Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP045813 Bacillus subtilis strain P8_B3 plasmid pBs005, complete sequence 0 crisprs NA 0 0 3 0
NZ_CP045812 Bacillus subtilis strain P8_B3 chromosome, complete genome 3 crisprs csa3,cas3,DEDDh,WYL,DinG 0 1 11 0

Results visualization

1. NZ_CP045813
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 2953 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_2 7758 : 75768 75 Enterococcus_phage(31.82%) tail,head,portal,integrase,terminase,capsid,protease attL 35099:35116|attR 76321:76338
DBSCAN-SWA_3 79717 : 84032 4 Escherichia_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP045812
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045812_1 937539-937644 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045812_2 3171843-3171950 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045812_3 3714605-3714717 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045812_2 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder 3171867-3171926 60 NZ_CP024037 Bacillus aryabhattai strain K13 plasmid unnamed2 10417-10476 7 0.883
NZ_CP045812_2 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder 3171867-3171926 60 NZ_CP026740 Bacillus megaterium strain YC4-R4 plasmid unnamed4 70764-70823 7 0.883
NZ_CP045812_2 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder 3171867-3171926 60 NC_017139 Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence 1318-1377 7 0.883
NZ_CP045812_2 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder 3171867-3171926 60 NZ_CP010587 Bacillus megaterium Q3 plasmid p1, complete sequence 838-897 7 0.883
NZ_CP045812_2 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder 3171867-3171926 60 NZ_CP023319 Bacillus megaterium strain A plasmid p2, complete sequence 75825-75884 7 0.883
NZ_CP045812_2 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder 3171867-3171926 60 NC_020451 Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence 1960-2019 9 0.85
NZ_CP045812_2 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder 3171867-3171926 60 NZ_CP015440 Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence 64773-64832 12 0.8
NZ_CP045812_2 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder 3171867-3171926 60 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 483791-483850 13 0.783
NZ_CP045812_2 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder 3171867-3171926 60 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 57361-57420 14 0.767

1. spacer 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder matches to NZ_CP024037 (Bacillus aryabhattai strain K13 plasmid unnamed2) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

2. spacer 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder matches to NZ_CP026740 (Bacillus megaterium strain YC4-R4 plasmid unnamed4) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

3. spacer 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder matches to NC_017139 (Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

4. spacer 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder matches to NZ_CP010587 (Bacillus megaterium Q3 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

5. spacer 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder matches to NZ_CP023319 (Bacillus megaterium strain A plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

6. spacer 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder matches to NC_020451 (Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence) position: , mismatch: 9, identity: 0.85

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcattttagttatggcccggg	Protospacer
****************************************** ***   * ***  **. 

7. spacer 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder matches to NZ_CP015440 (Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence) position: , mismatch: 12, identity: 0.8

cagcttggaaggctgaggttttaccactaaactacacccgca-------atttttatttg	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcataataatatataccattg	Protospacer
******************************************       ** * .  ***

8. spacer 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.783

cagcttggaaggctgaggttttaccactaaactacacccgc--------aatttttattt	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatggttaaaagttttgcca	Protospacer
*****************************************        ** ****... 

9. spacer 2.1|3171867|60|NZ_CP045812|CRISPRCasFinder matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 14, identity: 0.767

cagcttggaaggctgaggttttaccactaaactacacccgc---------aatttttatt	CRISPR spacer
cagcttggaaggctgtagttttaccactaaactacacccgcatagtaagtagttcttagt	Protospacer
*************** .************************         *.**.*** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 699825 : 708191 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 1207403 : 1251177 49 Planktothrix_phage(25.0%) tRNA,coat NA
DBSCAN-SWA_3 1314039 : 1358875 57 Bacillus_phage(25.71%) portal,holin,terminase,protease,plate NA
DBSCAN-SWA_4 1868207 : 1874762 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_5 2059281 : 2064968 9 Bacillus_phage(100.0%) holin NA
DBSCAN-SWA_6 2151217 : 2286645 198 Bacillus_phage(97.8%) integrase,bacteriocin attL 2151640:2151655|attR 2286006:2286021
DBSCAN-SWA_7 2424833 : 2430929 8 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_8 2660686 : 2698828 55 uncultured_Caudovirales_phage(30.3%) portal,holin,tail,terminase,plate NA
DBSCAN-SWA_9 2832312 : 2885629 56 uncultured_Mediterranean_phage(12.5%) protease,coat,tRNA NA
DBSCAN-SWA_10 3459392 : 3470589 14 Organic_Lake_phycodnavirus(50.0%) holin NA
DBSCAN-SWA_11 3833264 : 3909879 78 Bacillus_phage(26.67%) protease,bacteriocin,coat,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage