Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP045371 Microbulbifer sp. THAF38 plasmid pTHAF38_b, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP045370 Microbulbifer sp. THAF38 plasmid pTHAF38_a, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP045369 Microbulbifer sp. THAF38 chromosome, complete genome 1 crisprs DEDDh,DinG,WYL,RT,csa3,cas3 1 0 8 0

Results visualization

1. NZ_CP045369
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045369_1 902504-902598 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP045369_1 1.1|902539|25|NZ_CP045369|CRISPRCasFinder 902539-902563 25 NZ_CP045369.1 902584-902608 2 0.92

1. spacer 1.1|902539|25|NZ_CP045369|CRISPRCasFinder matches to position: 902584-902608, mismatch: 2, identity: 0.92

caagaaaaaggaaggtaaatgcggc	CRISPR spacer
caagaaaaaagaaggtaagtgcggc	Protospacer
*********.********.******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 245531 : 288125 33 Vibrio_phage(33.33%) tRNA,transposase,protease,plate NA
DBSCAN-SWA_2 642717 : 663442 31 Vibrio_phage(31.25%) terminase,tail,capsid,head,protease,portal NA
DBSCAN-SWA_3 1114317 : 1187383 31 Tupanvirus(30.0%) holin,tRNA,transposase NA
DBSCAN-SWA_4 1881493 : 1918849 43 Pseudomonas_phage(38.46%) tRNA,portal,terminase,tail,head,protease,integrase attL 1873278:1873293|attR 1911429:1911444
DBSCAN-SWA_5 2232545 : 2304394 56 Mollivirus(16.67%) holin,protease,transposase,integrase attL 2227010:2227069|attR 2278284:2278958
DBSCAN-SWA_6 3056027 : 3079068 36 Vibrio_phage(22.22%) terminase NA
DBSCAN-SWA_7 4125750 : 4205426 77 Vibrio_phage(14.29%) tail,protease,transposase,plate NA
DBSCAN-SWA_8 4268868 : 4325632 49 Cafeteria_roenbergensis_virus(11.11%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage