Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP046390 Lactobacillus delbrueckii strain TS1-06 chromosome, complete genome 3 crisprs DEDDh,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3,cas14j,Cas14u_CAS-V,c2c9_V-U4,DinG,csa3 0 32 5 0

Results visualization

1. NZ_CP046390
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046390_1 193049-196957 TypeI-E I-B,III-A,III-B
63 spacers
DEDDh,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046390_2 261448-261574 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046390_3 1050321-1050411 TypeV NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP046390_1 1.2|193138|33|NZ_CP046390|CRISPRCasFinder,CRT 193138-193170 33 L02497 Bacteriophage mv4 ORF1, 3' end; minor structural protein (g20) gene, complete cds; major capsid protein (g34) gene, complete cds; ORF4-5, complete cds; ORF6, 5' end 2672-2704 0 1.0
NZ_CP046390_1 1.65|193139|33|NZ_CP046390|PILER-CR 193139-193171 33 L02497 Bacteriophage mv4 ORF1, 3' end; minor structural protein (g20) gene, complete cds; major capsid protein (g34) gene, complete cds; ORF4-5, complete cds; ORF6, 5' end 2672-2704 0 1.0
NZ_CP046390_1 1.3|193199|33|NZ_CP046390|CRISPRCasFinder,CRT 193199-193231 33 NC_001670 Lactobacillus delbrueckii plasmid pWS58, complete sequence 5160-5192 5 0.848
NZ_CP046390_1 1.66|193200|33|NZ_CP046390|PILER-CR 193200-193232 33 NC_001670 Lactobacillus delbrueckii plasmid pWS58, complete sequence 5160-5192 5 0.848
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NC_014023 Bacillus megaterium QM B1551 plasmid pBM700, complete sequence 96658-96690 6 0.818
NZ_CP046390_1 1.8|193504|33|NZ_CP046390|CRISPRCasFinder,CRT 193504-193536 33 LT960552 Yersinia phage fHe-Yen9-03 genome assembly, complete genome: monopartite 195201-195233 6 0.818
NZ_CP046390_1 1.8|193504|33|NZ_CP046390|CRISPRCasFinder,CRT 193504-193536 33 LR596615 Yersinia phage fHe-Yen9-04 genome assembly, chromosome: I 195625-195657 6 0.818
NZ_CP046390_1 1.8|193504|33|NZ_CP046390|CRISPRCasFinder,CRT 193504-193536 33 NC_042116 Yersinia phage fHe-Yen9-04 genome assembly, complete genome: monopartite 195625-195657 6 0.818
NZ_CP046390_1 1.46|195859|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195859-195891 33 NZ_CP022209 Burkholderia gladioli pv. gladioli strain FDAARGOS_188 plasmid unnamed1, complete sequence 84835-84867 6 0.818
NZ_CP046390_1 1.46|195859|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195859-195891 33 NC_015383 Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence 43901-43933 6 0.818
NZ_CP046390_1 1.46|195859|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195859-195891 33 NZ_CP009321 Burkholderia gladioli strain ATCC 10248 plasmid 1, complete sequence 39051-39083 6 0.818
NZ_CP046390_1 1.46|195859|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195859-195891 33 NZ_CP022007 Burkholderia gladioli pv. gladioli strain KACC 11889 plasmid pls1, complete sequence 179497-179529 6 0.818
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NC_014023 Bacillus megaterium QM B1551 plasmid pBM700, complete sequence 96658-96690 6 0.818
NZ_CP046390_1 1.71|193505|33|NZ_CP046390|PILER-CR 193505-193537 33 LT960552 Yersinia phage fHe-Yen9-03 genome assembly, complete genome: monopartite 195201-195233 6 0.818
NZ_CP046390_1 1.71|193505|33|NZ_CP046390|PILER-CR 193505-193537 33 LR596615 Yersinia phage fHe-Yen9-04 genome assembly, chromosome: I 195625-195657 6 0.818
NZ_CP046390_1 1.71|193505|33|NZ_CP046390|PILER-CR 193505-193537 33 NC_042116 Yersinia phage fHe-Yen9-04 genome assembly, complete genome: monopartite 195625-195657 6 0.818
NZ_CP046390_1 1.15|193931|34|NZ_CP046390|CRISPRCasFinder,CRT 193931-193964 34 NZ_CP008877 Terribacillus goriensis strain MP602 plasmid pT1, complete sequence 40099-40132 7 0.794
NZ_CP046390_1 1.16|193993|34|NZ_CP046390|CRISPRCasFinder,CRT 193993-194026 34 NZ_CP008877 Terribacillus goriensis strain MP602 plasmid pT1, complete sequence 40099-40132 7 0.794
NZ_CP046390_1 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT 195092-195124 33 MK448484 Streptococcus satellite phage Javan416, complete genome 462-494 7 0.788
NZ_CP046390_1 1.45|195798|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195798-195830 33 NZ_CP015602 Pseudomonas antarctica strain PAMC 27494 plasmid pP27494_2, complete sequence 16897-16929 7 0.788
NZ_CP046390_1 1.78|193932|34|NZ_CP046390|PILER-CR 193932-193965 34 NZ_CP008877 Terribacillus goriensis strain MP602 plasmid pT1, complete sequence 40099-40132 7 0.794
NZ_CP046390_1 1.79|193994|34|NZ_CP046390|PILER-CR 193994-194027 34 NZ_CP008877 Terribacillus goriensis strain MP602 plasmid pT1, complete sequence 40099-40132 7 0.794
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 KJ010489 Enterococcus phage IME-EFm1, complete genome 18328-18360 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NZ_CP012367 Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence 102034-102066 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NZ_CP050649 Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE 12756-12788 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NZ_CP050651 Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT 23780-23812 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NC_015219 Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069 plasmid pSGG1, complete sequence 16050-16082 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NC_013963 Bacillus sp. BS-01 plasmid pBS-01, complete sequence 2529-2561 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NZ_CP035137 Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence 79818-79850 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NZ_CP042833 Enterococcus faecium strain FA3 plasmid unnamed1 168710-168742 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NZ_CP033739 Enterococcus sp. FDAARGOS_553 plasmid unnamed1, complete sequence 36016-36048 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NC_014557 Bacillus sp. BS-02 plasmid pBS-02, complete sequence 11300-11332 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NZ_CP043485 Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence 90553-90585 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NZ_CP012385 Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence 159730-159762 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NZ_CP040877 Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence 108924-108956 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NZ_CP042214 Enterococcus faecalis strain L15 plasmid pL15, complete sequence 73422-73454 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NZ_CP035221 Enterococcus faecium strain SRCM103470 plasmid unnamed1 163371-163403 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 LN681539 Clostridium phage phiCD505, complete genome 26803-26835 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 LN681542 Clostridium phage phiMMP03, complete genome 25782-25814 8 0.758
NZ_CP046390_1 1.8|193504|33|NZ_CP046390|CRISPRCasFinder,CRT 193504-193536 33 NC_015390 Carnobacterium sp. 17-4 plasmid pCAR50, complete sequence 17342-17374 8 0.758
NZ_CP046390_1 1.10|193626|33|NZ_CP046390|CRISPRCasFinder,CRT 193626-193658 33 NZ_CP042825 Rhizobium sp. WL3 plasmid unnamed2, complete sequence 146045-146077 8 0.758
NZ_CP046390_1 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT 195092-195124 33 MK448465 Streptococcus satellite phage Javan388, complete genome 462-494 8 0.758
NZ_CP046390_1 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT 195092-195124 33 MK448471 Streptococcus satellite phage Javan398, complete genome 462-494 8 0.758
NZ_CP046390_1 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT 195092-195124 33 MK448468 Streptococcus satellite phage Javan395, complete genome 462-494 8 0.758
NZ_CP046390_1 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT 195092-195124 33 MK448476 Streptococcus satellite phage Javan404, complete genome 462-494 8 0.758
NZ_CP046390_1 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT 195092-195124 33 MK448480 Streptococcus satellite phage Javan410, complete genome 462-494 8 0.758
NZ_CP046390_1 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT 195092-195124 33 MK448466 Streptococcus satellite phage Javan390, complete genome 462-494 8 0.758
NZ_CP046390_1 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT 195092-195124 33 MK448353 Streptococcus satellite phage Javan195, complete genome 462-494 8 0.758
NZ_CP046390_1 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT 195092-195124 33 MK448352 Streptococcus satellite phage Javan194, complete genome 462-494 8 0.758
NZ_CP046390_1 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT 195092-195124 33 MK448351 Streptococcus satellite phage Javan193, complete genome 462-494 8 0.758
NZ_CP046390_1 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT 195092-195124 33 MK448462 Streptococcus satellite phage Javan379, complete genome 456-488 8 0.758
NZ_CP046390_1 1.60|196714|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 196714-196746 33 MN693475 Marine virus AFVG_25M183, complete genome 8103-8135 8 0.758
NZ_CP046390_1 1.61|196775|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 196775-196807 33 NZ_AP014580 Burkholderia sp. RPE67 plasmid p2, complete sequence 457327-457359 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 KJ010489 Enterococcus phage IME-EFm1, complete genome 18328-18360 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NZ_CP012367 Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence 102034-102066 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NZ_CP050649 Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE 12756-12788 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NZ_CP050651 Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT 23780-23812 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NC_015219 Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069 plasmid pSGG1, complete sequence 16050-16082 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NC_013963 Bacillus sp. BS-01 plasmid pBS-01, complete sequence 2529-2561 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NZ_CP035137 Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence 79818-79850 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NZ_CP042833 Enterococcus faecium strain FA3 plasmid unnamed1 168710-168742 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NZ_CP033739 Enterococcus sp. FDAARGOS_553 plasmid unnamed1, complete sequence 36016-36048 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NC_014557 Bacillus sp. BS-02 plasmid pBS-02, complete sequence 11300-11332 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NZ_CP043485 Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence 90553-90585 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NZ_CP012385 Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence 159730-159762 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NZ_CP040877 Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence 108924-108956 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NZ_CP042214 Enterococcus faecalis strain L15 plasmid pL15, complete sequence 73422-73454 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NZ_CP035221 Enterococcus faecium strain SRCM103470 plasmid unnamed1 163371-163403 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 LN681539 Clostridium phage phiCD505, complete genome 26803-26835 8 0.758
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 LN681542 Clostridium phage phiMMP03, complete genome 25782-25814 8 0.758
NZ_CP046390_1 1.71|193505|33|NZ_CP046390|PILER-CR 193505-193537 33 NC_015390 Carnobacterium sp. 17-4 plasmid pCAR50, complete sequence 17342-17374 8 0.758
NZ_CP046390_1 1.73|193627|33|NZ_CP046390|PILER-CR 193627-193659 33 NZ_CP042825 Rhizobium sp. WL3 plasmid unnamed2, complete sequence 146045-146077 8 0.758
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 MN693673 Marine virus AFVG_250M950, complete genome 11353-11385 9 0.727
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NZ_CP009640 Bacillus cereus 03BB108 plasmid pBFI_3, complete sequence 76568-76600 9 0.727
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 NZ_CP053961 Bacillus cereus strain FDAARGOS_802 plasmid unnamed1, complete sequence 24522-24554 9 0.727
NZ_CP046390_1 1.9|193565|33|NZ_CP046390|CRISPRCasFinder,CRT 193565-193597 33 NC_011981 Agrobacterium vitis S4 plasmid pAtS4e, complete sequence 540046-540078 9 0.727
NZ_CP046390_1 1.12|193748|33|NZ_CP046390|CRISPRCasFinder,CRT 193748-193780 33 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 605765-605797 9 0.727
NZ_CP046390_1 1.25|194543|33|NZ_CP046390|CRISPRCasFinder,CRT 194543-194575 33 NZ_CP040831 Paenibacillus polymyxa strain ZF129 plasmid pAP2, complete sequence 18658-18690 9 0.727
NZ_CP046390_1 1.26|194604|33|NZ_CP046390|CRISPRCasFinder,CRT 194604-194636 33 NZ_CP045391 Roseivivax sp. THAF30 plasmid pTHAF30_b, complete sequence 47935-47967 9 0.727
NZ_CP046390_1 1.26|194604|33|NZ_CP046390|CRISPRCasFinder,CRT 194604-194636 33 NZ_CP045363 Roseivivax sp. THAF40 plasmid pTHAF40_c, complete sequence 15363-15395 9 0.727
NZ_CP046390_1 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT 195092-195124 33 MK448459 Streptococcus satellite phage Javan375, complete genome 456-488 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 50401-50433 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 29816-29848 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 39947-39979 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 48609-48641 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP039379 Pediococcus pentosaceus strain SL001 plasmid pSL001-1, complete sequence 72388-72420 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP023175 Lactobacillus plantarum strain BDGP2 plasmid pLtBDGP2A, complete sequence 35979-36011 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 19322-19354 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 79768-79800 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 24847-24879 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 8510-8542 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 62685-62717 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 5456-5488 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 32129-32161 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 54892-54924 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 48648-48680 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 58229-58261 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 45597-45629 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 34784-34816 9 0.727
NZ_CP046390_1 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 195737-195769 33 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 19941-19973 9 0.727
NZ_CP046390_1 1.49|196042|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR 196042-196074 33 KP735928 Staphylococcus phage IME-SA4, complete genome 1062-1094 9 0.727
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 MN693673 Marine virus AFVG_250M950, complete genome 11353-11385 9 0.727
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NZ_CP009640 Bacillus cereus 03BB108 plasmid pBFI_3, complete sequence 76568-76600 9 0.727
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 NZ_CP053961 Bacillus cereus strain FDAARGOS_802 plasmid unnamed1, complete sequence 24522-24554 9 0.727
NZ_CP046390_1 1.72|193566|33|NZ_CP046390|PILER-CR 193566-193598 33 NC_011981 Agrobacterium vitis S4 plasmid pAtS4e, complete sequence 540046-540078 9 0.727
NZ_CP046390_1 1.75|193749|33|NZ_CP046390|PILER-CR 193749-193781 33 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 605765-605797 9 0.727
NZ_CP046390_1 1.88|194544|33|NZ_CP046390|PILER-CR 194544-194576 33 NZ_CP040831 Paenibacillus polymyxa strain ZF129 plasmid pAP2, complete sequence 18658-18690 9 0.727
NZ_CP046390_1 1.89|194605|33|NZ_CP046390|PILER-CR 194605-194637 33 NZ_CP045391 Roseivivax sp. THAF30 plasmid pTHAF30_b, complete sequence 47935-47967 9 0.727
NZ_CP046390_1 1.89|194605|33|NZ_CP046390|PILER-CR 194605-194637 33 NZ_CP045363 Roseivivax sp. THAF40 plasmid pTHAF40_c, complete sequence 15363-15395 9 0.727
NZ_CP046390_1 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT 193443-193475 33 MN694358 Marine virus AFVG_250M310, complete genome 29836-29868 10 0.697
NZ_CP046390_1 1.10|193626|33|NZ_CP046390|CRISPRCasFinder,CRT 193626-193658 33 MF490237 Pseudomonas phage vB_PaeP_E220, complete genome 8217-8249 10 0.697
NZ_CP046390_1 1.10|193626|33|NZ_CP046390|CRISPRCasFinder,CRT 193626-193658 33 KM389247 UNVERIFIED: Pseudomonas phage JBD90 clone contig00001 genomic sequence 46927-46959 10 0.697
NZ_CP046390_1 1.10|193626|33|NZ_CP046390|CRISPRCasFinder,CRT 193626-193658 33 NC_042342 Pseudomonas virus H66, complete genome 65008-65040 10 0.697
NZ_CP046390_1 1.17|194055|33|NZ_CP046390|CRISPRCasFinder,CRT 194055-194087 33 LC371242 Escherichia phage EcS1 DNA, complete sequence 72122-72154 10 0.697
NZ_CP046390_1 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT 195092-195124 33 KP696448 Bacillus phage Stills, complete genome 56371-56403 10 0.697
NZ_CP046390_1 1.38|195370|33|NZ_CP046390|CRISPRCasFinder,CRT 195370-195402 33 AP018706 Uncultured bacterium plasmid pSN0729-70 DNA, complete sequence 18567-18599 10 0.697
NZ_CP046390_1 1.70|193444|33|NZ_CP046390|PILER-CR 193444-193476 33 MN694358 Marine virus AFVG_250M310, complete genome 29836-29868 10 0.697
NZ_CP046390_1 1.73|193627|33|NZ_CP046390|PILER-CR 193627-193659 33 MF490237 Pseudomonas phage vB_PaeP_E220, complete genome 8217-8249 10 0.697
NZ_CP046390_1 1.73|193627|33|NZ_CP046390|PILER-CR 193627-193659 33 KM389247 UNVERIFIED: Pseudomonas phage JBD90 clone contig00001 genomic sequence 46927-46959 10 0.697
NZ_CP046390_1 1.73|193627|33|NZ_CP046390|PILER-CR 193627-193659 33 NC_042342 Pseudomonas virus H66, complete genome 65008-65040 10 0.697
NZ_CP046390_1 1.80|194056|33|NZ_CP046390|PILER-CR 194056-194088 33 LC371242 Escherichia phage EcS1 DNA, complete sequence 72122-72154 10 0.697

1. spacer 1.2|193138|33|NZ_CP046390|CRISPRCasFinder,CRT matches to L02497 (Bacteriophage mv4 ORF1, 3' end; minor structural protein (g20) gene, complete cds; major capsid protein (g34) gene, complete cds; ORF4-5, complete cds; ORF6, 5' end) position: , mismatch: 0, identity: 1.0 

tcagagtagccagcgtacatcatgactagcccg	CRISPR spacer
tcagagtagccagcgtacatcatgactagcccg	Protospacer
*********************************

2. spacer 1.65|193139|33|NZ_CP046390|PILER-CR matches to L02497 (Bacteriophage mv4 ORF1, 3' end; minor structural protein (g20) gene, complete cds; major capsid protein (g34) gene, complete cds; ORF4-5, complete cds; ORF6, 5' end) position: , mismatch: 0, identity: 1.0 

tcagagtagccagcgtacatcatgactagcccg	CRISPR spacer
tcagagtagccagcgtacatcatgactagcccg	Protospacer
*********************************

3. spacer 1.3|193199|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NC_001670 (Lactobacillus delbrueckii plasmid pWS58, complete sequence) position: , mismatch: 5, identity: 0.848 

ctgttttgtgtgagtatctgtccacccgtggca	CRISPR spacer
ctgttttgtgtgagtacctgtccacaagaggga	Protospacer
****************.********  * ** *

4. spacer 1.66|193200|33|NZ_CP046390|PILER-CR matches to NC_001670 (Lactobacillus delbrueckii plasmid pWS58, complete sequence) position: , mismatch: 5, identity: 0.848 

ctgttttgtgtgagtatctgtccacccgtggca	CRISPR spacer
ctgttttgtgtgagtacctgtccacaagaggga	Protospacer
****************.********  * ** *

5. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NC_014023 (Bacillus megaterium QM B1551 plasmid pBM700, complete sequence) position: , mismatch: 6, identity: 0.818 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
atacatactaaggaggattaaaaaatggctata	Protospacer
*   ***.********************* * *

6. spacer 1.8|193504|33|NZ_CP046390|CRISPRCasFinder,CRT matches to LT960552 (Yersinia phage fHe-Yen9-03 genome assembly, complete genome: monopartite) position: , mismatch: 6, identity: 0.818 

caaataaggagggctaaaaaatgttagatgtta	CRISPR spacer
ctaataaggaggactaaaatatgttagaacgta	Protospacer
* **********.****** ********   **

7. spacer 1.8|193504|33|NZ_CP046390|CRISPRCasFinder,CRT matches to LR596615 (Yersinia phage fHe-Yen9-04 genome assembly, chromosome: I) position: , mismatch: 6, identity: 0.818 

caaataaggagggctaaaaaatgttagatgtta	CRISPR spacer
ctaataaggaggactaaaatatgttagaacgta	Protospacer
* **********.****** ********   **

8. spacer 1.8|193504|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NC_042116 (Yersinia phage fHe-Yen9-04 genome assembly, complete genome: monopartite) position: , mismatch: 6, identity: 0.818 

caaataaggagggctaaaaaatgttagatgtta	CRISPR spacer
ctaataaggaggactaaaatatgttagaacgta	Protospacer
* **********.****** ********   **

9. spacer 1.46|195859|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022209 (Burkholderia gladioli pv. gladioli strain FDAARGOS_188 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818 

ccttggccggggtcaagttgaccgactaccaaa-	CRISPR spacer
ccttggccggtgtcaaggtgaccg-cgacgaagc	Protospacer
********** ****** ****** * ** **.

10. spacer 1.46|195859|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 6, identity: 0.818 

ccttggccggggtcaagttgaccgactaccaaa-	CRISPR spacer
ccttggccggtgtcaaggtgaccg-cgacgaagc	Protospacer
********** ****** ****** * ** **.

11. spacer 1.46|195859|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009321 (Burkholderia gladioli strain ATCC 10248 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.818 

ccttggccggggtcaagttgaccgactaccaaa-	CRISPR spacer
ccttggccggtgtcaaggtgaccg-cgacgaagc	Protospacer
********** ****** ****** * ** **.

12. spacer 1.46|195859|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022007 (Burkholderia gladioli pv. gladioli strain KACC 11889 plasmid pls1, complete sequence) position: , mismatch: 6, identity: 0.818 

ccttggccggggtcaagttgaccgactaccaaa-	CRISPR spacer
ccttggccggtgtcaaggtgaccg-cgacgaagc	Protospacer
********** ****** ****** * ** **.

13. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NC_014023 (Bacillus megaterium QM B1551 plasmid pBM700, complete sequence) position: , mismatch: 6, identity: 0.818 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
atacatactaaggaggattaaaaaatggctata	Protospacer
*   ***.********************* * *

14. spacer 1.71|193505|33|NZ_CP046390|PILER-CR matches to LT960552 (Yersinia phage fHe-Yen9-03 genome assembly, complete genome: monopartite) position: , mismatch: 6, identity: 0.818 

caaataaggagggctaaaaaatgttagatgtta	CRISPR spacer
ctaataaggaggactaaaatatgttagaacgta	Protospacer
* **********.****** ********   **

15. spacer 1.71|193505|33|NZ_CP046390|PILER-CR matches to LR596615 (Yersinia phage fHe-Yen9-04 genome assembly, chromosome: I) position: , mismatch: 6, identity: 0.818 

caaataaggagggctaaaaaatgttagatgtta	CRISPR spacer
ctaataaggaggactaaaatatgttagaacgta	Protospacer
* **********.****** ********   **

16. spacer 1.71|193505|33|NZ_CP046390|PILER-CR matches to NC_042116 (Yersinia phage fHe-Yen9-04 genome assembly, complete genome: monopartite) position: , mismatch: 6, identity: 0.818 

caaataaggagggctaaaaaatgttagatgtta	CRISPR spacer
ctaataaggaggactaaaatatgttagaacgta	Protospacer
* **********.****** ********   **

17. spacer 1.15|193931|34|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP008877 (Terribacillus goriensis strain MP602 plasmid pT1, complete sequence) position: , mismatch: 7, identity: 0.794 

tggttaccttgatcaaagtaaagg--ctgaagtaag	CRISPR spacer
tggtcaccttgataaaagtaaagggcgtgaactt--	Protospacer
****.******** **********   **** *

18. spacer 1.16|193993|34|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP008877 (Terribacillus goriensis strain MP602 plasmid pT1, complete sequence) position: , mismatch: 7, identity: 0.794 

tggttaccttgatcaaagtaaagg--ctgaagtaag	CRISPR spacer
tggtcaccttgataaaagtaaagggcgtgaactt--	Protospacer
****.******** **********   **** *

19. spacer 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT matches to MK448484 (Streptococcus satellite phage Javan416, complete genome) position: , mismatch: 7, identity: 0.788 

cataatcgatatcagaccattctagcgcaagaa	CRISPR spacer
ttaaatcaatatcagaccattctagcgctacca	Protospacer
.  ****.******************** *  *

20. spacer 1.45|195798|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015602 (Pseudomonas antarctica strain PAMC 27494 plasmid pP27494_2, complete sequence) position: , mismatch: 7, identity: 0.788 

aaaaagactttgccgggcgcttgga---tacggcta	CRISPR spacer
aaaaagactttgccggtcgcgtggggtttccgg---	Protospacer
**************** *** ***.   * ***

21. spacer 1.78|193932|34|NZ_CP046390|PILER-CR matches to NZ_CP008877 (Terribacillus goriensis strain MP602 plasmid pT1, complete sequence) position: , mismatch: 7, identity: 0.794 

tggttaccttgatcaaagtaaagg--ctgaagtaag	CRISPR spacer
tggtcaccttgataaaagtaaagggcgtgaactt--	Protospacer
****.******** **********   **** *

22. spacer 1.79|193994|34|NZ_CP046390|PILER-CR matches to NZ_CP008877 (Terribacillus goriensis strain MP602 plasmid pT1, complete sequence) position: , mismatch: 7, identity: 0.794 

tggttaccttgatcaaagtaaagg--ctgaagtaag	CRISPR spacer
tggtcaccttgataaaagtaaagggcgtgaactt--	Protospacer
****.******** **********   **** *

23. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to KJ010489 (Enterococcus phage IME-EFm1, complete genome) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
taaactattaaggaggatgaaaacatggcagta	Protospacer
 . * ************* **** ******. *

24. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

25. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

26. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

27. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NC_015219 (Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069 plasmid pSGG1, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
ttcagcaaaaaggagttttaaaaaatggcaaaa	Protospacer
  **..*  ******  ****************

28. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NC_013963 (Bacillus sp. BS-01 plasmid pBS-01, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaatattatggaggattagaaaatgagtgaa	Protospacer
* .******* *********.******.  .**

29. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

30. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

31. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP033739 (Enterococcus sp. FDAARGOS_553 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

32. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NC_014557 (Bacillus sp. BS-02 plasmid pBS-02, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaatattatggaggattagaaaatgagtgaa	Protospacer
* .******* *********.******.  .**

33. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP043485 (Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

34. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

35. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

36. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP042214 (Enterococcus faecalis strain L15 plasmid pL15, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

37. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

38. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 8, identity: 0.758 

----agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
gtgaaataa----aagaaggattaataaatggcaaaa	Protospacer
    *..**    ***.******** ***********

39. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to LN681542 (Clostridium phage phiMMP03, complete genome) position: , mismatch: 8, identity: 0.758 

----agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
gtgaaataa----aagaaggattaataaatggcaaaa	Protospacer
    *..**    ***.******** ***********

40. spacer 1.8|193504|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NC_015390 (Carnobacterium sp. 17-4 plasmid pCAR50, complete sequence) position: , mismatch: 8, identity: 0.758 

caaataaggagggctaaaaaatgttagatgtta	CRISPR spacer
cagaaaaggagggctaaaaaatgtggtttattg	Protospacer
**.* ******************* .  *.**.

41. spacer 1.10|193626|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP042825 (Rhizobium sp. WL3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758 

ggagcaaagccctggtaatcgaagcgccgaaga	CRISPR spacer
tcatgaaagccttggtattcgaagcgccggaca	Protospacer
  *  ******.***** ***********.* *

42. spacer 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT matches to MK448465 (Streptococcus satellite phage Javan388, complete genome) position: , mismatch: 8, identity: 0.758 

cataatcgatatcagaccattctagcgcaagaa	CRISPR spacer
ctaaatcaatatcagaccattcaagcgcacacg	Protospacer
*  ****.************** ****** . .

43. spacer 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT matches to MK448471 (Streptococcus satellite phage Javan398, complete genome) position: , mismatch: 8, identity: 0.758 

cataatcgatatcagaccattctagcgcaagaa	CRISPR spacer
ctaaatcaatatcagaccattcaagcgcacatg	Protospacer
*  ****.************** ****** . .

44. spacer 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT matches to MK448468 (Streptococcus satellite phage Javan395, complete genome) position: , mismatch: 8, identity: 0.758 

cataatcgatatcagaccattctagcgcaagaa	CRISPR spacer
ctaaatcaatatcagaccattcaagcgcacatg	Protospacer
*  ****.************** ****** . .

45. spacer 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT matches to MK448476 (Streptococcus satellite phage Javan404, complete genome) position: , mismatch: 8, identity: 0.758 

cataatcgatatcagaccattctagcgcaagaa	CRISPR spacer
ctaaatcaatatcagaccattcaagcgcacacg	Protospacer
*  ****.************** ****** . .

46. spacer 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT matches to MK448480 (Streptococcus satellite phage Javan410, complete genome) position: , mismatch: 8, identity: 0.758 

cataatcgatatcagaccattctagcgcaagaa	CRISPR spacer
ctaaatcaatatcagaccattcaagcgcacacg	Protospacer
*  ****.************** ****** . .

47. spacer 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT matches to MK448466 (Streptococcus satellite phage Javan390, complete genome) position: , mismatch: 8, identity: 0.758 

cataatcgatatcagaccattctagcgcaagaa	CRISPR spacer
ctaaatcaatatcagaccattcaagcgcacatg	Protospacer
*  ****.************** ****** . .

48. spacer 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT matches to MK448353 (Streptococcus satellite phage Javan195, complete genome) position: , mismatch: 8, identity: 0.758 

cataatcgatatcagaccattctagcgcaagaa	CRISPR spacer
ctagatcaatatcagaccattctagggctacta	Protospacer
*  .***.***************** ** *  *

49. spacer 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT matches to MK448352 (Streptococcus satellite phage Javan194, complete genome) position: , mismatch: 8, identity: 0.758 

cataatcgatatcagaccattctagcgcaagaa	CRISPR spacer
ctagatcaatatcagaccattctagggctacta	Protospacer
*  .***.***************** ** *  *

50. spacer 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT matches to MK448351 (Streptococcus satellite phage Javan193, complete genome) position: , mismatch: 8, identity: 0.758 

cataatcgatatcagaccattctagcgcaagaa	CRISPR spacer
ctagatcaatatcagaccattctagggctacta	Protospacer
*  .***.***************** ** *  *

51. spacer 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT matches to MK448462 (Streptococcus satellite phage Javan379, complete genome) position: , mismatch: 8, identity: 0.758 

cataatcgatatcagaccattctagcgcaagaa	CRISPR spacer
ctagatcaatatcagaccattctagagctaaca	Protospacer
*  .***.***************** ** *. *

52. spacer 1.60|196714|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to MN693475 (Marine virus AFVG_25M183, complete genome) position: , mismatch: 8, identity: 0.758 

aagcttggtgaagacgttgacgctgacgaatgg	CRISPR spacer
gacgacggtgatgacgttgacgctgacgaagcg	Protospacer
.*   .***** ******************  *

53. spacer 1.61|196775|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014580 (Burkholderia sp. RPE67 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758 

tagcagccgccggggtttctttgcggtcaagtg	CRISPR spacer
tttgacgcgccggggtatatttgcggtcaagtt	Protospacer
*   *  ********* * *************

54. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to KJ010489 (Enterococcus phage IME-EFm1, complete genome) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
taaactattaaggaggatgaaaacatggcagta	Protospacer
 . * ************* **** ******. *

55. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

56. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

57. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

58. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NC_015219 (Streptococcus gallolyticus subsp. gallolyticus ATCC BAA-2069 plasmid pSGG1, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
ttcagcaaaaaggagttttaaaaaatggcaaaa	Protospacer
  **..*  ******  ****************

59. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NC_013963 (Bacillus sp. BS-01 plasmid pBS-01, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaatattatggaggattagaaaatgagtgaa	Protospacer
* .******* *********.******.  .**

60. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

61. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

62. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NZ_CP033739 (Enterococcus sp. FDAARGOS_553 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

63. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NC_014557 (Bacillus sp. BS-02 plasmid pBS-02, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaatattatggaggattagaaaatgagtgaa	Protospacer
* .******* *********.******.  .**

64. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NZ_CP043485 (Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

65. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

66. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

67. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NZ_CP042214 (Enterococcus faecalis strain L15 plasmid pL15, complete sequence) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

68. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 8, identity: 0.758 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
attaaaattaaggaggattaataaatgagtaat	Protospacer
* .** *************** *****.  **

69. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 8, identity: 0.758 

----agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
gtgaaataa----aagaaggattaataaatggcaaaa	Protospacer
    *..**    ***.******** ***********

70. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to LN681542 (Clostridium phage phiMMP03, complete genome) position: , mismatch: 8, identity: 0.758 

----agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
gtgaaataa----aagaaggattaataaatggcaaaa	Protospacer
    *..**    ***.******** ***********

71. spacer 1.71|193505|33|NZ_CP046390|PILER-CR matches to NC_015390 (Carnobacterium sp. 17-4 plasmid pCAR50, complete sequence) position: , mismatch: 8, identity: 0.758 

caaataaggagggctaaaaaatgttagatgtta	CRISPR spacer
cagaaaaggagggctaaaaaatgtggtttattg	Protospacer
**.* ******************* .  *.**.

72. spacer 1.73|193627|33|NZ_CP046390|PILER-CR matches to NZ_CP042825 (Rhizobium sp. WL3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758 

ggagcaaagccctggtaatcgaagcgccgaaga	CRISPR spacer
tcatgaaagccttggtattcgaagcgccggaca	Protospacer
  *  ******.***** ***********.* *

73. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to MN693673 (Marine virus AFVG_250M950, complete genome) position: , mismatch: 9, identity: 0.727 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
gcggatattattgaggattaaaaaatggcactt	Protospacer
.  .******  ******************

74. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP009640 (Bacillus cereus 03BB108 plasmid pBFI_3, complete sequence) position: , mismatch: 9, identity: 0.727 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
gaagaaagtaaggaggataaaaaaatggaaaat	Protospacer
.. .* * ********** ********* ***

75. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP053961 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
gaagaaagtaaggaggataaaaaaatggaaaat	Protospacer
.. .* * ********** ********* ***

76. spacer 1.9|193565|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NC_011981 (Agrobacterium vitis S4 plasmid pAtS4e, complete sequence) position: , mismatch: 9, identity: 0.727 

cttcctggtagtgcacttccttgcttcctggta	CRISPR spacer
ccgcctggtagagcaattccttgcttccgaaat	Protospacer
*. ******** *** ************ ..

77. spacer 1.12|193748|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.727 

caatagcgtcccggacggtttcatcgtcgcttg	CRISPR spacer
ccagcgcttcccggacggcttcatcgtcgtcga	Protospacer
* *  ** **********.**********.. .

78. spacer 1.25|194543|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP040831 (Paenibacillus polymyxa strain ZF129 plasmid pAP2, complete sequence) position: , mismatch: 9, identity: 0.727 

tgcaaaaagtacatgggacagtcaggt---cttgca	CRISPR spacer
ctaaaaaagtacattggacagtcatgtaaattt---	Protospacer
.  *********** ********* **   .**

79. spacer 1.26|194604|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP045391 (Roseivivax sp. THAF30 plasmid pTHAF30_b, complete sequence) position: , mismatch: 9, identity: 0.727 

ccgtcaatagccgcaaatacacgctcttggtga	CRISPR spacer
ccgtcaatagccgccaatacatgcggaacgaaa	Protospacer
************** ******.**     * .*

80. spacer 1.26|194604|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NZ_CP045363 (Roseivivax sp. THAF40 plasmid pTHAF40_c, complete sequence) position: , mismatch: 9, identity: 0.727 

ccgtcaatagccgcaaatacacgctcttggtga	CRISPR spacer
ccgtcaatagccgccaatacatgcggaacgaaa	Protospacer
************** ******.**     * .*

81. spacer 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT matches to MK448459 (Streptococcus satellite phage Javan375, complete genome) position: , mismatch: 9, identity: 0.727 

cataatcgatatcagaccattctagcgcaagaa	CRISPR spacer
ctagatcaatatcagaccattccagcgccaacg	Protospacer
*  .***.**************.***** *. .

82. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

83. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

84. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

85. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

86. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039379 (Pediococcus pentosaceus strain SL001 plasmid pSL001-1, complete sequence) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

87. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023175 (Lactobacillus plantarum strain BDGP2 plasmid pLtBDGP2A, complete sequence) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

88. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

89. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

90. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

91. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

92. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

93. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

94. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

95. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

96. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

97. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

98. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

99. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

100. spacer 1.44|195737|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 9, identity: 0.727 

taagtaaaaggaggaaattttaaaatggtaaaa	CRISPR spacer
gacatttaaggaggaaatattaaaatggcaatt	Protospacer
 * .*  *********** *********.**

101. spacer 1.49|196042|33|NZ_CP046390|CRISPRCasFinder,CRT,PILER-CR matches to KP735928 (Staphylococcus phage IME-SA4, complete genome) position: , mismatch: 9, identity: 0.727 

ttcaaattctaacatttttaacgccttttttaa	CRISPR spacer
gtagttctctaacctttttaacgtcttttttta	Protospacer
 * .  .****** *********.******* *

102. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to MN693673 (Marine virus AFVG_250M950, complete genome) position: , mismatch: 9, identity: 0.727 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
gcggatattattgaggattaaaaaatggcactt	Protospacer
.  .******  ******************

103. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NZ_CP009640 (Bacillus cereus 03BB108 plasmid pBFI_3, complete sequence) position: , mismatch: 9, identity: 0.727 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
gaagaaagtaaggaggataaaaaaatggaaaat	Protospacer
.. .* * ********** ********* ***

104. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to NZ_CP053961 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
gaagaaagtaaggaggataaaaaaatggaaaat	Protospacer
.. .* * ********** ********* ***

105. spacer 1.72|193566|33|NZ_CP046390|PILER-CR matches to NC_011981 (Agrobacterium vitis S4 plasmid pAtS4e, complete sequence) position: , mismatch: 9, identity: 0.727 

cttcctggtagtgcacttccttgcttcctggta	CRISPR spacer
ccgcctggtagagcaattccttgcttccgaaat	Protospacer
*. ******** *** ************ ..

106. spacer 1.75|193749|33|NZ_CP046390|PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.727 

caatagcgtcccggacggtttcatcgtcgcttg	CRISPR spacer
ccagcgcttcccggacggcttcatcgtcgtcga	Protospacer
* *  ** **********.**********.. .

107. spacer 1.88|194544|33|NZ_CP046390|PILER-CR matches to NZ_CP040831 (Paenibacillus polymyxa strain ZF129 plasmid pAP2, complete sequence) position: , mismatch: 9, identity: 0.727 

tgcaaaaagtacatgggacagtcaggt---cttgca	CRISPR spacer
ctaaaaaagtacattggacagtcatgtaaattt---	Protospacer
.  *********** ********* **   .**

108. spacer 1.89|194605|33|NZ_CP046390|PILER-CR matches to NZ_CP045391 (Roseivivax sp. THAF30 plasmid pTHAF30_b, complete sequence) position: , mismatch: 9, identity: 0.727 

ccgtcaatagccgcaaatacacgctcttggtga	CRISPR spacer
ccgtcaatagccgccaatacatgcggaacgaaa	Protospacer
************** ******.**     * .*

109. spacer 1.89|194605|33|NZ_CP046390|PILER-CR matches to NZ_CP045363 (Roseivivax sp. THAF40 plasmid pTHAF40_c, complete sequence) position: , mismatch: 9, identity: 0.727 

ccgtcaatagccgcaaatacacgctcttggtga	CRISPR spacer
ccgtcaatagccgccaatacatgcggaacgaaa	Protospacer
************** ******.**     * .*

110. spacer 1.7|193443|33|NZ_CP046390|CRISPRCasFinder,CRT matches to MN694358 (Marine virus AFVG_250M310, complete genome) position: , mismatch: 10, identity: 0.697 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
ttggaaattaaggagaataaaaaaatggcattt	Protospacer
   .* *********.** ***********

111. spacer 1.10|193626|33|NZ_CP046390|CRISPRCasFinder,CRT matches to MF490237 (Pseudomonas phage vB_PaeP_E220, complete genome) position: , mismatch: 10, identity: 0.697 

ggagcaaagccctggtaatcgaagcgccgaaga	CRISPR spacer
agctgcaagccctggtaaacgaagcgctgaccg	Protospacer
.*    ************ ********.**  .

112. spacer 1.10|193626|33|NZ_CP046390|CRISPRCasFinder,CRT matches to KM389247 (UNVERIFIED: Pseudomonas phage JBD90 clone contig00001 genomic sequence) position: , mismatch: 10, identity: 0.697 

ggagcaaagccctggtaatcgaagcgccgaaga	CRISPR spacer
agctgcaagccctggtaaacgaagcgctgaccg	Protospacer
.*    ************ ********.**  .

113. spacer 1.10|193626|33|NZ_CP046390|CRISPRCasFinder,CRT matches to NC_042342 (Pseudomonas virus H66, complete genome) position: , mismatch: 10, identity: 0.697 

ggagcaaagccctggtaatcgaagcgccgaaga	CRISPR spacer
agctgcaagccctggtaaacgaagcgctgaccg	Protospacer
.*    ************ ********.**  .

114. spacer 1.17|194055|33|NZ_CP046390|CRISPRCasFinder,CRT matches to LC371242 (Escherichia phage EcS1 DNA, complete sequence) position: , mismatch: 10, identity: 0.697 

cgggaaagcgggttcgattcccgcaatcagcca	CRISPR spacer
gaaggtcgcgggttcgattcctgcattcagcac	Protospacer
 ..*.  **************.*** *****

115. spacer 1.34|195092|33|NZ_CP046390|CRISPRCasFinder,CRT matches to KP696448 (Bacillus phage Stills, complete genome) position: , mismatch: 10, identity: 0.697 

cataatcgatatcagaccattctagcgcaagaa	CRISPR spacer
cgtaatcgatttaagaccattctagcttgttcc	Protospacer
*.******** * ************* ..

116. spacer 1.38|195370|33|NZ_CP046390|CRISPRCasFinder,CRT matches to AP018706 (Uncultured bacterium plasmid pSN0729-70 DNA, complete sequence) position: , mismatch: 10, identity: 0.697 

tacatcaaacacacaaaccggcgtacaaattaa	CRISPR spacer
aacatcaaaaacacaaaccagcgtaatgccttc	Protospacer
 ******** *********.*****  . .*

117. spacer 1.70|193444|33|NZ_CP046390|PILER-CR matches to MN694358 (Marine virus AFVG_250M310, complete genome) position: , mismatch: 10, identity: 0.697 

agcaatattaaggaggattaaaaaatggcaaaa	CRISPR spacer
ttggaaattaaggagaataaaaaaatggcattt	Protospacer
   .* *********.** ***********

118. spacer 1.73|193627|33|NZ_CP046390|PILER-CR matches to MF490237 (Pseudomonas phage vB_PaeP_E220, complete genome) position: , mismatch: 10, identity: 0.697 

ggagcaaagccctggtaatcgaagcgccgaaga	CRISPR spacer
agctgcaagccctggtaaacgaagcgctgaccg	Protospacer
.*    ************ ********.**  .

119. spacer 1.73|193627|33|NZ_CP046390|PILER-CR matches to KM389247 (UNVERIFIED: Pseudomonas phage JBD90 clone contig00001 genomic sequence) position: , mismatch: 10, identity: 0.697 

ggagcaaagccctggtaatcgaagcgccgaaga	CRISPR spacer
agctgcaagccctggtaaacgaagcgctgaccg	Protospacer
.*    ************ ********.**  .

120. spacer 1.73|193627|33|NZ_CP046390|PILER-CR matches to NC_042342 (Pseudomonas virus H66, complete genome) position: , mismatch: 10, identity: 0.697 

ggagcaaagccctggtaatcgaagcgccgaaga	CRISPR spacer
agctgcaagccctggtaaacgaagcgctgaccg	Protospacer
.*    ************ ********.**  .

121. spacer 1.80|194056|33|NZ_CP046390|PILER-CR matches to LC371242 (Escherichia phage EcS1 DNA, complete sequence) position: , mismatch: 10, identity: 0.697 

cgggaaagcgggttcgattcccgcaatcagcca	CRISPR spacer
gaaggtcgcgggttcgattcctgcattcagcac	Protospacer
 ..*.  **************.*** *****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 697522 : 714900 16 Phaeocystis_globosa_virus(16.67%) NA NA
DBSCAN-SWA_2 990391 : 1062940 50 Lactobacillus_phage(22.22%) transposase,protease NA
DBSCAN-SWA_3 1121820 : 1130615 9 Streptomyces_phage(37.5%) transposase NA
DBSCAN-SWA_4 1557528 : 1566101 8 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 1710017 : 1792747 66 Streptococcus_phage(13.04%) integrase,tRNA,transposase,protease attL 1741297:1741314|attR 1781527:1781544

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage