
******************************

669. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_014312 (Klebsiella pneumoniae plasmid pKP048, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

670. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

671. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

672. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

673. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

674. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

675. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

676. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

677. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP040995 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

678. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

679. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

680. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

681. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

682. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

683. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

684. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

685. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

686. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

687. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

688. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

689. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

690. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

691. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

692. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

693. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

694. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

695. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

696. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

697. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

698. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

699. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

700. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

701. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

702. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_FO834904 (Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

703. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

704. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

705. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

706. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

707. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

708. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

709. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

710. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

711. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

712. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

713. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

714. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

715. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

716. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

717. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

718. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

719. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

720. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

721. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

722. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

723. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031851 (Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

724. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

725. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

726. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

727. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

728. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

729. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

730. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

731. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

732. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

733. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

734. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

735. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_011281 (Klebsiella variicola strain 342 plasmid pKP91, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

736. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

737. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

738. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

739. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

740. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

741. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

742. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

743. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

744. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

745. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP023916 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

746. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

747. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

748. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026163 (Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

749. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

750. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

751. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

752. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032836 (Klebsiella pneumoniae strain INF237 plasmid pINF237_03, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

753. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

754. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

755. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

756. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

757. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

758. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN842291 (Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

759. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044390 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

760. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044394 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

761. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

762. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

763. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044378 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

764. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

765. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044382 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

766. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

767. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

768. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

769. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

770. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

771. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052438 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

772. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

773. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_016846 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

774. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

775. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

776. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

777. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

778. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044387 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

779. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

780. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

781. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

782. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

783. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LR792629 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_II) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

784. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LR792630 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

785. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

786. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

787. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

788. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

789. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

790. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

791. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

792. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044049 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

793. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

794. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN891678 (Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

795. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LR130540 (Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

796. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

797. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

798. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

799. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH909340 (Klebsiella pneumoniae strain A1763 plasmid pA1763-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

800. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413718 (Klebsiella pneumoniae strain 427113 plasmid p427113-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

801. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH477636 (Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

802. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

803. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

804. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

805. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_019390 (Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

806. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP014777 (Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

807. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

808. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

809. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN824000 (Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

810. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

811. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG288676 (Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

812. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG736312 (Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

813. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

814. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

815. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

816. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP035204 (Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

817. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

818. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MT108210 (Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacaggtgcagggc	Protospacer
********************************

819. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

820. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

821. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

822. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

823. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

824. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

825. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

826. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

827. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

828. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

829. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

830. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

831. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

832. spacer 1.21|37329|38|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

833. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

834. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

835. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

836. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

837. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

838. spacer 1.21|37329|38|NZ_CP044377|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

839. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

840. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

841. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

842. spacer 1.21|37329|38|NZ_CP044377|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

843. spacer 1.21|37329|38|NZ_CP044377|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

844. spacer 1.21|37329|38|NZ_CP044377|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

845. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

846. spacer 1.21|37329|38|NZ_CP044377|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

847. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

848. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

849. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

850. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

851. spacer 1.21|37329|38|NZ_CP044377|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

852. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

853. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

854. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

855. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

856. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

857. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

858. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

859. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

860. spacer 1.21|37329|38|NZ_CP044377|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

861. spacer 1.21|37329|38|NZ_CP044377|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

862. spacer 1.21|37329|38|NZ_CP044377|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

863. spacer 1.21|37329|38|NZ_CP044377|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

864. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

865. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

866. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

867. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

868. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

869. spacer 1.21|37329|38|NZ_CP044377|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

870. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

871. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

872. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaagtattc	Protospacer
**************************************

873. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

874. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

875. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

876. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

877. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

878. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

879. spacer 1.22|37390|38|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

880. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

881. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

882. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

883. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

884. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

885. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

886. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

887. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

888. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

889. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

890. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

891. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

892. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

893. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

894. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

895. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

896. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

897. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

898. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

899. spacer 1.22|37390|38|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

900. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

901. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

902. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

903. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

904. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

905. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

906. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

907. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

908. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

909. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

910. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

911. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

912. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

913. spacer 1.22|37390|38|NZ_CP044377|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

914. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

915. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

916. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

917. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

918. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

919. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

920. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

921. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

922. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

923. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

924. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

925. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

926. spacer 1.22|37390|38|NZ_CP044377|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagacgtattc	CRISPR spacer
aggtatttgacctcatccagaaaggcacagacgtattc	Protospacer
**************************************

927. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacgtataccttttgcacagtgttagtatt	Protospacer
*************************************

928. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacgtataccttttgcacagtgttagtatt	Protospacer
*************************************

929. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacgtataccttttgcacagtgttagtatt	Protospacer
*************************************

930. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacgtataccttttgcacagtgttagtatt	Protospacer
*************************************

931. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacgtataccttttgcacagtgttagtatt	Protospacer
*************************************

932. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacgtataccttttgcacagtgttagtatt	Protospacer
*************************************

933. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacgtataccttttgcacagtgttagtatt	Protospacer
*************************************

934. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

935. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

936. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

937. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

938. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

939. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

940. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

941. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

942. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

943. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

944. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

945. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

946. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

947. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

948. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

949. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

950. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

951. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

952. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

953. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

954. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

955. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

956. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

957. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

958. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

959. spacer 1.24|37511|37|NZ_CP044377|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

960. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

961. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

962. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

963. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

964. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

965. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcaggggtatt	Protospacer
*************************************

966. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

967. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

968. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

969. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

970. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

971. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

972. spacer 1.25|37571|38|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

973. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

974. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

975. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

976. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

977. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

978. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

979. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

980. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

981. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

982. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

983. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

984. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

985. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

986. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

987. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

988. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

989. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

990. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattc	Protospacer
**************************************

991. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

992. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

993. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

994. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

995. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

996. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

997. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

998. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

999. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1000. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1001. spacer 1.26|37632|31|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1002. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1003. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1004. spacer 1.26|37632|31|NZ_CP044377|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1005. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1006. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1007. spacer 1.26|37632|31|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1008. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1009. spacer 1.26|37632|31|NZ_CP044377|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1010. spacer 1.26|37632|31|NZ_CP044377|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1011. spacer 1.26|37632|31|NZ_CP044377|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1012. spacer 1.26|37632|31|NZ_CP044377|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1013. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1014. spacer 1.26|37632|31|NZ_CP044377|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1015. spacer 1.26|37632|31|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1016. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1017. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1018. spacer 1.26|37632|31|NZ_CP044377|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1019. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1020. spacer 1.26|37632|31|NZ_CP044377|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1021. spacer 1.26|37632|31|NZ_CP044377|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1022. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1023. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1024. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1025. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1026. spacer 1.26|37632|31|NZ_CP044377|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1027. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1028. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcgtattc	Protospacer
*******************************

1029. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1030. spacer 1.27|37686|38|NZ_CP044377|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1031. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1032. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1033. spacer 1.27|37686|38|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1034. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1035. spacer 1.27|37686|38|NZ_CP044377|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1036. spacer 1.27|37686|38|NZ_CP044377|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1037. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1038. spacer 1.27|37686|38|NZ_CP044377|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1039. spacer 1.27|37686|38|NZ_CP044377|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1040. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1041. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1042. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1043. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1044. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1045. spacer 1.27|37686|38|NZ_CP044377|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1046. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1047. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1048. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1049. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1050. spacer 1.27|37686|38|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1051. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1052. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1053. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1054. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1055. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1056. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1057. spacer 1.27|37686|38|NZ_CP044377|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1058. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1059. spacer 1.27|37686|38|NZ_CP044377|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1060. spacer 1.27|37686|38|NZ_CP044377|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1061. spacer 1.27|37686|38|NZ_CP044377|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1062. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1063. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1064. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1065. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1066. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1067. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1068. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1069. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1070. spacer 1.27|37686|38|NZ_CP044377|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1071. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1072. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1073. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1074. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1075. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1076. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1077. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1078. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1079. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1080. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1081. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1082. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1083. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1084. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1085. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1086. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1087. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1088. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1089. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1090. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1091. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1092. spacer 1.27|37686|38|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1093. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1094. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1095. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1096. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtcttttgtattc	Protospacer
**************************************

1097. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1098. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1099. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1100. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1101. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1102. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1103. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1104. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1105. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1106. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1107. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1108. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1109. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1110. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1111. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1112. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1113. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1114. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1115. spacer 1.28|37747|37|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1116. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1117. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1118. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1119. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1120. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1121. spacer 1.28|37747|37|NZ_CP044377|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1122. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1123. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1124. spacer 1.28|37747|37|NZ_CP044377|CRT matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1125. spacer 1.28|37747|37|NZ_CP044377|CRT matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1126. spacer 1.28|37747|37|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1127. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1128. spacer 1.28|37747|37|NZ_CP044377|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1129. spacer 1.28|37747|37|NZ_CP044377|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1130. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1131. spacer 1.28|37747|37|NZ_CP044377|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1132. spacer 1.28|37747|37|NZ_CP044377|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1133. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1134. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1135. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1136. spacer 1.28|37747|37|NZ_CP044377|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1137. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1138. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1139. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1140. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1141. spacer 1.28|37747|37|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1142. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1143. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1144. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1145. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1146. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1147. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1148. spacer 1.28|37747|37|NZ_CP044377|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1149. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1150. spacer 1.28|37747|37|NZ_CP044377|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1151. spacer 1.28|37747|37|NZ_CP044377|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1152. spacer 1.28|37747|37|NZ_CP044377|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1153. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1154. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1155. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1156. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1157. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1158. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1159. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1160. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1161. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1162. spacer 1.28|37747|37|NZ_CP044377|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1163. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1164. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1165. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtggtatt	Protospacer
*************************************

1166. spacer 1.29|37807|38|NZ_CP044377|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1167. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1168. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1169. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1170. spacer 1.29|37807|38|NZ_CP044377|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1171. spacer 1.29|37807|38|NZ_CP044377|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1172. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1173. spacer 1.29|37807|38|NZ_CP044377|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1174. spacer 1.29|37807|38|NZ_CP044377|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1175. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1176. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1177. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1178. spacer 1.29|37807|38|NZ_CP044377|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1179. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1180. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1181. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1182. spacer 1.29|37807|38|NZ_CP044377|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1183. spacer 1.29|37807|38|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1184. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1185. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1186. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1187. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1188. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1189. spacer 1.29|37807|38|NZ_CP044377|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1190. spacer 1.29|37807|38|NZ_CP044377|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1191. spacer 1.29|37807|38|NZ_CP044377|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1192. spacer 1.29|37807|38|NZ_CP044377|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1193. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1194. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1195. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1196. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1197. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1198. spacer 1.29|37807|38|NZ_CP044377|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1199. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1200. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1201. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1202. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1203. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1204. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1205. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1206. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1207. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1208. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1209. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1210. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1211. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1212. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1213. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1214. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1215. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1216. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1217. spacer 1.29|37807|38|NZ_CP044377|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgtgttggcgttcgttaaatattgttagtagtattc	CRISPR spacer
tgtgtgttggcgttcgttaaatattgttagtagtattc	Protospacer
**************************************

1218. spacer 1.30|37868|38|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagggtattc	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagggtattc	Protospacer
**************************************

1219. spacer 1.30|37868|38|NZ_CP044377|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagggtattc	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagggtattc	Protospacer
**************************************

1220. spacer 1.30|37868|38|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagggtattc	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagggtattc	Protospacer
**************************************

1221. spacer 1.30|37868|38|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagggtattc	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagggtattc	Protospacer
**************************************

1222. spacer 1.30|37868|38|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagggtattc	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagggtattc	Protospacer
**************************************

1223. spacer 1.30|37868|38|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagggtattc	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagggtattc	Protospacer
**************************************

1224. spacer 1.30|37868|38|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagggtattc	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagggtattc	Protospacer
**************************************

1225. spacer 1.30|37868|38|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagggtattc	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagggtattc	Protospacer
**************************************

1226. spacer 1.30|37868|38|NZ_CP044377|CRT matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagggtattc	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagggtattc	Protospacer
**************************************

1227. spacer 1.30|37868|38|NZ_CP044377|CRT matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagggtattc	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagggtattc	Protospacer
**************************************

1228. spacer 1.30|37868|38|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagggtattc	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagggtattc	Protospacer
**************************************

1229. spacer 1.30|37868|38|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagggtattc	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagggtattc	Protospacer
**************************************

1230. spacer 1.30|37868|38|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagggtattc	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagggtattc	Protospacer
**************************************

1231. spacer 1.30|37868|38|NZ_CP044377|CRT matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagggtattc	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagggtattc	Protospacer
**************************************

1232. spacer 1.30|37868|38|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

cggtaacgcaaatgtgatccgatgtcgtcagggtattc	CRISPR spacer
cggtaacgcaaatgtgatccgatgtcgtcagggtattc	Protospacer
**************************************

1233. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1234. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1235. spacer 1.31|37929|37|NZ_CP044377|CRT matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1236. spacer 1.31|37929|37|NZ_CP044377|CRT matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1237. spacer 1.31|37929|37|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1238. spacer 1.31|37929|37|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1239. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1240. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1241. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1242. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1243. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1244. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1245. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1246. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1247. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1248. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1249. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1250. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1251. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1252. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1253. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1254. spacer 1.31|37929|37|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1255. spacer 1.31|37929|37|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

aacaatttgaagtttctgcgccaggtcgtttcgtatt	CRISPR spacer
aacaatttgaagtttctgcgccaggtcgtttcgtatt	Protospacer
*************************************

1256. spacer 1.32|37989|37|NZ_CP044377|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1257. spacer 1.32|37989|37|NZ_CP044377|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1258. spacer 1.32|37989|37|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1259. spacer 1.32|37989|37|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1260. spacer 1.32|37989|37|NZ_CP044377|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1261. spacer 1.32|37989|37|NZ_CP044377|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1262. spacer 1.32|37989|37|NZ_CP044377|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1263. spacer 1.32|37989|37|NZ_CP044377|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1264. spacer 1.32|37989|37|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1265. spacer 1.32|37989|37|NZ_CP044377|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1266. spacer 1.32|37989|37|NZ_CP044377|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1267. spacer 1.32|37989|37|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1268. spacer 1.32|37989|37|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1269. spacer 1.32|37989|37|NZ_CP044377|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1270. spacer 1.32|37989|37|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1271. spacer 1.32|37989|37|NZ_CP044377|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1272. spacer 1.32|37989|37|NZ_CP044377|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1273. spacer 1.32|37989|37|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1274. spacer 1.32|37989|37|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1275. spacer 1.32|37989|37|NZ_CP044377|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1276. spacer 1.32|37989|37|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1277. spacer 1.32|37989|37|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

caggttatactggcaaaacgtcgatggctctcgtatt	CRISPR spacer
caggttatactggcaaaacgtcgatggctctcgtatt	Protospacer
*************************************

1278. spacer 1.33|38049|37|NZ_CP044377|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1279. spacer 1.33|38049|37|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1280. spacer 1.33|38049|37|NZ_CP044377|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1281. spacer 1.33|38049|37|NZ_CP044377|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1282. spacer 1.33|38049|37|NZ_CP044377|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1283. spacer 1.33|38049|37|NZ_CP044377|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1284. spacer 1.33|38049|37|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1285. spacer 1.33|38049|37|NZ_CP044377|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1286. spacer 1.33|38049|37|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1287. spacer 1.33|38049|37|NZ_CP044377|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1288. spacer 1.33|38049|37|NZ_CP044377|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1289. spacer 1.33|38049|37|NZ_CP044377|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1290. spacer 1.33|38049|37|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1291. spacer 1.33|38049|37|NZ_CP044377|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1292. spacer 1.33|38049|37|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1293. spacer 1.33|38049|37|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1294. spacer 1.33|38049|37|NZ_CP044377|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1295. spacer 1.33|38049|37|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1296. spacer 1.33|38049|37|NZ_CP044377|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1297. spacer 1.33|38049|37|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1298. spacer 1.33|38049|37|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1299. spacer 1.33|38049|37|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatattgttgtctaccgtgtcggtatt	Protospacer
*************************************

1300. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1301. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1302. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1303. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1304. spacer 1.34|38109|38|NZ_CP044377|CRT matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1305. spacer 1.34|38109|38|NZ_CP044377|CRT matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1306. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1307. spacer 1.34|38109|38|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1308. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1309. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1310. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1311. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1312. spacer 1.34|38109|38|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1313. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1314. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1315. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1316. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1317. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1318. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1319. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1320. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1321. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1322. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1323. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1324. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1325. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1326. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1327. spacer 1.34|38109|38|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1328. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agcagttcgaggaatagtgacaggcagtgcaggtattc	Protospacer
**************************************

1329. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1330. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1331. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1332. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1333. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1334. spacer 1.35|38170|39|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1335. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1336. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1337. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1338. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1339. spacer 1.35|38170|39|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1340. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1341. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1342. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1343. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1344. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1345. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1346. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1347. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1348. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1349. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1350. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1351. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1352. spacer 1.35|38170|39|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1353. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttatgagtgtggtgatgtattcc	Protospacer
***************************************

1354. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1355. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1356. spacer 1.36|38232|38|NZ_CP044377|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1357. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1358. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1359. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1360. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1361. spacer 1.36|38232|38|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1362. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1363. spacer 1.36|38232|38|NZ_CP044377|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1364. spacer 1.36|38232|38|NZ_CP044377|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1365. spacer 1.36|38232|38|NZ_CP044377|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1366. spacer 1.36|38232|38|NZ_CP044377|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1367. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1368. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1369. spacer 1.36|38232|38|NZ_CP044377|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1370. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1371. spacer 1.36|38232|38|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1372. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1373. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1374. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1375. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1376. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1377. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1378. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1379. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1380. spacer 1.36|38232|38|NZ_CP044377|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1381. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1382. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1383. spacer 1.36|38232|38|NZ_CP044377|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1384. spacer 1.36|38232|38|NZ_CP044377|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1385. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1386. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1387. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1388. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1389. spacer 1.36|38232|38|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1390. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1391. spacer 1.36|38232|38|NZ_CP044377|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1392. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1393. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgtttgaaaaatggtattc	Protospacer
**************************************

1394. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1395. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1396. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1397. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1398. spacer 1.37|38293|37|NZ_CP044377|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1399. spacer 1.37|38293|37|NZ_CP044377|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1400. spacer 1.37|38293|37|NZ_CP044377|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1401. spacer 1.37|38293|37|NZ_CP044377|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1402. spacer 1.37|38293|37|NZ_CP044377|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1403. spacer 1.37|38293|37|NZ_CP044377|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1404. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1405. spacer 1.37|38293|37|NZ_CP044377|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1406. spacer 1.37|38293|37|NZ_CP044377|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1407. spacer 1.37|38293|37|NZ_CP044377|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1408. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1409. spacer 1.37|38293|37|NZ_CP044377|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1410. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1411. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaaatgggacctgttcgtatt	Protospacer
*************************************

1412. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccgggagaactggctgaatagtatt	Protospacer
**************************************

1413. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccgggagaactggctgaatagtatt	Protospacer
**************************************

1414. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccgggagaactggctgaatagtatt	Protospacer
**************************************

1415. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1416. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1417. spacer 1.39|38414|36|NZ_CP044377|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1418. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1419. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1420. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1421. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1422. spacer 1.39|38414|36|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1423. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1424. spacer 1.39|38414|36|NZ_CP044377|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1425. spacer 1.39|38414|36|NZ_CP044377|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1426. spacer 1.39|38414|36|NZ_CP044377|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1427. spacer 1.39|38414|36|NZ_CP044377|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1428. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1429. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1430. spacer 1.39|38414|36|NZ_CP044377|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1431. spacer 1.39|38414|36|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1432. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1433. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1434. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1435. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1436. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1437. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1438. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1439. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1440. spacer 1.39|38414|36|NZ_CP044377|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1441. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1442. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1443. spacer 1.39|38414|36|NZ_CP044377|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1444. spacer 1.39|38414|36|NZ_CP044377|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1445. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1446. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1447. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1448. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1449. spacer 1.39|38414|36|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1450. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1451. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1452. spacer 1.39|38414|36|NZ_CP044377|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1453. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1454. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtac	Protospacer
************************************

1455. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1456. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1457. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1458. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1459. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1460. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1461. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1462. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1463. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1464. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1465. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1466. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1467. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1468. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1469. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1470. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1471. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1472. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1473. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1474. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1475. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1476. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1477. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1478. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1479. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1480. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1481. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1482. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1483. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1484. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1485. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1486. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1487. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1488. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1489. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1490. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1491. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1492. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1493. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1494. spacer 1.40|38473|38|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1495. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1496. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1497. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1498. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1499. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcgtatt	Protospacer
**************************************

1500. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1501. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1502. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1503. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1504. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1505. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1506. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1507. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1508. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1509. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1510. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1511. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1512. spacer 1.41|38534|38|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1513. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1514. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1515. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP034040 (Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1516. spacer 1.41|38534|38|NZ_CP044377|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1517. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1518. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1519. spacer 1.41|38534|38|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1520. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1521. spacer 1.41|38534|38|NZ_CP044377|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1522. spacer 1.41|38534|38|NZ_CP044377|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1523. spacer 1.41|38534|38|NZ_CP044377|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1524. spacer 1.41|38534|38|NZ_CP044377|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1525. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1526. spacer 1.41|38534|38|NZ_CP044377|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1527. spacer 1.41|38534|38|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1528. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1529. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1530. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1531. spacer 1.41|38534|38|NZ_CP044377|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1532. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1533. spacer 1.41|38534|38|NZ_CP044377|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1534. spacer 1.41|38534|38|NZ_CP044377|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1535. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1536. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1537. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1538. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1539. spacer 1.41|38534|38|NZ_CP044377|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1540. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1541. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgagaaccactgcgagagtgtggtgtatt	Protospacer
**************************************

1542. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgttacccgctggctggaa	Protospacer
****************.***************

1543. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgttacccgctggctggaa	Protospacer
****************.***************

1544. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050828 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-2, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tcgtgctctcaaccgtcacccgctggctggaa	Protospacer
* ******************************

1545. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1546. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1547. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1548. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1549. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1550. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1551. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1552. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1553. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1554. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1555. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1556. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1557. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1558. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1559. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1560. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1561. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1562. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1563. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1564. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1565. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1566. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1567. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1568. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1569. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1570. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1571. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1572. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1573. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1574. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1575. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1576. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1577. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1578. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1579. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1580. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1581. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1582. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1583. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1584. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1585. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1586. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1587. spacer 1.3|37451|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.968

gcaccctcacgtataccttttgcacagtgtt	CRISPR spacer
gcaccctcacggataccttttgcacagtgtt	Protospacer
*********** *******************

1588. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1589. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1590. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012994 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1591. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1592. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1593. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1594. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1595. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_FO834905 (Klebsiella pneumoniae strain Kp52.145 plasmid II, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1596. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1597. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1598. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1599. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1600. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1601. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1602. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP030066 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1603. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1604. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1605. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1606. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1607. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032173 (Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1608. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1609. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1610. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LR792629 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_II) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1611. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1612. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025683 (Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1613. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1614. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP035203 (Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence) position: , mismatch: 1, identity: 0.969

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaact	Protospacer
****************************** *

1615. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 1, identity: 0.968

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
ccgagattgattaaagcaaagtaacggcggt	Protospacer
********** ********************

1616. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.968

aacaatttgaagtttctgcgccaggtcgttt-	CRISPR spacer
aacaatttgaagtttctgcgcc-ggtcgtttc	Protospacer
********************** ******** 

1617. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.968

aacaatttgaagtttctgcgcc-aggtcgttt	CRISPR spacer
aacaatttgaagtttctgcgccgaggtcgtt-	Protospacer
********************** ******** 

1618. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatcttgttgtctaccgtgtc	Protospacer
************* *****************

1619. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
taaatcagcaaatcttgttgtctaccgtgtc	Protospacer
************* *****************

1620. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026163 (Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence) position: , mismatch: 1, identity: 0.969

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcag	Protospacer
*** ****************************

1621. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044390 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence) position: , mismatch: 1, identity: 0.969

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcag	Protospacer
*** ****************************

1622. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044394 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence) position: , mismatch: 1, identity: 0.969

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcag	Protospacer
*** ****************************

1623. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcag	Protospacer
*** ****************************

1624. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044378 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence) position: , mismatch: 1, identity: 0.969

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcag	Protospacer
*** ****************************

1625. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044382 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence) position: , mismatch: 1, identity: 0.969

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcag	Protospacer
*** ****************************

1626. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044387 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence) position: , mismatch: 1, identity: 0.969

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcag	Protospacer
*** ****************************

1627. spacer 1.14|38109|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 1, identity: 0.969

agcagttcgaggaatagtgacaggcagtgcag	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcag	Protospacer
*** ****************************

1628. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022925 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B) position: , mismatch: 1, identity: 0.969

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agcaaatcgaaaatccggctgattgaaaaatg	Protospacer
********************* **********

1629. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1630. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1631. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1632. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1633. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1634. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1635. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1636. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1637. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1638. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1639. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1640. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1641. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1642. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1643. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1644. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1645. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1646. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1647. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1648. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1649. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1650. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1651. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.969

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgaggctgctgacggagaattgggacctgttc	Protospacer
******************* ************

1652. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1653. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1654. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1655. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1656. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1657. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1658. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1659. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1660. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1661. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1662. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1663. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1664. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1665. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1666. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1667. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1668. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1669. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1670. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1671. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1672. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1673. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1674. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1675. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1676. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1677. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1678. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1679. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1680. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1681. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1682. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1683. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1684. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1685. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1686. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1687. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1688. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1689. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1690. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044049 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1691. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1692. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1693. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1694. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1695. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1696. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1697. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1698. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1699. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1700. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.969

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
ccgacccggtgcccaggagaactggctgaata	Protospacer
**************.*****************

1701. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1702. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1703. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1704. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1705. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1706. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1707. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1708. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1709. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1710. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1711. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032198 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1712. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1713. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1714. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1715. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1716. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1717. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1718. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1719. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1720. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1721. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1722. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1723. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1724. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1725. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1726. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1727. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1728. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1729. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1730. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1731. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1732. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP037744 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1733. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1734. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1735. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1736. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1737. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1738. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1739. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1740. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1741. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1742. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1743. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1744. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1745. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1746. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1747. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1748. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1749. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1750. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_021502 (Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1751. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1752. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1753. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1754. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP033628 (Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1755. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1756. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1757. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1758. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to HG969996 (Klebsiella pneumoniae plasmid pIT-12C47, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1759. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1760. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to HG969998 (Klebsiella pneumoniae plasmid pIT-11C07, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1761. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1762. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1763. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025040 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1764. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1765. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1766. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1767. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1768. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1769. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1770. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1771. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1772. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1773. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1774. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1775. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1776. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1777. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1778. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1779. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_019165 (Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1780. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1781. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1782. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1783. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1784. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1785. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1786. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1787. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1788. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1789. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026271 (Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1790. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1791. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1792. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1793. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1794. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027616 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1795. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1796. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1797. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1798. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1799. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1800. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1801. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1802. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1803. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1804. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1805. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1806. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1807. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1808. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LT991960 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1809. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1810. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1811. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1812. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1813. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1814. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1815. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1816. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026174 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1817. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026181 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1818. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1819. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1820. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1821. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1822. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1823. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1824. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1825. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041648 (Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1826. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021166 (Klebsiella pneumoniae strain 203 plasmid p203, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1827. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1828. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1829. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to KY940546 (Klebsiella pneumoniae plasmid pUCLA3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1830. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1831. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1832. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1833. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1834. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1835. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1836. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1837. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1838. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1839. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1840. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1841. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1842. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1843. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1844. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to LT009689 (Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1845. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1846. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1847. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1848. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1849. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1850. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1851. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP046942 (Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1852. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP046943 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed4) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1853. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP006922 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1854. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032181 (Citrobacter freundii strain AR_0116 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1855. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP009115 (Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1856. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1857. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP048381 (Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1858. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026396 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1859. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1860. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1861. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1862. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1863. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1864. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020064 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1865. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1866. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1867. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1868. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1869. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1870. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1871. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1872. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1873. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1874. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1875. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1876. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1877. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1878. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1879. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1880. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1881. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1882. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1883. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1884. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1885. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1886. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1887. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1888. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1889. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1890. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026212 (Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1891. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1892. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1893. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1894. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1895. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1896. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1897. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1898. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1899. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024510 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1900. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1901. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1902. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1903. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1904. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1905. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1906. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1907. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015824 (Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1908. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1909. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044395 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1910. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1911. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1912. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1913. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052263 (Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1914. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1915. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011621 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1916. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1917. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1918. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1919. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1920. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1921. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1922. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1923. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1924. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1925. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052436 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1926. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1927. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1928. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1929. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1930. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024544 (Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1931. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1932. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1933. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1934. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1935. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1936. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1937. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1938. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1939. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1940. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_023905 (Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1941. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1942. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1943. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1944. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1945. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1946. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1947. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1948. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1949. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1950. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1951. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1952. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026717 (Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1953. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1954. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1955. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1956. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1957. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015383 (Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1958. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP030071 (Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1959. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1960. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1961. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1962. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1963. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015393 (Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1964. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1965. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1966. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018955 (Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1967. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP047634 (Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1968. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP047635 (Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1969. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1970. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052307 (Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1971. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1972. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1973. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK167987 (Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1974. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1975. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1976. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1977. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044045 (Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1978. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1979. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1980. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1981. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1982. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1983. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1984. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN657248 (Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1985. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1986. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1987. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

1988. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF156696 (Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1989. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1990. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1991. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1992. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KY271406 (Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1993. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KY495890 (Klebsiella pneumoniae strain 301 plasmid pKP301cro, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1994. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1995. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG252894 (Klebsiella pneumoniae strain Kpn-35963cz plasmid pKpn-35963cz, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1996. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1997. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG288683 (Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1998. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

1999. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggctcggattttgcgaaacaggtgcagggc	Protospacer
****.***************************

2000. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagggc	Protospacer
*.******************************

2001. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP054255 (Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcgtattttgcgaaacaggtgcagggc	Protospacer
******** ***********************

2002. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.974

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgttacccgctggctggaagtattc	Protospacer
****************.*********************

2003. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.974

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgttacccgctggctggaagtattc	Protospacer
****************.*********************

2004. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2005. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2006. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2007. spacer 1.23|37451|37|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2008. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2009. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2010. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2011. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2012. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2013. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2014. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2015. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2016. spacer 1.23|37451|37|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2017. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2018. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2019. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2020. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2021. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2022. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2023. spacer 1.23|37451|37|NZ_CP044377|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2024. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2025. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2026. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2027. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2028. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2029. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2030. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2031. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2032. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2033. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2034. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2035. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2036. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2037. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2038. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2039. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2040. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2041. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2042. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2043. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2044. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2045. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2046. spacer 1.23|37451|37|NZ_CP044377|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.973

gcaccctcacgtataccttttgcacagtgttagtatt	CRISPR spacer
gcaccctcacggataccttttgcacagtgttagtatt	Protospacer
*********** *************************

2047. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.974

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattt	Protospacer
*************************************.

2048. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.974

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattt	Protospacer
*************************************.

2049. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.974

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattt	Protospacer
*************************************.

2050. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.974

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattt	Protospacer
*************************************.

2051. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.974

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattt	Protospacer
*************************************.

2052. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.974

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattt	Protospacer
*************************************.

2053. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.974

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattt	Protospacer
*************************************.

2054. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.974

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattt	Protospacer
*************************************.

2055. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.974

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattt	Protospacer
*************************************.

2056. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.974

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattt	Protospacer
*************************************.

2057. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.974

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattt	Protospacer
*************************************.

2058. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.974

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattt	Protospacer
*************************************.

2059. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.974

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattt	Protospacer
*************************************.

2060. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.974

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattt	Protospacer
*************************************.

2061. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.974

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaaatgtattt	Protospacer
*************************************.

2062. spacer 1.28|37747|37|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 1, identity: 0.973

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgattaaagcaaagtaacggcggtggtatt	Protospacer
********** **************************

2063. spacer 1.33|38049|37|NZ_CP044377|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatcttgttgtctaccgtgtcggtatt	Protospacer
************* ***********************

2064. spacer 1.33|38049|37|NZ_CP044377|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

taaatcagcaaatattgttgtctaccgtgtcggtatt	CRISPR spacer
taaatcagcaaatcttgttgtctaccgtgtcggtatt	Protospacer
************* ***********************

2065. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2066. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2067. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2068. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2069. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2070. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2071. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2072. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2073. spacer 1.37|38293|37|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2074. spacer 1.37|38293|37|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2075. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2076. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2077. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2078. spacer 1.37|38293|37|NZ_CP044377|CRT matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2079. spacer 1.37|38293|37|NZ_CP044377|CRT matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2080. spacer 1.37|38293|37|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2081. spacer 1.37|38293|37|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2082. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2083. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2084. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2085. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2086. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2087. spacer 1.37|38293|37|NZ_CP044377|CRT matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 1, identity: 0.973

tgaggctgctgacggagaaatgggacctgttcgtatt	CRISPR spacer
tgaggctgctgacggagaattgggacctgttcgtatt	Protospacer
******************* *****************

2088. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2089. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2090. spacer 1.38|38353|38|NZ_CP044377|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2091. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2092. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2093. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2094. spacer 1.38|38353|38|NZ_CP044377|CRT matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2095. spacer 1.38|38353|38|NZ_CP044377|CRT matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2096. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2097. spacer 1.38|38353|38|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2098. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2099. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2100. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2101. spacer 1.38|38353|38|NZ_CP044377|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2102. spacer 1.38|38353|38|NZ_CP044377|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2103. spacer 1.38|38353|38|NZ_CP044377|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2104. spacer 1.38|38353|38|NZ_CP044377|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2105. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2106. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2107. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2108. spacer 1.38|38353|38|NZ_CP044377|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2109. spacer 1.38|38353|38|NZ_CP044377|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2110. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2111. spacer 1.38|38353|38|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2112. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2113. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2114. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2115. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2116. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2117. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2118. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2119. spacer 1.38|38353|38|NZ_CP044377|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2120. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2121. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2122. spacer 1.38|38353|38|NZ_CP044377|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2123. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2124. spacer 1.38|38353|38|NZ_CP044377|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2125. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2126. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2127. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2128. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2129. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2130. spacer 1.38|38353|38|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2131. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2132. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2133. spacer 1.38|38353|38|NZ_CP044377|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2134. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2135. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.974

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaatagtatt	Protospacer
***************.**********************

2136. spacer 1.39|38414|36|NZ_CP044377|CRT matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.972

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtat	Protospacer
***********************************.

2137. spacer 1.39|38414|36|NZ_CP044377|CRT matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 1, identity: 0.972

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtat	Protospacer
***********************************.

2138. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.972

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtat	Protospacer
***********************************.

2139. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.972

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtat	Protospacer
***********************************.

2140. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 1, identity: 0.972

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
gttccctgcactaagacgctggtggtcgccacgtat	Protospacer
***********************************.

2141. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 1, identity: 0.974

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgcgaaccactgcgagagtgtggtgtatt	Protospacer
*********** **************************

2142. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.974

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgcgaaccactgcgagagtgtggtgtatt	Protospacer
*********** **************************

2143. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.974

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgcgaaccactgcgagagtgtggtgtatt	Protospacer
*********** **************************

2144. spacer 1.41|38534|38|NZ_CP044377|CRT matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.974

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgcgaaccactgcgagagtgtggtgtatt	Protospacer
*********** **************************

2145. spacer 1.41|38534|38|NZ_CP044377|CRT matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 1, identity: 0.974

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgcgaaccactgcgagagtgtggtgtatt	Protospacer
*********** **************************

2146. spacer 1.41|38534|38|NZ_CP044377|CRT matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 1, identity: 0.974

gggcatgagcgagaaccactgcgagagtgtggtgtatt	CRISPR spacer
gggcatgagcgcgaaccactgcgagagtgtggtgtatt	Protospacer
*********** **************************

2147. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 2, identity: 0.935

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaaaccaccgaggcagg	Protospacer
****************  *************

2148. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 2, identity: 0.935

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaaaccaccgaggcagg	Protospacer
****************  *************

2149. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 2, identity: 0.935

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
cttagagaagcaaaaaaaccaccgaggcagg	Protospacer
****************  *************

2150. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2151. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2152. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2153. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2154. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2155. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2156. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2157. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2158. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2159. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2160. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2161. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2162. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2163. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2164. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2165. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2166. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2167. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2168. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2169. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2170. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2171. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2172. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2173. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2174. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2175. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2176. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2177. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034040 (Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2178. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034040 (Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
ttatcaatggggaaaaatcttcatttgtaact	Protospacer
***.************************** *

2179. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2180. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2181. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2182. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2183. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2184. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031790 (Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2185. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042869 (Escherichia coli strain ATCC BAA-196 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2186. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2187. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2188. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2189. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2190. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2191. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2192. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2193. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2194. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2195. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2196. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2197. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2198. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2199. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2200. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2201. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2202. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2203. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2204. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaact	Protospacer
 ***************************** *

2205. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP036322 (Klebsiella pneumoniae strain VBA2172 plasmid pCol440I) position: , mismatch: 2, identity: 0.92

aacatcagtggaaatccactgcggc	CRISPR spacer
aacgccagtggaaatccactgcggc	Protospacer
***..********************

2206. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP038459 (Escherichia coli strain EC-129 plasmid pEC129_6, complete sequence) position: , mismatch: 2, identity: 0.92

aacatcagtggaaatccactgcggc	CRISPR spacer
aacgccagtggaaatccactgcggc	Protospacer
***..********************

2207. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP044044 (Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.92

aacatcagtggaaatccactgcggc	CRISPR spacer
aacgccagtggaaatccactgcggc	Protospacer
***..********************

2208. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025945 (Escherichia coli strain SCEC020023 plasmid p1_020023, complete sequence) position: , mismatch: 2, identity: 0.92

aacatcagtggaaatccactgcggc	CRISPR spacer
aacgccagtggaaatccactgcggc	Protospacer
***..********************

2209. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP033949 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

aacatcagtggaaatccactgcggc	CRISPR spacer
aacgccagtggaaatccactgcggc	Protospacer
***..********************

2210. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034676 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_6kb, complete sequence) position: , mismatch: 2, identity: 0.92

aacatcagtggaaatccactgcggc	CRISPR spacer
aacgccagtggaaatccactgcggc	Protospacer
***..********************

2211. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

2212. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

2213. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

2214. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

2215. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011587 (Enterobacter asburiae strain CAV1043 plasmid pCAV1043-51, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

2216. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

2217. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NC_011281 (Klebsiella variicola strain 342 plasmid pKP91, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

2218. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

2219. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

2220. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

2221. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

2222. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 2, identity: 0.939

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttataagtgtggtgaag	Protospacer
********************.********** *

2223. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 2, identity: 0.939

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttataagtgtggtgaag	Protospacer
********************.********** *

2224. spacer 1.15|38170|33|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 2, identity: 0.939

ttaatgttttgttaatttatgagtgtggtgatg	CRISPR spacer
ttaatgttttgttaatttataagtgtggtgaag	Protospacer
********************.********** *

2225. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to MK416007 (Klebsiella phage ST405-OXA48phi1.2, complete genome) position: , mismatch: 2, identity: 0.938

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
agtaaatcgaaaatccggctgattgaaaaatg	Protospacer
**.****************** **********

2226. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2227. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2228. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2229. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2230. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2231. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2232. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP042535 (Citrobacter freundii strain E51 plasmid pE51_001, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2233. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2234. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2235. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2236. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2237. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2238. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2239. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP013339 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2240. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2241. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2242. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026720 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2243. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2244. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018017 (Kosakonia radicincitans DSM 16656 plasmid pKrDSM16656L, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2245. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2246. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.933

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
ttccttgcactaagacgctggtgatcgcca	Protospacer
****.******************.******

2247. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2248. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to LK391770 (Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcaggga	Protospacer
*.***************************** 

2249. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KY454639 (Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcaggga	Protospacer
*.***************************** 

2250. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcaggga	Protospacer
*.***************************** 

2251. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015754 (Klebsiella pneumoniae strain W14 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcaggga	Protospacer
*.***************************** 

2252. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021946 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcaggga	Protospacer
*.***************************** 

2253. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggattttgcgaaacagatgcaggga	Protospacer
***********************.******* 

2254. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP016160 (Klebsiella pneumoniae strain TH1 isolate TH1 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcaggga	Protospacer
*.***************************** 

2255. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2256. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2257. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050837 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccgggtcggattttgcgaagcaggtgcagggc	Protospacer
**** **************.************

2258. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2259. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2260. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2261. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2262. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2263. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2264. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2265. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_AP018754 (Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2266. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2267. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2268. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2269. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP035637 (Enterobacter cloacae strain EN3600 plasmid unnamed5, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccggttcggactttgcgaaacaggtccagggc	Protospacer
**********.************** ******

2270. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2271. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2272. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2273. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2274. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2275. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2276. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2277. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2278. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2279. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2280. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2281. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2282. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2283. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2284. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2285. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2286. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2287. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2288. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2289. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2290. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2291. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2292. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2293. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2294. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ccgggtcggattttgcgaagcaggtgcagggc	Protospacer
**** **************.************

2295. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2296. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2297. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2298. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2299. spacer 1.20|38474|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938

ccggttcggattttgcgaaacaggtgcagggc	CRISPR spacer
ctggttcggattttgcgaaacaggtgcagagc	Protospacer
*.***************************.**

2300. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 2, identity: 0.946

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaaaccaccgaggcaggggtatt	Protospacer
****************  *******************

2301. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 2, identity: 0.946

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaaaccaccgaggcaggggtatt	Protospacer
****************  *******************

2302. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 2, identity: 0.946

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaaaccaccgaggcaggggtatt	Protospacer
****************  *******************

2303. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP034040 (Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.947

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttatcaatggggaaaaatcttcatttgtaactgtattc	Protospacer
***.************************** *******

2304. spacer 1.35|38170|39|NZ_CP044377|CRT matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 2, identity: 0.949

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttataagtgtggtgaagtattcc	Protospacer
********************.********** *******

2305. spacer 1.35|38170|39|NZ_CP044377|CRT matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 2, identity: 0.949

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttataagtgtggtgaagtattcc	Protospacer
********************.********** *******

2306. spacer 1.35|38170|39|NZ_CP044377|CRT matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 2, identity: 0.949

ttaatgttttgttaatttatgagtgtggtgatgtattcc	CRISPR spacer
ttaatgttttgttaatttataagtgtggtgaagtattcc	Protospacer
********************.********** *******

2307. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2308. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2309. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2310. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2311. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2312. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2313. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2314. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2315. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2316. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2317. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2318. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2319. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2320. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2321. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2322. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2323. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2324. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2325. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2326. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2327. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 3, identity: 0.906

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaact	Protospacer
 ******************.********** *

2328. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP018674 (Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2329. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KR822246 (Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2330. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_KJ958926 (Klebsiella pneumoniae strain Kpn-3002cz plasmid pB-3002cz, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2331. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LN824135 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2332. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP015502 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2333. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025214 (Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2334. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP025214 (Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2335. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012569 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3.X, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2336. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024835 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2337. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021687 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2338. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021720 (Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2339. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2340. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024839 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2341. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP036446 (Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2342. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP012564 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2343. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP024431 (Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2344. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to MN792917 (Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENM30_NDM1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2345. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2346. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050361 (Klebsiella pneumoniae strain 47733 plasmid p47733_ARR2, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2347. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2348. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP032188 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2349. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP020050 (Escherichia coli strain AR_0118 plasmid unitig_2, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2350. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP021758 (Klebsiella pneumoniae strain AR_0138 plasmid tig00000001, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2351. spacer 1.7|37686|32|NZ_CP044377|CRISPRCasFinder matches to MN688131 (Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENC1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

2352. spacer 1.18|38354|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP036439 (Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

ccgacccggtgcccgggagaactggctgaata	CRISPR spacer
tcgacccggtgcccaggagaactggctgaaca	Protospacer
.*************.***************.*

2353. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 3, identity: 0.919

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
cttagagaagcaaaaaccccaccgaggcagggggtat	Protospacer
*********************************   *

2354. spacer 1.28|37747|37|NZ_CP044377|CRT matches to MK416022 (Klebsiella phage ST846-OXA48phi9.2, complete genome) position: , mismatch: 4, identity: 0.892

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtgaaacg	Protospacer
********************************. *. 

2355. spacer 1.28|37747|37|NZ_CP044377|CRT matches to MK448237 (Klebsiella phage ST974-OXA48phi18.2, complete genome) position: , mismatch: 4, identity: 0.892

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtgaaacg	Protospacer
********************************. *. 

2356. spacer 1.28|37747|37|NZ_CP044377|CRT matches to KY271399 (Klebsiella phage 5 LV-2017, complete genome) position: , mismatch: 4, identity: 0.892

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtgaaacg	Protospacer
********************************. *. 

2357. spacer 1.28|37747|37|NZ_CP044377|CRT matches to MK422450 (Klebsiella phage ST13-OXA48phi12.4, complete genome) position: , mismatch: 4, identity: 0.892

ccgagattgagtaaagcaaagtaacggcggtggtatt	CRISPR spacer
ccgagattgagtaaagcaaagtaacggcggtgaaacg	Protospacer
********************************. *. 

2358. spacer 1.36|38232|38|NZ_CP044377|CRT matches to NZ_CP022925 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B) position: , mismatch: 4, identity: 0.895

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agcaaatcgaaaatccggctgattgaaaaatggtctca	Protospacer
********************* ************ *. 

2359. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP044049 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.895

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gccgacccggtgcccaggagaactggctgaataccatc	Protospacer
***************.***************** .**.

2360. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2361. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2362. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2363. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2364. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2365. spacer 1.39|38414|36|NZ_CP044377|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2366. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP042535 (Citrobacter freundii strain E51 plasmid pE51_001, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2367. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2368. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2369. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2370. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2371. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2372. spacer 1.39|38414|36|NZ_CP044377|CRT matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2373. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP013339 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2374. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2375. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2376. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP026720 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0060 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2377. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2378. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP018017 (Kosakonia radicincitans DSM 16656 plasmid pKrDSM16656L, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2379. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2380. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.889

gttccctgcactaagacgctggtggtcgccacgtac-	CRISPR spacer
gttccttgcactaagacgctggtgatcgcca-atacc	Protospacer
*****.******************.****** .*** 

2381. spacer 1.1|37329|32|NZ_CP044377|CRISPRCasFinder matches to NZ_FO704549 (Xenorhabdus doucetiae strain FRM16 plasmid XD_p, complete sequence) position: , mismatch: 5, identity: 0.844

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tcgttctctccaccgtcacccgctggctggcg	Protospacer
* ** ***** ******************* .

2382. spacer 1.6|37632|25|NZ_CP044377|CRISPRCasFinder matches to NZ_CP050824 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-2, complete sequence) position: , mismatch: 5, identity: 0.8

aacatcagtggaaatccactgcggc	CRISPR spacer
-----cagtggaaatccactgcggc	Protospacer
     ********************

2383. spacer 1.19|38415|30|NZ_CP044377|CRISPRCasFinder matches to NC_025028 (Uncultured bacterium pMCBF6 plasmid pMCBF6, complete sequence) position: , mismatch: 5, identity: 0.833

ttccctgcactaagacgctggtggtcgcca	CRISPR spacer
tgtactgcactaacacgctggtgttcgcca	Protospacer
* . ********* ********* ******

2384. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP038459 (Escherichia coli strain EC-129 plasmid pEC129_6, complete sequence) position: , mismatch: 5, identity: 0.868

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaaaaaaat	Protospacer
********************************. *  .

2385. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP019902 (Raoultella planticola strain GODA plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.868

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaaaaaa--	Protospacer
********************************. *   

2386. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP025945 (Escherichia coli strain SCEC020023 plasmid p1_020023, complete sequence) position: , mismatch: 5, identity: 0.868

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaaaaaaat	Protospacer
********************************. *  .

2387. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP029779 (Klebsiella pneumoniae strain WCHKP020034 plasmid p1_020034, complete sequence) position: , mismatch: 5, identity: 0.868

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaaaaaaat	Protospacer
********************************. *  .

2388. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2389. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP012994 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2390. spacer 1.25|37571|38|NZ_CP044377|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2391. spacer 1.25|37571|38|NZ_CP044377|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2392. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2393. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_FO834905 (Klebsiella pneumoniae strain Kp52.145 plasmid II, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2394. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2395. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2396. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2397. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2398. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP032173 (Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2399. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2400. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2401. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2402. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP035203 (Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2403. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2404. spacer 1.25|37571|38|NZ_CP044377|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2405. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2406. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2407. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2408. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2409. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP030066 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2410. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2411. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2412. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2413. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_LR792629 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_II) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2414. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP025683 (Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence) position: , mismatch: 5, identity: 0.868

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
ttaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
****************************** * * ..*

2415. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP019902 (Raoultella planticola strain GODA plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.839

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcactggc	Protospacer
*************************..   *

2416. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP029779 (Klebsiella pneumoniae strain WCHKP020034 plasmid p1_020034, complete sequence) position: , mismatch: 5, identity: 0.839

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcactggc	Protospacer
*************************..   *

2417. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP024491 (Klebsiella pneumoniae strain INF249 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.839

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacatcagtggaaatccactgcggcactggc	Protospacer
*************************..   *

2418. spacer 1.36|38232|38|NZ_CP044377|CRT matches to MK416007 (Klebsiella phage ST405-OXA48phi1.2, complete genome) position: , mismatch: 5, identity: 0.868

agcaaatcgaaaatccggctgtttgaaaaatggtattc	CRISPR spacer
agtaaatcgaaaatccggctgattgaaaaatggtctca	Protospacer
**.****************** ************ *. 

2419. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_014312 (Klebsiella pneumoniae plasmid pKP048, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2420. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2421. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2422. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2423. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2424. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2425. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2426. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP040995 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2427. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2428. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2429. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2430. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2431. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2432. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2433. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2434. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2435. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2436. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2437. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2438. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2439. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2440. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2441. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2442. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_FO834904 (Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2443. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2444. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2445. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2446. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2447. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2448. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2449. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2450. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2451. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2452. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2453. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2454. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2455. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2456. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2457. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2458. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP031851 (Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2459. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2460. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2461. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2462. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2463. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2464. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2465. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2466. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2467. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2468. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_011281 (Klebsiella variicola strain 342 plasmid pKP91, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2469. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2470. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2471. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2472. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2473. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2474. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2475. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2476. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP023916 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2477. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2478. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2479. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026163 (Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2480. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2481. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2482. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2483. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP032836 (Klebsiella pneumoniae strain INF237 plasmid pINF237_03, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2484. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2485. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN842291 (Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2486. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP044390 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2487. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP044394 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2488. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2489. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP044378 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2490. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP044382 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2491. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2492. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2493. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2494. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052438 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2495. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_016846 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2496. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2497. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP044387 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2498. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2499. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_LR792629 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_II) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2500. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_LR792630 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2501. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2502. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2503. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2504. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2505. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2506. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2507. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP044049 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2508. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN891678 (Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-KPC, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2509. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_LR130540 (Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2510. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2511. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MH909340 (Klebsiella pneumoniae strain A1763 plasmid pA1763-KPC, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2512. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MK413718 (Klebsiella pneumoniae strain 427113 plasmid p427113-2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2513. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MH477636 (Klebsiella pneumoniae strain 130504051 plasmid p504051-KPC, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2514. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2515. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_019390 (Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2516. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP014777 (Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2517. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN824000 (Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2518. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MG288676 (Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2519. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MG736312 (Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2520. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2521. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP035204 (Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2522. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2523. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MT108210 (Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence) position: , mismatch: 5, identity: 0.868

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*********************************.    

2524. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP028385 (Providencia heimbachae strain 99101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
atgtcagaaacaaaaacgccaccgaggcagg	Protospacer
 *   ****.******* *************

2525. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_CP050828 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-2, complete sequence) position: , mismatch: 6, identity: 0.842

tggtgctctcaaccgtcacccgctggctggaagtattc	CRISPR spacer
tcgtgctctcaaccgtcacccgctggctggaaaaaaat	Protospacer
* ******************************. *  .

2526. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2527. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2528. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2529. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2530. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2531. spacer 1.25|37571|38|NZ_CP044377|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2532. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2533. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2534. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2535. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2536. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2537. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2538. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2539. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2540. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2541. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2542. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2543. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2544. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2545. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2546. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2547. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2548. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2549. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2550. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2551. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2552. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP034040 (Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2553. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2554. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2555. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2556. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2557. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2558. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2559. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2560. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2561. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2562. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2563. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2564. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2565. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2566. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2567. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2568. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2569. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2570. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP031790 (Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2571. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP042869 (Escherichia coli strain ATCC BAA-196 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2572. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2573. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2574. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2575. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2576. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2577. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2578. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2579. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 6, identity: 0.842

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcttcatttgtaacttttccc	Protospacer
 ***************************** * * ..*

2580. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP025945 (Escherichia coli strain SCEC020023 plasmid p1_020023, complete sequence) position: , mismatch: 6, identity: 0.806

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacgccagtggaaatccactgcggcctgcgc	Protospacer
***..******************** *.. *

2581. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP033949 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.806

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacgccagtggaaatccactgcggcctgcgc	Protospacer
***..******************** *.. *

2582. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP034676 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_6kb, complete sequence) position: , mismatch: 6, identity: 0.806

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacgccagtggaaatccactgcggcctgcgc	Protospacer
***..******************** *.. *

2583. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP036322 (Klebsiella pneumoniae strain VBA2172 plasmid pCol440I) position: , mismatch: 6, identity: 0.806

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacgccagtggaaatccactgcggcctgcgc	Protospacer
***..******************** *.. *

2584. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP038459 (Escherichia coli strain EC-129 plasmid pEC129_6, complete sequence) position: , mismatch: 6, identity: 0.806

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacgccagtggaaatccactgcggcctgcgc	Protospacer
***..******************** *.. *

2585. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP044044 (Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
aacgccagtggaaatccactgcggcctgcgc	Protospacer
***..******************** *.. *

2586. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP044390 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence) position: , mismatch: 6, identity: 0.842

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcagcagccc	Protospacer
*** ****************************  ...*

2587. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP044394 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence) position: , mismatch: 6, identity: 0.842

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcagcagccc	Protospacer
*** ****************************  ...*

2588. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP044378 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence) position: , mismatch: 6, identity: 0.842

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcagcagccc	Protospacer
*** ****************************  ...*

2589. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP044382 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence) position: , mismatch: 6, identity: 0.842

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcagcagccc	Protospacer
*** ****************************  ...*

2590. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP044387 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence) position: , mismatch: 6, identity: 0.842

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcagcagccc	Protospacer
*** ****************************  ...*

2591. spacer 1.38|38353|38|NZ_CP044377|CRT matches to NZ_CP036439 (Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccgacccggtgcccgggagaactggctgaatagtatt	CRISPR spacer
gtcgacccggtgcccaggagaactggctgaacaccatc	Protospacer
*.*************.***************.* .**.

2592. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2593. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2594. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2595. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2596. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2597. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2598. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2599. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2600. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2601. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2602. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP032198 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2603. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2604. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2605. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2606. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2607. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2608. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2609. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2610. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2611. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2612. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2613. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2614. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2615. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2616. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2617. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2618. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2619. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2620. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2621. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2622. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2623. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP037744 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2624. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2625. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2626. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2627. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2628. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2629. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2630. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2631. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2632. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2633. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2634. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2635. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2636. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2637. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2638. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2639. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2640. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2641. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_021502 (Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2642. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2643. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2644. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2645. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP033628 (Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2646. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2647. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2648. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2649. spacer 1.40|38473|38|NZ_CP044377|CRT matches to HG969996 (Klebsiella pneumoniae plasmid pIT-12C47, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2650. spacer 1.40|38473|38|NZ_CP044377|CRT matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2651. spacer 1.40|38473|38|NZ_CP044377|CRT matches to HG969998 (Klebsiella pneumoniae plasmid pIT-11C07, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2652. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2653. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2654. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP025040 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2655. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2656. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2657. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2658. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2659. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2660. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2661. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2662. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2663. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2664. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2665. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2666. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2667. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2668. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2669. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2670. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_019165 (Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2671. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2672. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2673. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2674. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2675. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2676. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2677. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2678. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2679. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2680. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026271 (Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2681. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2682. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2683. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2684. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2685. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP027616 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2686. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2687. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2688. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2689. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2690. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2691. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2692. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2693. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2694. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2695. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2696. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2697. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2698. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2699. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_LT991960 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2700. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2701. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2702. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2703. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2704. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2705. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2706. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2707. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026174 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2708. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026181 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2709. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2710. spacer 1.40|38473|38|NZ_CP044377|CRT matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2711. spacer 1.40|38473|38|NZ_CP044377|CRT matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2712. spacer 1.40|38473|38|NZ_CP044377|CRT matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2713. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2714. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2715. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2716. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP041648 (Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2717. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP021166 (Klebsiella pneumoniae strain 203 plasmid p203, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2718. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2719. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2720. spacer 1.40|38473|38|NZ_CP044377|CRT matches to KY940546 (Klebsiella pneumoniae plasmid pUCLA3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2721. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2722. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2723. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2724. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2725. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2726. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2727. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2728. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2729. spacer 1.40|38473|38|NZ_CP044377|CRT matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2730. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2731. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2732. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2733. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2734. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2735. spacer 1.40|38473|38|NZ_CP044377|CRT matches to LT009689 (Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2736. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2737. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2738. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2739. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2740. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2741. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2742. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP046942 (Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2743. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP046943 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed4) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2744. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP006922 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2745. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP032181 (Citrobacter freundii strain AR_0116 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2746. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP009115 (Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2747. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2748. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP048381 (Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2749. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026396 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2750. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2751. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2752. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2753. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2754. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2755. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP020064 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2756. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2757. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2758. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2759. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2760. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2761. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2762. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2763. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2764. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2765. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2766. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2767. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2768. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2769. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2770. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2771. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2772. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2773. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2774. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2775. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2776. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2777. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2778. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2779. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2780. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2781. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026212 (Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2782. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2783. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2784. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2785. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2786. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2787. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2788. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2789. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2790. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP024510 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2791. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2792. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2793. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2794. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2795. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2796. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2797. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2798. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP015824 (Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2799. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2800. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP044395 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2801. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2802. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2803. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2804. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052263 (Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2805. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2806. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP011621 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2807. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2808. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2809. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2810. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2811. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2812. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2813. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2814. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2815. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2816. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052436 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2817. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2818. spacer 1.40|38473|38|NZ_CP044377|CRT matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2819. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2820. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2821. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP024544 (Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2822. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2823. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2824. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2825. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2826. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2827. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2828. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2829. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2830. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2831. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_023905 (Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2832. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2833. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2834. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2835. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2836. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2837. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2838. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2839. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2840. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2841. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2842. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2843. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026717 (Klebsiella oxytoca strain AR_0028 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2844. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2845. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2846. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2847. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2848. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP015383 (Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2849. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP030071 (Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2850. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2851. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2852. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2853. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2854. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP015393 (Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2855. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2856. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2857. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018955 (Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2858. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP047634 (Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2859. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP047635 (Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2860. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2861. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052307 (Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2862. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2863. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2864. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MK167987 (Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2865. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2866. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2867. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2868. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP044045 (Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2869. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2870. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2871. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2872. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2873. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2874. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2875. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN657248 (Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2876. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2877. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2878. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2879. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MF156696 (Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2880. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2881. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2882. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2883. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KY271406 (Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2884. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KY495890 (Klebsiella pneumoniae strain 301 plasmid pKP301cro, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2885. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2886. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MG252894 (Klebsiella pneumoniae strain Kpn-35963cz plasmid pKpn-35963cz, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2887. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2888. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_MG288683 (Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2889. spacer 1.40|38473|38|NZ_CP044377|CRT matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2890. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggctcggattttgcgaaacaggtgcagggcaatgg	Protospacer
*****.***************************.    

2891. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggcaatgg	Protospacer
**.******************************.    

2892. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP054255 (Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcgtattttgcgaaacaggtgcagggcaatgg	Protospacer
********* ***********************.    

2893. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP035637 (Enterobacter cloacae strain EN3600 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.842

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggactttgcgaaacaggtccagggcggggg	Protospacer
***********.************** ******* .  

2894. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 7, identity: 0.781

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
atatgtatggggaaaaatcttcatttgcaaca	Protospacer
 **.  *********************.**  

2895. spacer 1.5|37571|32|NZ_CP044377|CRISPRCasFinder matches to NC_011775 (Bacillus cereus G9842 plasmid pG9842_209, complete sequence) position: , mismatch: 7, identity: 0.781

ttaccaatggggaaaaatcttcatttgtaaat	CRISPR spacer
atatgtatggggaaaaatcttcatttgcaaca	Protospacer
 **.  *********************.**  

2896. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_CP017943 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgacgatgctgacggagaaatgggcgatggcc	Protospacer
*** * ******************   ** .*

2897. spacer 1.17|38293|32|NZ_CP044377|CRISPRCasFinder matches to NZ_LR723673 (Rhizobium flavum strain YW14 plasmid 4) position: , mismatch: 7, identity: 0.781

tgaggctgctgacggagaaatgggacctgttc	CRISPR spacer
tgacgatgctgacggagaaatgggtaatggcc	Protospacer
*** * ******************   ** .*

2898. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2899. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2900. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2901. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2902. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2903. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2904. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2905. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2906. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2907. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2908. spacer 1.25|37571|38|NZ_CP044377|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2909. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2910. spacer 1.25|37571|38|NZ_CP044377|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2911. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2912. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2913. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2914. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2915. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2916. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2917. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2918. spacer 1.25|37571|38|NZ_CP044377|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 7, identity: 0.816

ttaccaatggggaaaaatcttcatttgtaaatgtattc	CRISPR spacer
gtaccaatggggaaaaatcctcatttgtaacttttccc	Protospacer
 ******************.********** * * ..*

2919. spacer 1.26|37632|31|NZ_CP044377|CRT matches to CP000617 (Burkholderia vietnamiensis G4 plasmid pBVIE01, complete sequence) position: , mismatch: 7, identity: 0.774

aacatca--gtggaaatccactgcggcgtattc	CRISPR spacer
--cgtcgtcgtggaaatgcactgcagcgtattg	Protospacer
  *.**.  ******** ******.******* 

2920. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 7, identity: 0.816

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
********* ******************* ***    .

2921. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 7, identity: 0.816

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
********* ******************* ***    .

2922. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 7, identity: 0.816

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
********* ******************* ***    .

2923. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP011587 (Enterobacter asburiae strain CAV1043 plasmid pCAV1043-51, complete sequence) position: , mismatch: 7, identity: 0.816

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
********* ******************* ***    .

2924. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 7, identity: 0.816

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
********* ******************* ***    .

2925. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NC_011281 (Klebsiella variicola strain 342 plasmid pKP91, complete sequence) position: , mismatch: 7, identity: 0.816

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
********* ******************* ***    .

2926. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 7, identity: 0.816

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
********* ******************* ***    .

2927. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
********* ******************* ***    .

2928. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 7, identity: 0.816

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
********* ******************* ***    .

2929. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 7, identity: 0.816

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
********* ******************* ***    .

2930. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 7, identity: 0.816

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
********* ******************* ***    .

2931. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP026163 (Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence) position: , mismatch: 7, identity: 0.816

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcagcagcct	Protospacer
*** ****************************  ....

2932. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcagcagcct	Protospacer
*** ****************************  ....

2933. spacer 1.34|38109|38|NZ_CP044377|CRT matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 7, identity: 0.816

agcagttcgaggaatagtgacaggcagtgcaggtattc	CRISPR spacer
agctgttcgaggaatagtgacaggcagtgcagcagcct	Protospacer
*** ****************************  ....

2934. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2935. spacer 1.40|38473|38|NZ_CP044377|CRT matches to LK391770 (Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggaaatgg	Protospacer
**.***************************** .    

2936. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KY454639 (Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggaaatgg	Protospacer
**.***************************** .    

2937. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggaaatgg	Protospacer
**.***************************** .    

2938. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP015754 (Klebsiella pneumoniae strain W14 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggaaatgg	Protospacer
**.***************************** .    

2939. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP021946 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggaaatgg	Protospacer
**.***************************** .    

2940. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccggttcggattttgcgaaacagatgcagggaaatgg	Protospacer
************************.******* .    

2941. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP016160 (Klebsiella pneumoniae strain TH1 isolate TH1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagggaaatgg	Protospacer
**.***************************** .    

2942. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2943. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2944. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP050837 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccgggtcggattttgcgaagcaggtgcagggcagcgg	Protospacer
***** **************.************.    

2945. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2946. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2947. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2948. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2949. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2950. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2951. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2952. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_AP018754 (Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2953. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2954. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2955. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2956. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2957. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2958. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2959. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2960. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2961. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2962. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2963. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2964. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2965. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2966. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2967. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2968. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2969. spacer 1.40|38473|38|NZ_CP044377|CRT matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2970. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2971. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2972. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2973. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2974. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2975. spacer 1.40|38473|38|NZ_CP044377|CRT matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2976. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2977. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2978. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2979. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2980. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gccgggtcggattttgcgaagcaggtgcagggcagcgg	Protospacer
***** **************.************.    

2981. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2982. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2983. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2984. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2985. spacer 1.40|38473|38|NZ_CP044377|CRT matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.816

gccggttcggattttgcgaaacaggtgcagggcgtatt	CRISPR spacer
gctggttcggattttgcgaaacaggtgcagagcaatgg	Protospacer
**.***************************.**.    

2986. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to MT741943 (Acinetobacter phage Meroveus, complete genome) position: , mismatch: 8, identity: 0.742

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aaccatttgaagtttccgcgccacgccaaag	Protospacer
*** ************.****** *.*.   

2987. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to NC_049511 (Acinetobacter phage AM101, complete genome) position: , mismatch: 8, identity: 0.742

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aaccatttgaagtttccgcgccatgccaaag	Protospacer
*** ************.****** *.*.   

2988. spacer 1.11|37929|31|NZ_CP044377|CRISPRCasFinder matches to MT409116 (Acinetobacter phage Octan, complete genome) position: , mismatch: 8, identity: 0.742

aacaatttgaagtttctgcgccaggtcgttt	CRISPR spacer
aaccatttgaagtttccgcgccacgccaaag	Protospacer
*** ************.****** *.*.   

2989. spacer 1.16|38232|32|NZ_CP044377|CRISPRCasFinder matches to NC_019898 (Thermobacillus composti KWC4 plasmid pTHECO01, complete sequence) position: , mismatch: 8, identity: 0.75

agcaaatcgaaaatccggctgtttgaaaaatg	CRISPR spacer
ttcaaatcgagaatccggatgtttgggaatcg	Protospacer
  ********.******* ******..** .*

2990. spacer 1.21|37329|38|NZ_CP044377|CRT matches to NZ_FO704549 (Xenorhabdus doucetiae strain FRM16 plasmid XD_p, complete sequence) position: , mismatch: 8, identity: 0.789

tggtgctctcaaccgtcacccgctggctgg-aagtattc	CRISPR spacer
tcgttctctccaccgtcacccgctggctggcgcgcaat-	Protospacer
* ** ***** ******************* . *.* * 

2991. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP015502 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

2992. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP012569 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3.X, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

2993. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP024835 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_1, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

2994. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

2995. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP024839 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_1, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

2996. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP012564 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

2997. spacer 1.27|37686|38|NZ_CP044377|CRT matches to MN792917 (Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENM30_NDM1, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

2998. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

2999. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP050361 (Klebsiella pneumoniae strain 47733 plasmid p47733_ARR2, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3000. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP032188 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3001. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP020050 (Escherichia coli strain AR_0118 plasmid unitig_2, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3002. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP021758 (Klebsiella pneumoniae strain AR_0138 plasmid tig00000001, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3003. spacer 1.27|37686|38|NZ_CP044377|CRT matches to MN688131 (Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENC1, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3004. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP018674 (Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3005. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_KR822246 (Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3006. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_KJ958926 (Klebsiella pneumoniae strain Kpn-3002cz plasmid pB-3002cz, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3007. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_LN824135 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3008. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP025214 (Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3009. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP025214 (Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3010. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP021687 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3011. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP021720 (Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3012. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP036446 (Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3013. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NZ_CP024431 (Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3014. spacer 1.27|37686|38|NZ_CP044377|CRT matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 8, identity: 0.789

cgaaaacggcaaccttcataaaaacgtcttttgtattc	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgttgatgat	Protospacer
 ******** ******************* ***    .

3015. spacer 1.4|37511|31|NZ_CP044377|CRISPRCasFinder matches to NZ_CP030844 (Acidisarcina polymorpha strain SBC82 plasmid pACPOL3, complete sequence) position: , mismatch: 9, identity: 0.71

cttagagaagcaaaaaccccaccgaggcagg	CRISPR spacer
aaagcaaaagcaaaaaacccacggaggcagc	Protospacer
   . *.********* ***** ******* 

3016. spacer 1.8|37747|31|NZ_CP044377|CRISPRCasFinder matches to NC_019739 (Microcoleus sp. PCC 7113 plasmid pMIC7113.01, complete sequence) position: , mismatch: 9, identity: 0.71

ccgagattgagtaaagcaaagtaacggcggt	CRISPR spacer
tcgagattgagcaaagaaaagtaaggataaa	Protospacer
.**********.**** ******* *.... 

3017. spacer 1.13|38049|31|NZ_CP044377|CRISPRCasFinder matches to KU594606 (Cyanophage S-RIM32 isolate RW_108_0702, complete genome) position: , mismatch: 9, identity: 0.71

taaatcagcaaatattgttgtctaccgtgtc	CRISPR spacer
ataccaagcaaatcttgttgtttaccgtgaa	Protospacer
  * . ******* *******.*******  

3018. spacer 1.26|37632|31|NZ_CP044377|CRT matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 10, identity: 0.677

aacatcagtggaaatccactgcggcgtattc	CRISPR spacer
gtaatccgaggaaatccactgcggcgctaaa	Protospacer
.  *** * *****************.    

3019. spacer 1.39|38414|36|NZ_CP044377|CRT matches to NC_025028 (Uncultured bacterium pMCBF6 plasmid pMCBF6, complete sequence) position: , mismatch: 10, identity: 0.722

gttccctgcactaagacgctggtggtcgccacgtac	CRISPR spacer
atgtactgcactaacacgctggtgttcgccataacc	Protospacer
.* . ********* ********* ******..  *

3020. spacer 1.24|37511|37|NZ_CP044377|CRT matches to NZ_CP028385 (Providencia heimbachae strain 99101 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.703

cttagagaagcaaaaaccccaccgaggcaggggtatt	CRISPR spacer
atgtcagaaacaaaaacgccaccgaggcaggtggcgc	Protospacer
 *   ****.******* ************* *   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 6287 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_2 15041 : 20349 9 Salmonella_phage(42.86%) NA NA
DBSCAN-SWA_3 24251 : 25920 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_4 39929 : 42248 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_5 45692 : 236708 107 Escherichia_phage(17.24%) transposase NA
DBSCAN-SWA_6 268009 : 269188 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_7 275818 : 277066 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_8 282133 : 283108 1 Staphylococcus_phage(100.0%) transposase NA
DBSCAN-SWA_9 291462 : 294813 6 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_10 301696 : 306657 6 Enterobacteria_phage(66.67%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP044376
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044376_1 2581882-2582005 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044376_2 2887424-2887563 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1577150 : 1604675 29 Escherichia_phage(29.41%) tail,holin,transposase,bacteriocin,terminase NA
DBSCAN-SWA_2 1610328 : 1615315 8 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_3 1618502 : 1623326 7 Escherichia_phage(42.86%) tRNA NA
DBSCAN-SWA_4 5160399 : 5169996 11 Enterobacteria_phage(83.33%) integrase attL 5145490:5145505|attR 5180149:5180164
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage