Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP033985 Staphylococcus aureus strain P2D1C1 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP033987 Staphylococcus aureus strain P2D1C1 chromosome, complete genome 9 crisprs cas3,DEDDh,DinG,csa3,RT,WYL 9 3 8 2
NZ_CP033983 Staphylococcus aureus strain P2D1C1 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP033986 Staphylococcus aureus strain P2D1C1 plasmid unnamed4, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP033984 Staphylococcus aureus strain P2D1C1 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP033987
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033987_1 465453-465554 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033987_2 860102-860180 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033987_3 865557-865826 Unclear NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033987_4 908822-908903 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033987_5 1701491-1701575 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033987_6 1735921-1736068 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033987_7 2265780-2265860 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033987_8 2278101-2278186 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033987_9 2386146-2386226 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP033987_2 2.1|860126|31|NZ_CP033987|CRISPRCasFinder 860126-860156 31 NZ_CP033987.1 334951-334981 0 1.0
NZ_CP033987_3 3.1|865593|22|NZ_CP033987|CRT 865593-865614 22 NZ_CP033987.1 818252-818273 0 1.0
NZ_CP033987_3 3.1|865593|22|NZ_CP033987|CRT 865593-865614 22 NZ_CP033987.1 908895-908916 0 1.0
NZ_CP033987_3 3.1|865593|22|NZ_CP033987|CRT 865593-865614 22 NZ_CP033987.1 1473832-1473853 0 1.0
NZ_CP033987_3 3.1|865593|22|NZ_CP033987|CRT 865593-865614 22 NZ_CP033987.1 1701567-1701588 0 1.0
NZ_CP033987_3 3.1|865593|22|NZ_CP033987|CRT 865593-865614 22 NZ_CP033987.1 2032529-2032550 0 1.0
NZ_CP033987_3 3.1|865593|22|NZ_CP033987|CRT 865593-865614 22 NZ_CP033987.1 211741-211762 0 1.0
NZ_CP033987_3 3.1|865593|22|NZ_CP033987|CRT 865593-865614 22 NZ_CP033987.1 211799-211820 0 1.0
NZ_CP033987_3 3.1|865593|22|NZ_CP033987|CRT 865593-865614 22 NZ_CP033987.1 334876-334897 0 1.0
NZ_CP033987_3 3.1|865593|22|NZ_CP033987|CRT 865593-865614 22 NZ_CP033987.1 334986-335007 0 1.0
NZ_CP033987_3 3.1|865593|22|NZ_CP033987|CRT 865593-865614 22 NZ_CP033987.1 693744-693765 0 1.0
NZ_CP033987_3 3.1|865593|22|NZ_CP033987|CRT 865593-865614 22 NZ_CP033987.1 1385280-1385301 0 1.0
NZ_CP033987_3 3.1|865593|22|NZ_CP033987|CRT 865593-865614 22 NZ_CP033987.1 1716101-1716122 0 1.0
NZ_CP033987_3 3.3|865710|22|NZ_CP033987|CRT 865710-865731 22 NZ_CP033987.1 818252-818273 0 1.0
NZ_CP033987_3 3.3|865710|22|NZ_CP033987|CRT 865710-865731 22 NZ_CP033987.1 908895-908916 0 1.0
NZ_CP033987_3 3.3|865710|22|NZ_CP033987|CRT 865710-865731 22 NZ_CP033987.1 1473832-1473853 0 1.0
NZ_CP033987_3 3.3|865710|22|NZ_CP033987|CRT 865710-865731 22 NZ_CP033987.1 1701567-1701588 0 1.0
NZ_CP033987_3 3.3|865710|22|NZ_CP033987|CRT 865710-865731 22 NZ_CP033987.1 2032529-2032550 0 1.0
NZ_CP033987_3 3.3|865710|22|NZ_CP033987|CRT 865710-865731 22 NZ_CP033987.1 211741-211762 0 1.0
NZ_CP033987_3 3.3|865710|22|NZ_CP033987|CRT 865710-865731 22 NZ_CP033987.1 211799-211820 0 1.0
NZ_CP033987_3 3.3|865710|22|NZ_CP033987|CRT 865710-865731 22 NZ_CP033987.1 334876-334897 0 1.0
NZ_CP033987_3 3.3|865710|22|NZ_CP033987|CRT 865710-865731 22 NZ_CP033987.1 334986-335007 0 1.0
NZ_CP033987_3 3.3|865710|22|NZ_CP033987|CRT 865710-865731 22 NZ_CP033987.1 693744-693765 0 1.0
NZ_CP033987_3 3.3|865710|22|NZ_CP033987|CRT 865710-865731 22 NZ_CP033987.1 1385280-1385301 0 1.0
NZ_CP033987_3 3.3|865710|22|NZ_CP033987|CRT 865710-865731 22 NZ_CP033987.1 1716101-1716122 0 1.0
NZ_CP033987_2 2.1|860126|31|NZ_CP033987|CRISPRCasFinder 860126-860156 31 NZ_CP033987.1 334896-334926 1 0.968
NZ_CP033987_3 3.1|865593|22|NZ_CP033987|CRT 865593-865614 22 NZ_CP033987.1 979128-979149 1 0.955
NZ_CP033987_3 3.1|865593|22|NZ_CP033987|CRT 865593-865614 22 NZ_CP033987.1 1735828-1735849 1 0.955
NZ_CP033987_3 3.1|865593|22|NZ_CP033987|CRT 865593-865614 22 NZ_CP033987.1 1736061-1736082 1 0.955
NZ_CP033987_3 3.2|865651|23|NZ_CP033987|CRT 865651-865673 23 NZ_CP033987.1 819202-819224 1 0.957
NZ_CP033987_3 3.2|865651|23|NZ_CP033987|CRT 865651-865673 23 NZ_CP033987.1 819424-819446 1 0.957
NZ_CP033987_3 3.2|865651|23|NZ_CP033987|CRT 865651-865673 23 NZ_CP033987.1 1385396-1385418 1 0.957
NZ_CP033987_3 3.2|865651|23|NZ_CP033987|CRT 865651-865673 23 NZ_CP033987.1 2032587-2032609 1 0.957
NZ_CP033987_3 3.2|865651|23|NZ_CP033987|CRT 865651-865673 23 NZ_CP033987.1 2375317-2375339 1 0.957
NZ_CP033987_3 3.3|865710|22|NZ_CP033987|CRT 865710-865731 22 NZ_CP033987.1 979128-979149 1 0.955
NZ_CP033987_3 3.3|865710|22|NZ_CP033987|CRT 865710-865731 22 NZ_CP033987.1 1735828-1735849 1 0.955
NZ_CP033987_3 3.3|865710|22|NZ_CP033987|CRT 865710-865731 22 NZ_CP033987.1 1736061-1736082 1 0.955
NZ_CP033987_3 3.4|865768|23|NZ_CP033987|CRT 865768-865790 23 NZ_CP033987.1 819202-819224 1 0.957
NZ_CP033987_3 3.4|865768|23|NZ_CP033987|CRT 865768-865790 23 NZ_CP033987.1 819424-819446 1 0.957
NZ_CP033987_3 3.4|865768|23|NZ_CP033987|CRT 865768-865790 23 NZ_CP033987.1 1385396-1385418 1 0.957
NZ_CP033987_3 3.4|865768|23|NZ_CP033987|CRT 865768-865790 23 NZ_CP033987.1 2032587-2032609 1 0.957
NZ_CP033987_3 3.4|865768|23|NZ_CP033987|CRT 865768-865790 23 NZ_CP033987.1 2375317-2375339 1 0.957
NZ_CP033987_4 4.1|908846|34|NZ_CP033987|CRISPRCasFinder 908846-908879 34 NZ_CP033987.1 1385376-1385409 1 0.971
NZ_CP033987_5 5.1|1701517|33|NZ_CP033987|CRISPRCasFinder 1701517-1701549 33 NZ_CP033987.1 1385377-1385409 1 0.97
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 872845-872875 1 0.968
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 872901-872931 1 0.968
NZ_CP033987_3 3.2|865651|23|NZ_CP033987|CRT 865651-865673 23 NZ_CP033987.1 1473715-1473737 2 0.913
NZ_CP033987_3 3.2|865651|23|NZ_CP033987|CRT 865651-865673 23 NZ_CP033987.1 2135126-2135148 2 0.913
NZ_CP033987_3 3.2|865651|23|NZ_CP033987|CRT 865651-865673 23 NZ_CP033987.1 2135185-2135207 2 0.913
NZ_CP033987_3 3.4|865768|23|NZ_CP033987|CRT 865768-865790 23 NZ_CP033987.1 1473715-1473737 2 0.913
NZ_CP033987_3 3.4|865768|23|NZ_CP033987|CRT 865768-865790 23 NZ_CP033987.1 2135126-2135148 2 0.913
NZ_CP033987_3 3.4|865768|23|NZ_CP033987|CRT 865768-865790 23 NZ_CP033987.1 2135185-2135207 2 0.913
NZ_CP033987_6 6.2|1736028|22|NZ_CP033987|PILER-CR 1736028-1736049 22 NZ_CP033987.1 2135014-2135035 2 0.909
NZ_CP033987_6 6.2|1736028|22|NZ_CP033987|PILER-CR 1736028-1736049 22 NZ_CP033987.1 2135131-2135152 2 0.909
NZ_CP033987_6 6.2|1736028|22|NZ_CP033987|PILER-CR 1736028-1736049 22 NZ_CP033987.1 2135190-2135211 2 0.909
NZ_CP033987_6 6.2|1736028|22|NZ_CP033987|PILER-CR 1736028-1736049 22 NZ_CP033987.1 1172237-1172258 2 0.909
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 113073-113103 2 0.935
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 872957-872987 2 0.935
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 909158-909188 2 0.935
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 1075125-1075155 2 0.935
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 1473768-1473798 2 0.935
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 1473884-1473914 2 0.935
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 2031181-2031211 2 0.935
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 2375370-2375400 2 0.935
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 2550832-2550862 2 0.935
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 411285-411315 2 0.935
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 693799-693829 2 0.935
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 1177716-1177746 2 0.935
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 1385335-1385365 2 0.935
NZ_CP033987_9 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder 2386171-2386201 31 NZ_CP033987.1 1716155-1716185 2 0.935

1. spacer 2.1|860126|31|NZ_CP033987|CRISPRCasFinder matches to position: 334951-334981, mismatch: 0, identity: 1.0

ctgtgttggggccccgccaacttgcattgcc	CRISPR spacer
ctgtgttggggccccgccaacttgcattgcc	Protospacer
*******************************

2. spacer 3.1|865593|22|NZ_CP033987|CRT matches to position: 818252-818273, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

3. spacer 3.1|865593|22|NZ_CP033987|CRT matches to position: 908895-908916, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

4. spacer 3.1|865593|22|NZ_CP033987|CRT matches to position: 1473832-1473853, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

5. spacer 3.1|865593|22|NZ_CP033987|CRT matches to position: 1701567-1701588, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

6. spacer 3.1|865593|22|NZ_CP033987|CRT matches to position: 2032529-2032550, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

7. spacer 3.1|865593|22|NZ_CP033987|CRT matches to position: 211741-211762, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

8. spacer 3.1|865593|22|NZ_CP033987|CRT matches to position: 211799-211820, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

9. spacer 3.1|865593|22|NZ_CP033987|CRT matches to position: 334876-334897, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

10. spacer 3.1|865593|22|NZ_CP033987|CRT matches to position: 334986-335007, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

11. spacer 3.1|865593|22|NZ_CP033987|CRT matches to position: 693744-693765, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

12. spacer 3.1|865593|22|NZ_CP033987|CRT matches to position: 1385280-1385301, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

13. spacer 3.1|865593|22|NZ_CP033987|CRT matches to position: 1716101-1716122, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

14. spacer 3.3|865710|22|NZ_CP033987|CRT matches to position: 818252-818273, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

15. spacer 3.3|865710|22|NZ_CP033987|CRT matches to position: 908895-908916, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

16. spacer 3.3|865710|22|NZ_CP033987|CRT matches to position: 1473832-1473853, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

17. spacer 3.3|865710|22|NZ_CP033987|CRT matches to position: 1701567-1701588, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

18. spacer 3.3|865710|22|NZ_CP033987|CRT matches to position: 2032529-2032550, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

19. spacer 3.3|865710|22|NZ_CP033987|CRT matches to position: 211741-211762, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

20. spacer 3.3|865710|22|NZ_CP033987|CRT matches to position: 211799-211820, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

21. spacer 3.3|865710|22|NZ_CP033987|CRT matches to position: 334876-334897, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

22. spacer 3.3|865710|22|NZ_CP033987|CRT matches to position: 334986-335007, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

23. spacer 3.3|865710|22|NZ_CP033987|CRT matches to position: 693744-693765, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

24. spacer 3.3|865710|22|NZ_CP033987|CRT matches to position: 1385280-1385301, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

25. spacer 3.3|865710|22|NZ_CP033987|CRT matches to position: 1716101-1716122, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

26. spacer 2.1|860126|31|NZ_CP033987|CRISPRCasFinder matches to position: 334896-334926, mismatch: 1, identity: 0.968

ctgtgttggggccccgccaacttgcattgcc	CRISPR spacer
ctgtgttggggccccgccaacttgcattacc	Protospacer
****************************.**

27. spacer 3.1|865593|22|NZ_CP033987|CRT matches to position: 979128-979149, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

28. spacer 3.1|865593|22|NZ_CP033987|CRT matches to position: 1735828-1735849, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

29. spacer 3.1|865593|22|NZ_CP033987|CRT matches to position: 1736061-1736082, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

30. spacer 3.2|865651|23|NZ_CP033987|CRT matches to position: 819202-819224, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

31. spacer 3.2|865651|23|NZ_CP033987|CRT matches to position: 819424-819446, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

32. spacer 3.2|865651|23|NZ_CP033987|CRT matches to position: 1385396-1385418, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

33. spacer 3.2|865651|23|NZ_CP033987|CRT matches to position: 2032587-2032609, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

34. spacer 3.2|865651|23|NZ_CP033987|CRT matches to position: 2375317-2375339, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

35. spacer 3.3|865710|22|NZ_CP033987|CRT matches to position: 979128-979149, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

36. spacer 3.3|865710|22|NZ_CP033987|CRT matches to position: 1735828-1735849, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

37. spacer 3.3|865710|22|NZ_CP033987|CRT matches to position: 1736061-1736082, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

38. spacer 3.4|865768|23|NZ_CP033987|CRT matches to position: 819202-819224, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

39. spacer 3.4|865768|23|NZ_CP033987|CRT matches to position: 819424-819446, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

40. spacer 3.4|865768|23|NZ_CP033987|CRT matches to position: 1385396-1385418, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

41. spacer 3.4|865768|23|NZ_CP033987|CRT matches to position: 2032587-2032609, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

42. spacer 3.4|865768|23|NZ_CP033987|CRT matches to position: 2375317-2375339, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

43. spacer 4.1|908846|34|NZ_CP033987|CRISPRCasFinder matches to position: 1385376-1385409, mismatch: 1, identity: 0.971

attgagaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
****.*****************************

44. spacer 5.1|1701517|33|NZ_CP033987|CRISPRCasFinder matches to position: 1385377-1385409, mismatch: 1, identity: 0.97

attgggaatccaatttctctgtgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttggggccca	Protospacer
******************** ************

45. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 872845-872875, mismatch: 1, identity: 0.968

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgtcagct	Protospacer
***********************.*******

46. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 872901-872931, mismatch: 1, identity: 0.968

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgtcagct	Protospacer
***********************.*******

47. spacer 3.2|865651|23|NZ_CP033987|CRT matches to position: 1473715-1473737, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

48. spacer 3.2|865651|23|NZ_CP033987|CRT matches to position: 2135126-2135148, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

49. spacer 3.2|865651|23|NZ_CP033987|CRT matches to position: 2135185-2135207, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

50. spacer 3.4|865768|23|NZ_CP033987|CRT matches to position: 1473715-1473737, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

51. spacer 3.4|865768|23|NZ_CP033987|CRT matches to position: 2135126-2135148, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

52. spacer 3.4|865768|23|NZ_CP033987|CRT matches to position: 2135185-2135207, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

53. spacer 6.2|1736028|22|NZ_CP033987|PILER-CR matches to position: 2135014-2135035, mismatch: 2, identity: 0.909

tgaaattggggttccaatttct	CRISPR spacer
tgaaattgggaatccaatttct	Protospacer
**********. **********

54. spacer 6.2|1736028|22|NZ_CP033987|PILER-CR matches to position: 2135131-2135152, mismatch: 2, identity: 0.909

tgaaattggggttccaatttct	CRISPR spacer
tgaaattgggaatccaatttct	Protospacer
**********. **********

55. spacer 6.2|1736028|22|NZ_CP033987|PILER-CR matches to position: 2135190-2135211, mismatch: 2, identity: 0.909

tgaaattggggttccaatttct	CRISPR spacer
tgaaattgggaatccaatttct	Protospacer
**********. **********

56. spacer 6.2|1736028|22|NZ_CP033987|PILER-CR matches to position: 1172237-1172258, mismatch: 2, identity: 0.909

tgaaattggggttccaatttct	CRISPR spacer
tgaaattggtgatccaatttct	Protospacer
********* * **********

57. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 113073-113103, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

58. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 872957-872987, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

59. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 909158-909188, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

60. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 1075125-1075155, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

61. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 1473768-1473798, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

62. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 1473884-1473914, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

63. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 2031181-2031211, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

64. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 2375370-2375400, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

65. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 2550832-2550862, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

66. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 411285-411315, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

67. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 693799-693829, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

68. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 1177716-1177746, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

69. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 1385335-1385365, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

70. spacer 9.1|2386171|31|NZ_CP033987|CRISPRCasFinder matches to position: 1716155-1716185, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP033987_3 3.2|865651|23|NZ_CP033987|CRT 865651-865673 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
NZ_CP033987_3 3.2|865651|23|NZ_CP033987|CRT 865651-865673 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
NZ_CP033987_3 3.4|865768|23|NZ_CP033987|CRT 865768-865790 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
NZ_CP033987_3 3.4|865768|23|NZ_CP033987|CRT 865768-865790 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
NZ_CP033987_8 8.1|2278127|34|NZ_CP033987|CRISPRCasFinder 2278127-2278160 34 JN882286 Cronobacter phage vB_CsaP_GAP52, complete genome 23034-23067 8 0.765
NZ_CP033987_8 8.1|2278127|34|NZ_CP033987|CRISPRCasFinder 2278127-2278160 34 CP030544 Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence 7567-7600 8 0.765

1. spacer 3.2|865651|23|NZ_CP033987|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

2. spacer 3.2|865651|23|NZ_CP033987|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

3. spacer 3.4|865768|23|NZ_CP033987|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

4. spacer 3.4|865768|23|NZ_CP033987|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

5. spacer 8.1|2278127|34|NZ_CP033987|CRISPRCasFinder matches to JN882286 (Cronobacter phage vB_CsaP_GAP52, complete genome) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgcatatctttagctttatagcttttatatgct	Protospacer
******************** *.** .*  **  

6. spacer 8.1|2278127|34|NZ_CP033987|CRISPRCasFinder matches to CP030544 (Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgaataactttagctttattgttataaacagta	Protospacer
*** *** ****************   *** * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12362 : 81380 60 Staphylococcus_phage(38.46%) tRNA,transposase NA
DBSCAN-SWA_2 434769 : 447677 22 Staphylococcus_phage(94.12%) integrase,coat,terminase attL 427540:427553|attR 442334:442347
DBSCAN-SWA_3 797330 : 805151 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_4 821071 : 831707 10 uncultured_Caudovirales_phage(62.5%) NA NA
DBSCAN-SWA_5 1528163 : 1614683 106 Staphylococcus_phage(80.77%) protease,integrase,head,terminase,holin,tail,tRNA,portal,capsid attL 1567188:1567205|attR 1613200:1613217
DBSCAN-SWA_6 1751160 : 1760203 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_7 1890346 : 1951678 57 Staphylococcus_phage(95.56%) tRNA,protease NA
DBSCAN-SWA_8 2045426 : 2140068 112 Staphylococcus_phage(86.67%) protease,integrase,head,terminase,holin,tail,tRNA,portal,capsid attL 2041863:2041887|attR 2142354:2142378
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP033987.1|WP_000681968.1|2081185_2081362_-|hypothetical-protein 2081185_2081362_- 58 aa aa NA WHTH_GntR NA 2045426-2140068 yes
NZ_CP033987.1|WP_000990056.1|2081604_2081703_-|hypothetical-protein 2081604_2081703_- 32 aa aa NA WHTH_GntR NA 2045426-2140068 yes