Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP035680 Vibrio navarrensis strain 08-2462 chromosome 1, complete sequence 1 crisprs DinG,WYL,DEDDh,RT,cas3,csx1 1 0 4 0
NZ_CP035681 Vibrio navarrensis strain 08-2462 chromosome 2, complete sequence 1 crisprs csa3,cas3 0 0 105 0

Results visualization

1. NZ_CP035681
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035681_1 821485-821586 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 45084 44 Vibrio_phage(29.17%) tRNA,capsid,transposase,portal,head,tail,lysis NA
DBSCAN-SWA_2 55472 : 60144 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 70920 : 72392 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_4 81899 : 83033 1 Streptococcus_phi-m46.1-like_phage(100.0%) NA NA
DBSCAN-SWA_5 87525 : 92550 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_6 99347 : 100655 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_7 103897 : 106498 2 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_8 125565 : 126468 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_9 134283 : 136173 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_10 139727 : 142355 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_11 145731 : 151152 4 Invertebrate_iridovirus(50.0%) NA NA
DBSCAN-SWA_12 157282 : 159483 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_13 175079 : 182168 6 Chrysochromulina_ericina_virus(25.0%) NA NA
DBSCAN-SWA_14 187120 : 188476 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_15 195830 : 197096 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_16 202589 : 202931 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_17 207044 : 209781 2 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_18 215186 : 215972 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_19 223021 : 223936 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_20 226949 : 230845 2 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_21 234468 : 235755 1 Pontimonas_phage(100.0%) NA NA
DBSCAN-SWA_22 240842 : 241460 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_23 249187 : 260383 8 Streptococcus_phage(20.0%) NA NA
DBSCAN-SWA_24 268559 : 280915 9 Bacillus_virus(50.0%) holin NA
DBSCAN-SWA_25 301571 : 303554 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_26 320344 : 324306 2 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_27 329219 : 334650 5 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_28 338387 : 349926 8 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_29 356971 : 358105 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_30 363147 : 371463 6 Prochlorococcus_phage(33.33%) protease NA
DBSCAN-SWA_31 374464 : 377524 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_32 388745 : 391898 1 Trichoplusia_ni_single_nucleopolyhedrovirus(100.0%) NA NA
DBSCAN-SWA_33 396936 : 397419 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_34 402215 : 403478 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_35 414384 : 415422 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_36 430294 : 431134 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_37 437776 : 438454 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_38 447761 : 449744 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_39 464439 : 465102 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_40 470826 : 474957 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_41 481110 : 483763 2 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_42 493884 : 494319 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_43 498800 : 500420 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_44 508308 : 509853 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_45 514547 : 521403 7 Bacillus_phage(20.0%) NA NA
DBSCAN-SWA_46 543348 : 544200 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_47 554818 : 556729 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_48 564203 : 566021 1 Microcystis_virus(100.0%) NA NA
DBSCAN-SWA_49 570378 : 580021 6 Hokovirus(33.33%) NA NA
DBSCAN-SWA_50 585633 : 594376 8 uncultured_Caudovirales_phage(60.0%) NA NA
DBSCAN-SWA_51 613305 : 614907 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_52 629695 : 631647 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_53 638491 : 644331 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_54 649258 : 655566 6 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_55 659239 : 672249 10 Vibrio_phage(16.67%) NA NA
DBSCAN-SWA_56 675327 : 687988 9 Salmonella_phage(25.0%) NA NA
DBSCAN-SWA_57 713591 : 716463 3 Hokovirus(50.0%) NA NA
DBSCAN-SWA_58 720166 : 721860 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_59 729821 : 737866 7 Pike_perch_iridovirus(25.0%) NA NA
DBSCAN-SWA_60 747439 : 750896 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_61 760383 : 765994 5 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_62 772624 : 779990 6 Organic_Lake_phycodnavirus(25.0%) NA NA
DBSCAN-SWA_63 785223 : 789405 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_64 805712 : 807344 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_65 819684 : 820335 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_66 823610 : 824339 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_67 828541 : 830077 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_68 834072 : 835606 1 Bacillus_phage(100.0%) transposase NA
DBSCAN-SWA_69 843318 : 843990 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_70 847215 : 851017 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_71 854292 : 854799 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_72 863552 : 865425 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_73 883641 : 884658 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_74 889031 : 893633 3 Pacmanvirus(50.0%) NA NA
DBSCAN-SWA_75 907333 : 908353 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_76 913368 : 915084 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_77 924271 : 930087 4 Indivirus(33.33%) NA NA
DBSCAN-SWA_78 933612 : 935625 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_79 947030 : 951325 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_80 956659 : 957655 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_81 965371 : 967429 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_82 972357 : 972696 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_83 982225 : 984995 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_84 989032 : 995739 5 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_85 1005555 : 1008009 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_86 1013647 : 1014403 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_87 1022226 : 1024083 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_88 1038404 : 1044872 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_89 1049687 : 1050167 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_90 1060873 : 1064446 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_91 1067795 : 1068494 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_92 1076921 : 1087076 6 Enterobacteria_phage(20.0%) tRNA NA
DBSCAN-SWA_93 1095087 : 1097171 2 Vibrio_virus(50.0%) NA NA
DBSCAN-SWA_94 1124126 : 1125257 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_95 1130936 : 1136830 5 Catovirus(33.33%) NA NA
DBSCAN-SWA_96 1140617 : 1154128 8 uncultured_Caudovirales_phage(40.0%) NA NA
DBSCAN-SWA_97 1157472 : 1160662 3 Diachasmimorpha_longicaudata_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_98 1176511 : 1180038 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_99 1187762 : 1191495 3 Micromonas_pusilla_virus(50.0%) NA NA
DBSCAN-SWA_100 1199340 : 1200810 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_101 1206289 : 1207231 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_102 1218552 : 1219428 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_103 1228555 : 1237674 10 Bacillus_thuringiensis_phage(25.0%) NA NA
DBSCAN-SWA_104 1250094 : 1256661 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_105 1260025 : 1275026 20 Vibrio_phage(77.78%) transposase,integrase attL 1262730:1262743|attR 1272128:1272141
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP035680
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035680_1 568210-568413 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP035680_1 1.3|568353|41|NZ_CP035680|CRT 568353-568393 41 NZ_CP035680.1 568177-568217 1 0.976

1. spacer 1.3|568353|41|NZ_CP035680|CRT matches to position: 568177-568217, mismatch: 1, identity: 0.976

tcctgggctctgggaaaagcaagagcggaagagaaggtcct	CRISPR spacer
tcctaggctctgggaaaagcaagagcggaagagaaggtcct	Protospacer
****.************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 77611 : 84314 7 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 153548 : 160577 9 Megavirus(16.67%) NA NA
DBSCAN-SWA_3 1357269 : 1372612 14 uncultured_Mediterranean_phage(22.22%) tRNA NA
DBSCAN-SWA_4 2195561 : 2218101 44 Shigella_phage(100.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage