Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP046266 Bacillus sp. DSL-17 chromosome, complete genome 3 crisprs cas3,DinG,PD-DExK,DEDDh,csa3,RT,WYL 1 0 6 0

Results visualization

1. NZ_CP046266
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046266_1 3074735-3074833 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046266_2 4370866-4370942 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP046266_3 4809136-4809476 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP046266_3 3.1|4809168|20|NZ_CP046266|CRT 4809168-4809187 20 NZ_CP046266.1 5150543-5150562 2 0.9

1. spacer 3.1|4809168|20|NZ_CP046266|CRT matches to position: 5150543-5150562, mismatch: 2, identity: 0.9

aatttcattagaactgtcct	CRISPR spacer
aatttcatttgcactgtcct	Protospacer
********* * ********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 320935 : 330913 9 Synechococcus_phage(37.5%) NA NA
DBSCAN-SWA_2 1174300 : 1212184 30 Wolbachia_phage(50.0%) transposase NA
DBSCAN-SWA_3 2393108 : 2430323 36 Wolbachia_phage(50.0%) tail,transposase NA
DBSCAN-SWA_4 2841180 : 2850272 7 Brazilian_cedratvirus(33.33%) transposase NA
DBSCAN-SWA_5 2964408 : 2971857 8 Bacillus_virus(83.33%) NA NA
DBSCAN-SWA_6 3516400 : 3525896 12 Staphylococcus_phage(37.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage