Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP034089 Bifidobacterium longum strain LTBL16 chromosome, complete genome 4 crisprs cas3,WYL,DEDDh,casR 0 1 0 0

Results visualization

1. NZ_CP034089
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034089_1 297529-297614 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034089_2 841614-841688 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034089_3 2030699-2030784 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP034089_4 2172883-2172956 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP034089_2 2.1|841638|27|NZ_CP034089|CRISPRCasFinder 841638-841664 27 NC_015513 Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY03, complete sequence 20971-20997 4 0.852
NZ_CP034089_2 2.1|841638|27|NZ_CP034089|CRISPRCasFinder 841638-841664 27 MN694668 Marine virus AFVG_250M472, complete genome 7746-7772 6 0.778

1. spacer 2.1|841638|27|NZ_CP034089|CRISPRCasFinder matches to NC_015513 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY03, complete sequence) position: , mismatch: 4, identity: 0.852

ggaaaacggcggaaacaagccaaaatc	CRISPR spacer
ggaatacgccggaaacaagccaaaacg	Protospacer
**** *** ****************. 

2. spacer 2.1|841638|27|NZ_CP034089|CRISPRCasFinder matches to MN694668 (Marine virus AFVG_250M472, complete genome) position: , mismatch: 6, identity: 0.778

ggaaaacggcggaaacaagccaaaatc	CRISPR spacer
aagaaacggaagaaacaagccaaaatg	Protospacer
...****** .*************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage