Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP045054 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP045056 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 chromosome, complete genome 2 crisprs DEDDh,WYL,DinG,cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e 1 9 10 0
NZ_CP045055 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP045053 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP045054
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 24836 : 146398 99 Salmonella_phage(35.0%) integrase,portal,protease,holin,bacteriocin,terminase,plate,tail,lysis,transposase,head,capsid attL 25114:25130|attR 71709:71725
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP045056
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045056_1 3002100-3003227 TypeI-E I-E
18 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045056_2 3019363-3019514 TypeI-E I-E
2 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP045056_2 2.2|3019454|31|NZ_CP045056|CRISPRCasFinder 3019454-3019484 31 NZ_CP045056.1 715136-715166 1 0.968

1. spacer 2.2|3019454|31|NZ_CP045056|CRISPRCasFinder matches to position: 715136-715166, mismatch: 1, identity: 0.968

aagggagccaaatctgccgcatgaccatcgt	CRISPR spacer
aagggagccaaatctgccgcatgaccgtcgt	Protospacer
**************************.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045056_1 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002923-3002954 32 NZ_CP044178 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1 30628-30659 2 0.938
NZ_CP045056_1 1.1|3002129|32|NZ_CP045056|CRISPRCasFinder,CRT 3002129-3002160 32 NC_006824 Aromatoleum aromaticum EbN1 plasmid 2, complete sequence 25444-25475 6 0.812
NZ_CP045056_1 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002923-3002954 32 MH632120 Mycobacterium phage Thonko, complete genome 6035-6066 6 0.812
NZ_CP045056_1 1.3|3002251|32|NZ_CP045056|CRISPRCasFinder,CRT 3002251-3002282 32 NC_013860 Azospirillum sp. B510 plasmid pAB510f, complete sequence 12149-12180 7 0.781
NZ_CP045056_1 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002923-3002954 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 94726-94757 7 0.781
NZ_CP045056_1 1.20|3002251|31|NZ_CP045056|PILER-CR 3002251-3002281 31 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1026941-1026971 7 0.774
NZ_CP045056_1 1.20|3002251|31|NZ_CP045056|PILER-CR 3002251-3002281 31 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 12524-12554 7 0.774
NZ_CP045056_1 1.3|3002251|32|NZ_CP045056|CRISPRCasFinder,CRT 3002251-3002282 32 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1026941-1026972 8 0.75
NZ_CP045056_1 1.3|3002251|32|NZ_CP045056|CRISPRCasFinder,CRT 3002251-3002282 32 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 12523-12554 8 0.75
NZ_CP045056_1 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002923-3002954 32 NZ_CP039896 Rhizobium pusense strain CFBP5875 plasmid pAtCFBP5875, complete sequence 40576-40607 8 0.75
NZ_CP045056_1 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002923-3002954 32 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 71482-71513 8 0.75
NZ_CP045056_1 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002923-3002954 32 NZ_CP039913 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence 133525-133556 8 0.75
NZ_CP045056_1 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002923-3002954 32 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 259824-259855 8 0.75
NZ_CP045056_1 1.3|3002251|32|NZ_CP045056|CRISPRCasFinder,CRT 3002251-3002282 32 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 153622-153653 9 0.719
NZ_CP045056_1 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002923-3002954 32 NZ_CP010801 Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence 134672-134703 9 0.719
NZ_CP045056_1 1.16|3003045|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3003045-3003076 32 AP018698 Arthrobacter sp. MN05-02 plasmid plasmid1 DNA, complete genome 127276-127307 9 0.719
NZ_CP045056_1 1.20|3002251|31|NZ_CP045056|PILER-CR 3002251-3002281 31 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 153622-153652 9 0.71
NZ_CP045056_1 1.20|3002251|31|NZ_CP045056|PILER-CR 3002251-3002281 31 NC_013860 Azospirillum sp. B510 plasmid pAB510f, complete sequence 12149-12179 9 0.71
NZ_CP045056_1 1.4|3002312|32|NZ_CP045056|CRISPRCasFinder,CRT 3002312-3002343 32 NZ_CP011404 Lactobacillus salivarius str. Ren plasmid pR1, complete sequence 14283-14314 10 0.688
NZ_CP045056_1 1.4|3002312|32|NZ_CP045056|CRISPRCasFinder,CRT 3002312-3002343 32 NZ_CP017108 Lactobacillus salivarius strain CICC23174 plasmid pLS_1 sequence 170262-170293 10 0.688
NZ_CP045056_1 1.8|3002557|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002557-3002588 32 MT889371 Microbacterium phage DelaGarza, complete genome 20155-20186 10 0.688
NZ_CP045056_1 1.9|3002618|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002618-3002649 32 MT889371 Microbacterium phage DelaGarza, complete genome 20155-20186 10 0.688
NZ_CP045056_1 1.13|3002862|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002862-3002893 32 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 304278-304309 10 0.688
NZ_CP045056_1 1.13|3002862|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002862-3002893 32 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 7051-7082 10 0.688
NZ_CP045056_1 1.13|3002862|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002862-3002893 32 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 304278-304309 10 0.688
NZ_CP045056_1 1.13|3002862|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002862-3002893 32 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 279065-279096 10 0.688
NZ_CP045056_1 1.13|3002862|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002862-3002893 32 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 721171-721202 10 0.688
NZ_CP045056_1 1.13|3002862|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR 3002862-3002893 32 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 318301-318332 10 0.688

1. spacer 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044178 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1) position: , mismatch: 2, identity: 0.938

ctgcgcgacaacttcatcgaacaggtcacagg	CRISPR spacer
ctgcgcgacaacttcatcgaacagggcgcagg	Protospacer
************************* *.****

2. spacer 1.1|3002129|32|NZ_CP045056|CRISPRCasFinder,CRT matches to NC_006824 (Aromatoleum aromaticum EbN1 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.812

gatttttcgccagccactccagccagt--gctgc	CRISPR spacer
gcttcttcgccagccactcccgccattcggct--	Protospacer
* **.*************** **** *  ***  

3. spacer 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to MH632120 (Mycobacterium phage Thonko, complete genome) position: , mismatch: 6, identity: 0.812

ctgcgcgacaacttcatcgaacaggtcacagg-	CRISPR spacer
cagcgcgacgacttcatcgagcagg-cacgcga	Protospacer
* *******.**********.**** ***. * 

4. spacer 1.3|3002251|32|NZ_CP045056|CRISPRCasFinder,CRT matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 7, identity: 0.781

atcgccggggcgggcaatgacgccagctcacc--	CRISPR spacer
ggcggcggggcgggcaatgacacca--tcagcgg	Protospacer
. ** ****************.***  *** *  

5. spacer 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 7, identity: 0.781

ctgcgcgacaacttcatcgaacag-gtcacagg	CRISPR spacer
ctgcgcgacaagttcttcgaacagcattgcaa-	Protospacer
*********** *** ******** .*..**. 

6. spacer 1.20|3002251|31|NZ_CP045056|PILER-CR matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 7, identity: 0.774

atcgccggggcgggcaatgacgccagctcac	CRISPR spacer
atcgccggcgcgggcaatgaagccgggcgat	Protospacer
******** *********** ***.* . *.

7. spacer 1.20|3002251|31|NZ_CP045056|PILER-CR matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 7, identity: 0.774

atcgccggggcgggcaatgacgccagctcac	CRISPR spacer
ctcgccgggccgggcaaggacgccgaccctc	Protospacer
 ******** ******* ******..*.* *

8. spacer 1.3|3002251|32|NZ_CP045056|CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.75

atcgccggggcgggcaatgacgccagctcacc	CRISPR spacer
atcgccggcgcgggcaatgaagccgggcgata	Protospacer
******** *********** ***.* . *. 

9. spacer 1.3|3002251|32|NZ_CP045056|CRISPRCasFinder,CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 8, identity: 0.75

atcgccggggcgggcaatgacgccagctcacc	CRISPR spacer
ctcgccgggccgggcaaggacgccgaccctct	Protospacer
 ******** ******* ******..*.* *.

10. spacer 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039896 (Rhizobium pusense strain CFBP5875 plasmid pAtCFBP5875, complete sequence) position: , mismatch: 8, identity: 0.75

ctgcgcgacaacttcatcgaacaggtcacagg	CRISPR spacer
atcctcgacaacttcctcgagcaggtcatata	Protospacer
 * * ********** ****.*******.* .

11. spacer 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 8, identity: 0.75

ctgcgcgacaacttcatcgaacaggtcacagg	CRISPR spacer
atcctcgacaacttcctcgagcaggtcatata	Protospacer
 * * ********** ****.*******.* .

12. spacer 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.75

ctgcgcgacaacttcatcgaacaggtcacagg	CRISPR spacer
atcctcgacaacttcctcgagcaggtcatata	Protospacer
 * * ********** ****.*******.* .

13. spacer 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 8, identity: 0.75

ctgcgcgacaacttcatcgaacaggtcacagg	CRISPR spacer
atcctcgacaacttcctcgagcaggtcatata	Protospacer
 * * ********** ****.*******.* .

14. spacer 1.3|3002251|32|NZ_CP045056|CRISPRCasFinder,CRT matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 9, identity: 0.719

atcgccggggcgggcaatgacgccagctcacc	CRISPR spacer
tccggcggggccggcaatgacgccatgtggac	Protospacer
 .** ****** *************  * . *

15. spacer 1.14|3002923|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010801 (Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence) position: , mismatch: 9, identity: 0.719

ctgcgcgacaacttcatcgaacaggtcacagg	CRISPR spacer
gtaggcggcaacttcatcgatcaggtcgatcg	Protospacer
 *. ***.************ ******.   *

16. spacer 1.16|3003045|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to AP018698 (Arthrobacter sp. MN05-02 plasmid plasmid1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

tcgtcgagg-----cggatgaaatagtggttagcatc	CRISPR spacer
-----gaaagaatccggatgaaatagtggttggcctc	Protospacer
     **..     *****************.** **

17. spacer 1.20|3002251|31|NZ_CP045056|PILER-CR matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 9, identity: 0.71

atcgccggggcgggcaatgacgccagctcac	CRISPR spacer
tccggcggggccggcaatgacgccatgtgga	Protospacer
 .** ****** *************  * . 

18. spacer 1.20|3002251|31|NZ_CP045056|PILER-CR matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 9, identity: 0.71

atcgccggggcgggcaatgacgccagctcac	CRISPR spacer
ggcggcggggcgggcaatgacaccatcagcg	Protospacer
. ** ****************.*** *    

19. spacer 1.4|3002312|32|NZ_CP045056|CRISPRCasFinder,CRT matches to NZ_CP011404 (Lactobacillus salivarius str. Ren plasmid pR1, complete sequence) position: , mismatch: 10, identity: 0.688

cccccctgattattttttatccgtttcagtaa	CRISPR spacer
aaaggatgaatattttttatcagtttcagata	Protospacer
      *** *********** *******  *

20. spacer 1.4|3002312|32|NZ_CP045056|CRISPRCasFinder,CRT matches to NZ_CP017108 (Lactobacillus salivarius strain CICC23174 plasmid pLS_1 sequence) position: , mismatch: 10, identity: 0.688

cccccctgattattttttatccgtttcagtaa	CRISPR spacer
aaaggatgaatattttttatcagtttcagata	Protospacer
      *** *********** *******  *

21. spacer 1.8|3002557|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 10, identity: 0.688

aacacggcggcaatatcgcgcccctgactggg	CRISPR spacer
tggagggcggcaatctcacgcccctgaccctc	Protospacer
 . * ********* **.**********.   

22. spacer 1.9|3002618|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 10, identity: 0.688

aacacggcggcaatatcgcgcccctgactggg	CRISPR spacer
tggagggcggcaatctcacgcccctgaccctc	Protospacer
 . * ********* **.**********.   

23. spacer 1.13|3002862|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 10, identity: 0.688

gcaaacgggctcattttccactgcgcggcctg	CRISPR spacer
tctttgatgctcaatttccactgcgcggtctt	Protospacer
 *    . ***** **************.** 

24. spacer 1.13|3002862|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 10, identity: 0.688

gcaaacgggctcattttccactgcgcggcctg	CRISPR spacer
tcttcgatgctcaatttccactgcgcggtctt	Protospacer
 *    . ***** **************.** 

25. spacer 1.13|3002862|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 10, identity: 0.688

gcaaacgggctcattttccactgcgcggcctg	CRISPR spacer
tctttgatgctcaatttccactgcgcggtctt	Protospacer
 *    . ***** **************.** 

26. spacer 1.13|3002862|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gcaaacgggctcattttccactgcgcggcctg	CRISPR spacer
tcttcgatgctcaatttccactgcgcggtctt	Protospacer
 *    . ***** **************.** 

27. spacer 1.13|3002862|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 10, identity: 0.688

gcaaacgggctcattttccactgcgcggcctg	CRISPR spacer
tcttcgatgctcaatttccactgcgcggtctt	Protospacer
 *    . ***** **************.** 

28. spacer 1.13|3002862|32|NZ_CP045056|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 10, identity: 0.688

gcaaacgggctcattttccactgcgcggcctg	CRISPR spacer
tcttcgatgctcaatttccactgcgcggtctt	Protospacer
 *    . ***** **************.** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 968135 : 975448 7 Dickeya_phage(16.67%) protease NA
DBSCAN-SWA_2 1076856 : 1123328 65 Salmonella_phage(25.0%) head,lysis,tail,protease,integrase attL 1071977:1071992|attR 1103725:1103740
DBSCAN-SWA_3 1817236 : 1911628 103 Enterobacteria_phage(44.74%) tRNA,head,capsid,portal,lysis,tail,protease,terminase,integrase,transposase attL 1809326:1809341|attR 1907620:1907635
DBSCAN-SWA_4 1965730 : 1971120 9 uncultured_Caudovirales_phage(33.33%) integrase attL 1965777:1965791|attR 1976665:1976679
DBSCAN-SWA_5 2073793 : 2085204 12 Morganella_phage(25.0%) NA NA
DBSCAN-SWA_6 2209145 : 2219652 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_7 2298107 : 2307278 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_8 3441671 : 3481276 55 Pseudomonas_phage(24.24%) head,tail,terminase,integrase,plate,transposase attL 3441418:3441433|attR 3481385:3481400
DBSCAN-SWA_9 4292882 : 4388360 110 Salmonella_phage(77.78%) tRNA,holin,portal,capsid,head,tail,protease,terminase,integrase,plate attL 4325781:4325825|attR 4358452:4358496
DBSCAN-SWA_10 4506977 : 4525129 23 Burkholderia_phage(40.0%) tail,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage