Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP033248 Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence 2 crisprs WYL,DEDDh,RT,csa3 0 2 4 0
NZ_CP033249 Clostridium butyricum strain CFSA3989 chromosome, complete genome 7 crisprs cas3,csa3,DEDDh,DinG,RT,WYL 0 0 6 0

Results visualization

1. NZ_CP033248
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033248_1 882004-882115 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033248_2 882198-882288 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP033248_1 1.1|882034|51|NZ_CP033248|CRISPRCasFinder 882034-882084 51 NZ_CP039703 Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence 379362-379412 0 1.0
NZ_CP033248_1 1.1|882034|51|NZ_CP033248|CRISPRCasFinder 882034-882084 51 NZ_CP013238 Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence 493938-493988 0 1.0
NZ_CP033248_1 1.1|882034|51|NZ_CP033248|CRISPRCasFinder 882034-882084 51 NZ_CP039706 Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence 296581-296631 0 1.0
NZ_CP033248_1 1.1|882034|51|NZ_CP033248|CRISPRCasFinder 882034-882084 51 NZ_CP033246 Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence 882019-882069 0 1.0
NZ_CP033248_1 1.1|882034|51|NZ_CP033248|CRISPRCasFinder 882034-882084 51 NZ_CP033248 Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence 882034-882084 0 1.0
NZ_CP033248_1 1.1|882034|51|NZ_CP033248|CRISPRCasFinder 882034-882084 51 NZ_AP019717 Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence 331611-331661 0 1.0
NZ_CP033248_2 2.1|882228|31|NZ_CP033248|CRISPRCasFinder 882228-882258 31 NZ_CP039703 Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence 379188-379218 0 1.0
NZ_CP033248_2 2.1|882228|31|NZ_CP033248|CRISPRCasFinder 882228-882258 31 NZ_CP039706 Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence 296775-296805 0 1.0
NZ_CP033248_2 2.1|882228|31|NZ_CP033248|CRISPRCasFinder 882228-882258 31 NZ_CP033246 Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence 882213-882243 0 1.0
NZ_CP033248_2 2.1|882228|31|NZ_CP033248|CRISPRCasFinder 882228-882258 31 NZ_CP033248 Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence 882228-882258 0 1.0
NZ_CP033248_2 2.1|882228|31|NZ_CP033248|CRISPRCasFinder 882228-882258 31 NZ_AP019717 Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence 331805-331835 0 1.0
NZ_CP033248_2 2.1|882228|31|NZ_CP033248|CRISPRCasFinder 882228-882258 31 NZ_CP013238 Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence 493764-493794 1 0.968

1. spacer 1.1|882034|51|NZ_CP033248|CRISPRCasFinder matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	CRISPR spacer
aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	Protospacer
***************************************************

2. spacer 1.1|882034|51|NZ_CP033248|CRISPRCasFinder matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	CRISPR spacer
aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	Protospacer
***************************************************

3. spacer 1.1|882034|51|NZ_CP033248|CRISPRCasFinder matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	CRISPR spacer
aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	Protospacer
***************************************************

4. spacer 1.1|882034|51|NZ_CP033248|CRISPRCasFinder matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	CRISPR spacer
aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	Protospacer
***************************************************

5. spacer 1.1|882034|51|NZ_CP033248|CRISPRCasFinder matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	CRISPR spacer
aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	Protospacer
***************************************************

6. spacer 1.1|882034|51|NZ_CP033248|CRISPRCasFinder matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	CRISPR spacer
aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	Protospacer
***************************************************

7. spacer 2.1|882228|31|NZ_CP033248|CRISPRCasFinder matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 0, identity: 1.0

tacttataaacgtgataacttggttcacaag	CRISPR spacer
tacttataaacgtgataacttggttcacaag	Protospacer
*******************************

8. spacer 2.1|882228|31|NZ_CP033248|CRISPRCasFinder matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 0, identity: 1.0

tacttataaacgtgataacttggttcacaag	CRISPR spacer
tacttataaacgtgataacttggttcacaag	Protospacer
*******************************

9. spacer 2.1|882228|31|NZ_CP033248|CRISPRCasFinder matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 0, identity: 1.0

tacttataaacgtgataacttggttcacaag	CRISPR spacer
tacttataaacgtgataacttggttcacaag	Protospacer
*******************************

10. spacer 2.1|882228|31|NZ_CP033248|CRISPRCasFinder matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 0, identity: 1.0

tacttataaacgtgataacttggttcacaag	CRISPR spacer
tacttataaacgtgataacttggttcacaag	Protospacer
*******************************

11. spacer 2.1|882228|31|NZ_CP033248|CRISPRCasFinder matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 0, identity: 1.0

tacttataaacgtgataacttggttcacaag	CRISPR spacer
tacttataaacgtgataacttggttcacaag	Protospacer
*******************************

12. spacer 2.1|882228|31|NZ_CP033248|CRISPRCasFinder matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 1, identity: 0.968

tacttataaacgtgataacttggttcacaag	CRISPR spacer
tacttataaacgtgataacttcgttcacaag	Protospacer
********************* *********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 216561 : 256872 45 Erysipelothrix_phage(25.81%) holin,portal,protease,capsid,head,tail,terminase NA
DBSCAN-SWA_2 612440 : 621525 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_3 714266 : 766307 53 uncultured_Caudovirales_phage(43.33%) transposase,coat,portal,tail,terminase NA
DBSCAN-SWA_4 772158 : 782368 16 Clostridium_phage(30.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP033249
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033249_1 309769-309916 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033249_2 315579-315717 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033249_3 2119714-2119797 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033249_4 3320856-3320941 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033249_5 3375822-3375908 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033249_6 3445165-3445364 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033249_7 3449096-3449313 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 491159 : 544025 51 Clostridium_phage(30.0%) protease,coat,tRNA NA
DBSCAN-SWA_2 859119 : 923089 56 Bacillus_phage(42.86%) transposase,integrase,coat,tRNA attL 883801:883832|attR 923752:923783
DBSCAN-SWA_3 1136580 : 1222476 99 Clostridium_phage(21.62%) terminase,protease,capsid,tail,portal,integrase,tRNA attL 1132261:1132280|attR 1186386:1186405
DBSCAN-SWA_4 1611813 : 1660244 49 uncultured_Caudovirales_phage(20.0%) integrase,coat,transposase attL 1618236:1618251|attR 1638062:1638077
DBSCAN-SWA_5 2689140 : 2699168 7 Prochlorococcus_phage(42.86%) NA NA
DBSCAN-SWA_6 2832410 : 2854539 28 Clostridium_phage(36.36%) transposase,terminase,protease,capsid,tail,portal,integrase,head attL 2830897:2830955|attR 2854678:2854736
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage