Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040339 Bacillus luti strain FJ plasmid unnamed3, complete sequence 0 crisprs RT,csa3 0 0 0 0
NZ_CP040336 Bacillus luti strain FJ chromosome, complete genome 2 crisprs c2c9_V-U4,csa3,cas3,DEDDh,RT,WYL,cas14k,DinG,c2c10_CAS-V-U3 0 2 5 0
NZ_CP040338 Bacillus luti strain FJ plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP040337 Bacillus luti strain FJ plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP040336
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040336_1 957083-957267 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040336_2 3297207-3297342 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040336_2 2.2|3297289|26|NZ_CP040336|CRISPRCasFinder 3297289-3297314 26 MN694375 Marine virus AFVG_250M985, complete genome 24706-24731 4 0.846
NZ_CP040336_2 2.2|3297289|26|NZ_CP040336|CRISPRCasFinder 3297289-3297314 26 MN693660 Marine virus AFVG_250M778, complete genome 15530-15555 4 0.846
NZ_CP040336_2 2.2|3297289|26|NZ_CP040336|CRISPRCasFinder 3297289-3297314 26 MN694123 Marine virus AFVG_250M986, complete genome 15421-15446 4 0.846
NZ_CP040336_2 2.2|3297289|26|NZ_CP040336|CRISPRCasFinder 3297289-3297314 26 MN693659 Marine virus AFVG_250M987, complete genome 15432-15457 4 0.846
NZ_CP040336_2 2.1|3297235|26|NZ_CP040336|CRISPRCasFinder 3297235-3297260 26 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 268516-268541 6 0.769

1. spacer 2.2|3297289|26|NZ_CP040336|CRISPRCasFinder matches to MN694375 (Marine virus AFVG_250M985, complete genome) position: , mismatch: 4, identity: 0.846

cgatctggatatactgtttctgtctc	CRISPR spacer
cgaactggatatactgttcctgttcc	Protospacer
*** **************.****..*

2. spacer 2.2|3297289|26|NZ_CP040336|CRISPRCasFinder matches to MN693660 (Marine virus AFVG_250M778, complete genome) position: , mismatch: 4, identity: 0.846

cgatctggatatactgtttctgtctc	CRISPR spacer
cgaactggatatactgttcctgttcc	Protospacer
*** **************.****..*

3. spacer 2.2|3297289|26|NZ_CP040336|CRISPRCasFinder matches to MN694123 (Marine virus AFVG_250M986, complete genome) position: , mismatch: 4, identity: 0.846

cgatctggatatactgtttctgtctc	CRISPR spacer
cgaactggatatactgttcctgttcc	Protospacer
*** **************.****..*

4. spacer 2.2|3297289|26|NZ_CP040336|CRISPRCasFinder matches to MN693659 (Marine virus AFVG_250M987, complete genome) position: , mismatch: 4, identity: 0.846

cgatctggatatactgtttctgtctc	CRISPR spacer
cgaactggatatactgttcctgttcc	Protospacer
*** **************.****..*

5. spacer 2.1|3297235|26|NZ_CP040336|CRISPRCasFinder matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 6, identity: 0.769

ggcccttgatacgctttttctgcagt	CRISPR spacer
acgtcttgatacgcttttcctgcagg	Protospacer
.  .**************.****** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 826679 : 834316 10 uncultured_Caudovirales_phage(16.67%) NA NA
DBSCAN-SWA_2 889628 : 957556 55 Klosneuvirus(22.22%) integrase,tRNA,coat,protease attL 909776:909796|attR 937490:937510
DBSCAN-SWA_3 3230126 : 3239476 9 Bacillus_phage(71.43%) NA NA
DBSCAN-SWA_4 4804062 : 4812433 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_5 4853317 : 4861266 6 Bacillus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage