Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP033246 Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence 2 crisprs WYL,DEDDh,RT,csa3 0 2 4 0
NZ_CP033247 Clostridium butyricum strain CFSA3987 chromosome, complete genome 7 crisprs cas3,csa3,DEDDh,DinG,RT,WYL 0 2 6 0

Results visualization

1. NZ_CP033246
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033246_1 881989-882100 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033246_2 882183-882273 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP033246_1 1.1|882019|51|NZ_CP033246|CRISPRCasFinder 882019-882069 51 NZ_CP039703 Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence 379362-379412 0 1.0
NZ_CP033246_1 1.1|882019|51|NZ_CP033246|CRISPRCasFinder 882019-882069 51 NZ_CP013238 Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence 493938-493988 0 1.0
NZ_CP033246_1 1.1|882019|51|NZ_CP033246|CRISPRCasFinder 882019-882069 51 NZ_CP039706 Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence 296581-296631 0 1.0
NZ_CP033246_1 1.1|882019|51|NZ_CP033246|CRISPRCasFinder 882019-882069 51 NZ_CP033246 Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence 882019-882069 0 1.0
NZ_CP033246_1 1.1|882019|51|NZ_CP033246|CRISPRCasFinder 882019-882069 51 NZ_CP033248 Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence 882034-882084 0 1.0
NZ_CP033246_1 1.1|882019|51|NZ_CP033246|CRISPRCasFinder 882019-882069 51 NZ_AP019717 Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence 331611-331661 0 1.0
NZ_CP033246_2 2.1|882213|31|NZ_CP033246|CRISPRCasFinder 882213-882243 31 NZ_CP039703 Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence 379188-379218 0 1.0
NZ_CP033246_2 2.1|882213|31|NZ_CP033246|CRISPRCasFinder 882213-882243 31 NZ_CP039706 Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence 296775-296805 0 1.0
NZ_CP033246_2 2.1|882213|31|NZ_CP033246|CRISPRCasFinder 882213-882243 31 NZ_CP033246 Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence 882213-882243 0 1.0
NZ_CP033246_2 2.1|882213|31|NZ_CP033246|CRISPRCasFinder 882213-882243 31 NZ_CP033248 Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence 882228-882258 0 1.0
NZ_CP033246_2 2.1|882213|31|NZ_CP033246|CRISPRCasFinder 882213-882243 31 NZ_AP019717 Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence 331805-331835 0 1.0
NZ_CP033246_2 2.1|882213|31|NZ_CP033246|CRISPRCasFinder 882213-882243 31 NZ_CP013238 Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence 493764-493794 1 0.968

1. spacer 1.1|882019|51|NZ_CP033246|CRISPRCasFinder matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	CRISPR spacer
aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	Protospacer
***************************************************

2. spacer 1.1|882019|51|NZ_CP033246|CRISPRCasFinder matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	CRISPR spacer
aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	Protospacer
***************************************************

3. spacer 1.1|882019|51|NZ_CP033246|CRISPRCasFinder matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	CRISPR spacer
aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	Protospacer
***************************************************

4. spacer 1.1|882019|51|NZ_CP033246|CRISPRCasFinder matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	CRISPR spacer
aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	Protospacer
***************************************************

5. spacer 1.1|882019|51|NZ_CP033246|CRISPRCasFinder matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	CRISPR spacer
aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	Protospacer
***************************************************

6. spacer 1.1|882019|51|NZ_CP033246|CRISPRCasFinder matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 0, identity: 1.0

aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	CRISPR spacer
aacaaaattcaactcctttttactattatttttattaaaaattgcgtttcg	Protospacer
***************************************************

7. spacer 2.1|882213|31|NZ_CP033246|CRISPRCasFinder matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 0, identity: 1.0

tacttataaacgtgataacttggttcacaag	CRISPR spacer
tacttataaacgtgataacttggttcacaag	Protospacer
*******************************

8. spacer 2.1|882213|31|NZ_CP033246|CRISPRCasFinder matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 0, identity: 1.0

tacttataaacgtgataacttggttcacaag	CRISPR spacer
tacttataaacgtgataacttggttcacaag	Protospacer
*******************************

9. spacer 2.1|882213|31|NZ_CP033246|CRISPRCasFinder matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 0, identity: 1.0

tacttataaacgtgataacttggttcacaag	CRISPR spacer
tacttataaacgtgataacttggttcacaag	Protospacer
*******************************

10. spacer 2.1|882213|31|NZ_CP033246|CRISPRCasFinder matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 0, identity: 1.0

tacttataaacgtgataacttggttcacaag	CRISPR spacer
tacttataaacgtgataacttggttcacaag	Protospacer
*******************************

11. spacer 2.1|882213|31|NZ_CP033246|CRISPRCasFinder matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 0, identity: 1.0

tacttataaacgtgataacttggttcacaag	CRISPR spacer
tacttataaacgtgataacttggttcacaag	Protospacer
*******************************

12. spacer 2.1|882213|31|NZ_CP033246|CRISPRCasFinder matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 1, identity: 0.968

tacttataaacgtgataacttggttcacaag	CRISPR spacer
tacttataaacgtgataacttcgttcacaag	Protospacer
********************* *********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 216521 : 256832 45 Erysipelothrix_phage(25.81%) protease,holin,portal,head,tail,terminase,capsid NA
DBSCAN-SWA_2 612425 : 621510 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_3 714250 : 766291 53 uncultured_Caudovirales_phage(43.33%) portal,tail,terminase,coat,transposase NA
DBSCAN-SWA_4 772142 : 782352 16 Clostridium_phage(30.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP033247
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033247_1 309766-309913 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033247_2 1680963-1681179 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033247_3 2119718-2119801 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033247_4 3320882-3320967 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033247_5 3375848-3375934 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033247_6 3445191-3445390 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP033247_7 3449122-3449339 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP033247_2 2.1|1680986|32|NZ_CP033247|PILER-CR 1680986-1681017 32 MN694669 Marine virus AFVG_250M354, complete genome 36383-36414 9 0.719
NZ_CP033247_2 2.3|1681125|32|NZ_CP033247|PILER-CR 1681125-1681156 32 MN694669 Marine virus AFVG_250M354, complete genome 36383-36414 9 0.719

1. spacer 2.1|1680986|32|NZ_CP033247|PILER-CR matches to MN694669 (Marine virus AFVG_250M354, complete genome) position: , mismatch: 9, identity: 0.719

taacgactgaaagaagttagcttcattaagaa	CRISPR spacer
taacgactgaaagtaggtagcttagtatcaca	Protospacer
************* ** ****** .*   . *

2. spacer 2.3|1681125|32|NZ_CP033247|PILER-CR matches to MN694669 (Marine virus AFVG_250M354, complete genome) position: , mismatch: 9, identity: 0.719

taacgactgaaagaagttagcttcattaagaa	CRISPR spacer
taacgactgaaagtaggtagcttagtatcaca	Protospacer
************* ** ****** .*   . *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 491156 : 544023 52 Clostridium_phage(27.27%) coat,tRNA,protease NA
DBSCAN-SWA_2 859119 : 923089 56 Bacillus_phage(42.86%) coat,transposase,tRNA,integrase attL 883801:883832|attR 923752:923783
DBSCAN-SWA_3 1136581 : 1222477 99 Clostridium_phage(21.62%) capsid,tRNA,protease,integrase,tail,terminase,portal attL 1132262:1132281|attR 1186387:1186406
DBSCAN-SWA_4 1611815 : 1660247 49 uncultured_Caudovirales_phage(20.0%) coat,transposase,integrase attL 1618239:1618254|attR 1638065:1638080
DBSCAN-SWA_5 2689146 : 2699174 7 Prochlorococcus_phage(42.86%) NA NA
DBSCAN-SWA_6 2832416 : 2854545 28 Clostridium_phage(36.36%) head,capsid,protease,integrase,tail,terminase,transposase,portal attL 2830903:2830961|attR 2854684:2854742
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage