Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP045421 Maribius sp. THAF1 plasmid pTHAF1_a, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP045420 Maribius sp. THAF1 chromosome, complete genome 1 crisprs RT,cas3,csa3,WYL,DEDDh 1 1 3 0

Results visualization

1. NZ_CP045420
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045420_1 2270448-2270675 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP045420_1 1.1|2270466|20|NZ_CP045420|CRT 2270466-2270485 20 NZ_CP045420.1 1874488-1874507 2 0.9

1. spacer 1.1|2270466|20|NZ_CP045420|CRT matches to position: 1874488-1874507, mismatch: 2, identity: 0.9

ggaagcttcatcggcggcga	CRISPR spacer
ggaggcgtcatcggcggcga	Protospacer
***.** *************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045420_1 1.4|2270591|28|NZ_CP045420|CRT 2270591-2270618 28 NC_013085 Synechococcus phage S-RSM4, complete genome 115937-115964 6 0.786
NZ_CP045420_1 1.4|2270591|28|NZ_CP045420|CRT 2270591-2270618 28 FM207411 Synechococcus phage S-RSM4 complete genome 115937-115964 6 0.786

1. spacer 1.4|2270591|28|NZ_CP045420|CRT matches to NC_013085 (Synechococcus phage S-RSM4, complete genome) position: , mismatch: 6, identity: 0.786

ccgccgtcccgaaattcagactgcaacc	CRISPR spacer
attccgtcccgtaattcagaatgcaaac	Protospacer
 . ******** ******** ***** *

2. spacer 1.4|2270591|28|NZ_CP045420|CRT matches to FM207411 (Synechococcus phage S-RSM4 complete genome) position: , mismatch: 6, identity: 0.786

ccgccgtcccgaaattcagactgcaacc	CRISPR spacer
attccgtcccgtaattcagaatgcaaac	Protospacer
 . ******** ******** ***** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 136143 : 190612 53 Virus_Rctr41k(28.57%) transposase,integrase attL 149756:149776|attR 196110:196130
DBSCAN-SWA_2 194680 : 232487 42 uncultured_Caudovirales_phage(22.22%) capsid,tRNA,protease,terminase,integrase,head,portal attL 222798:222821|attR 233919:233942
DBSCAN-SWA_3 1168960 : 1214219 48 Dinoroseobacter_phage(13.33%) capsid,tRNA,holin,protease,tail,head,portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage