Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP045973 Listeria monocytogenes strain AUSMDU00000224 plasmid pAUSMDU00000224_01, complete sequence 0 crisprs csa3,cas5 0 0 1 0
NZ_CP045972 Listeria monocytogenes strain AUSMDU00000224 chromosome, complete genome 4 crisprs DinG,cas3,WYL,casR,DEDDh,csa3 0 1 5 0

Results visualization

1. NZ_CP045972
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045972_1 209955-210106 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045972_2 497235-497819 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045972_3 542783-543071 Orphan I-A
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045972_4 2766665-2766775 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045972_3 3.3|542942|35|NZ_CP045972|PILER-CR,CRISPRCasFinder,CRT 542942-542976 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NZ_CP045972_3 3.3|542942|35|NZ_CP045972|PILER-CR,CRISPRCasFinder,CRT 542942-542976 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943

1. spacer 3.3|542942|35|NZ_CP045972|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

2. spacer 3.3|542942|35|NZ_CP045972|PILER-CR,CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 120336 : 126861 10 Listeria_phage(33.33%) tail NA
DBSCAN-SWA_2 1122513 : 1129936 8 Hokovirus(33.33%) NA NA
DBSCAN-SWA_3 1243986 : 1324532 96 Listeria_phage(75.44%) holin,integrase,protease,capsid,tRNA,terminase,portal,tail attL 1243870:1243886|attR 1286829:1286845
DBSCAN-SWA_4 1858146 : 1866432 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 2522741 : 2530585 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP045973
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 31037 : 39882 10 Streptococcus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage