Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040799 Xylella fastidiosa subsp. fastidiosa strain Bakersfield-1 chromosome, complete genome 1 crisprs Cas9_archaeal,c2c8_V-U2,WYL,csa3,DEDDh,cas3,DinG 0 1 8 0
NZ_CP040800 Xylella fastidiosa subsp. fastidiosa strain Bakersfield-1 plasmid pXFAS01, complete sequence 0 crisprs c2c9_V-U4 0 0 0 0

Results visualization

1. NZ_CP040799
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040799_1 1866818-1866892 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040799_1 1.1|1866841|29|NZ_CP040799|CRISPRCasFinder 1866841-1866869 29 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1189005-1189033 7 0.759
NZ_CP040799_1 1.1|1866841|29|NZ_CP040799|CRISPRCasFinder 1866841-1866869 29 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 503612-503640 7 0.759
NZ_CP040799_1 1.1|1866841|29|NZ_CP040799|CRISPRCasFinder 1866841-1866869 29 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 774323-774351 7 0.759
NZ_CP040799_1 1.1|1866841|29|NZ_CP040799|CRISPRCasFinder 1866841-1866869 29 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 774405-774433 7 0.759
NZ_CP040799_1 1.1|1866841|29|NZ_CP040799|CRISPRCasFinder 1866841-1866869 29 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 80930-80958 8 0.724

1. spacer 1.1|1866841|29|NZ_CP040799|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

cccgccgttgctcgttccaggtctggaca	CRISPR spacer
ggcgtagtcgctcgttccaggtctggaag	Protospacer
  **. **.****************** .

2. spacer 1.1|1866841|29|NZ_CP040799|CRISPRCasFinder matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 7, identity: 0.759

cccgccgttgctcgttccaggtctggaca	CRISPR spacer
ccagccgttgctcgttccagggaaagatg	Protospacer
** ******************   .**..

3. spacer 1.1|1866841|29|NZ_CP040799|CRISPRCasFinder matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 7, identity: 0.759

cccgccgttgctcgttccaggtctggaca	CRISPR spacer
ccagccgttgctcgttccagggaaagatg	Protospacer
** ******************   .**..

4. spacer 1.1|1866841|29|NZ_CP040799|CRISPRCasFinder matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 7, identity: 0.759

cccgccgttgctcgttccaggtctggaca	CRISPR spacer
ccagccgttgctcgttccagggaaagatg	Protospacer
** ******************   .**..

5. spacer 1.1|1866841|29|NZ_CP040799|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.724

cccgccgttgctcgttccaggtctggaca	CRISPR spacer
cggaacgtggctcgttccaggtctggcgc	Protospacer
*  . *** *****************   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 419939 : 468630 55 Xylella_phage(23.81%) portal,protease,capsid,integrase,plate,tail attL 450524:450538|attR 475901:475915
DBSCAN-SWA_2 1129170 : 1143200 22 Stenotrophomonas_phage(50.0%) NA NA
DBSCAN-SWA_3 1152597 : 1189360 42 Haemophilus_phage(31.82%) protease,head,transposase,tRNA,plate,tail NA
DBSCAN-SWA_4 1192591 : 1226879 42 Xylella_phage(30.43%) integrase,terminase attL 1210161:1210178|attR 1228274:1228291
DBSCAN-SWA_5 1285014 : 1340514 72 Xylella_phage(44.44%) portal,capsid,integrase,terminase,plate,tail attL 1330479:1330494|attR 1342361:1342376
DBSCAN-SWA_6 1382782 : 1406283 28 Xylella_phage(28.57%) plate,tail,integrase attL 1383254:1383268|attR 1403210:1403224
DBSCAN-SWA_7 1579361 : 1585192 10 Xylella_phage(33.33%) NA NA
DBSCAN-SWA_8 2027196 : 2036398 12 Xylella_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage