Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP045262 Yersinia pestis strain SCPM-O-B-5942 (I-2638) plasmid pPCP, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP045261 Yersinia pestis strain SCPM-O-B-5942 (I-2638) plasmid pTP33, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP045259 Yersinia pestis strain SCPM-O-B-5942 (I-2638) plasmid pMT, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP045258 Yersinia pestis strain SCPM-O-B-5942 (I-2638) chromosome, complete genome 6 crisprs csa3,DEDDh,DinG,cas3,cas6f,cas7f,cas5f,cas8f,cas3f,cas1 4 10 11 1
NZ_CP045260 Yersinia pestis strain SCPM-O-B-5942 (I-2638) plasmid pCD, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP045260
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 43586 : 66468 19 Enterobacteria_phage(50.0%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP045259
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 97798 99 Salmonella_phage(79.49%) transposase,integrase,terminase,tail attL 13549:13566|attR 26607:26624
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP045258
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045258_1 205993-206105 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045258_2 2369677-2369885 Orphan I-F
3 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045258_3 2494831-2494952 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045258_4 2784892-2785399 TypeI-F I-F
8 spacers
cas1,cas3f,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045258_5 3395011-3395340 Orphan I-F
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045258_6 3827391-3827470 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP045258_4 4.7|2785280|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785280-2785311 32 NZ_CP045258.1 2002074-2002105 0 1.0
NZ_CP045258_4 4.8|2785340|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785340-2785371 32 NZ_CP045258.1 2028471-2028502 0 1.0
NZ_CP045258_5 5.1|3395039|32|NZ_CP045258|CRISPRCasFinder,CRT 3395039-3395070 32 NZ_CP045258.1 2007640-2007671 0 1.0
NZ_CP045258_5 5.5|3395281|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 3395281-3395312 32 NZ_CP045258.1 2006615-2006646 0 1.0

1. spacer 4.7|2785280|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to position: 2002074-2002105, mismatch: 0, identity: 1.0

aaaaagaatttgggattaaagttacccatcag	CRISPR spacer
aaaaagaatttgggattaaagttacccatcag	Protospacer
********************************

2. spacer 4.8|2785340|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to position: 2028471-2028502, mismatch: 0, identity: 1.0

ctgattctgctggaaatactttgatttatgaa	CRISPR spacer
ctgattctgctggaaatactttgatttatgaa	Protospacer
********************************

3. spacer 5.1|3395039|32|NZ_CP045258|CRISPRCasFinder,CRT matches to position: 2007640-2007671, mismatch: 0, identity: 1.0

tctgtacgcataccgccatcttgcatcagtct	CRISPR spacer
tctgtacgcataccgccatcttgcatcagtct	Protospacer
********************************

4. spacer 5.5|3395281|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to position: 2006615-2006646, mismatch: 0, identity: 1.0

aaaatcagagtcccagcctgacaggtggctaa	CRISPR spacer
aaaatcagagtcccagcctgacaggtggctaa	Protospacer
********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045258_5 5.1|3395039|32|NZ_CP045258|CRISPRCasFinder,CRT 3395039-3395070 32 MT374852 Yersinia phage vB_YpM_3, complete genome 12-43 0 1.0
NZ_CP045258_2 2.4|2369767|30|NZ_CP045258|PILER-CR 2369767-2369796 30 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 86944-86973 6 0.8
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 MK820641 Gordonia phage EnalisNailo, complete genome 34088-34119 6 0.812
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 MK878898 Gordonia phage Zameen, complete genome 34513-34544 6 0.812
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 MK919483 Gordonia phage Suscepit, complete genome 34514-34545 6 0.812
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 MK284520 Gordonia phage Lilas, complete genome 35799-35830 6 0.812
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 MK016492 Gordonia phage Bialota, complete genome 35265-35296 6 0.812
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 MK820642 Gordonia phage Polly, complete genome 33956-33987 6 0.812
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 NC_041883 Gordonia phage Attis, complete genome 31646-31677 6 0.812
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 MK814755 Gordonia phage Antonio, complete genome 34513-34544 6 0.812
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 MK875796 Gordonia phage Tayonia, complete genome 34513-34544 6 0.812
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 MK801734 Gordonia phage LordFarquaad, complete genome 31627-31658 6 0.812
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 MK433274 Gordonia phage Bradissa, complete genome 34554-34585 6 0.812
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 KU963257 Gordonia phage Kita, complete genome 34522-34553 6 0.812
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 NC_031251 Gordonia phage SoilAssassin, complete genome 31645-31676 6 0.812
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 NC_031097 Gordonia phage Zirinka, complete genome 35253-35284 6 0.812
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 NZ_CP005086 Sphingobium sp. TKS plasmid pTK2, complete sequence 138555-138586 6 0.812
NZ_CP045258_2 2.2|2369765|32|NZ_CP045258|CRISPRCasFinder,CRT 2369765-2369796 32 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 86942-86973 7 0.781
NZ_CP045258_2 2.4|2369767|30|NZ_CP045258|PILER-CR 2369767-2369796 30 NZ_CP010358 Acinetobacter johnsonii XBB1 plasmid pXBB1-8, complete sequence 46720-46749 7 0.767
NZ_CP045258_2 2.4|2369767|30|NZ_CP045258|PILER-CR 2369767-2369796 30 MT774386 CrAssphage cr110_1, complete genome 42858-42887 7 0.767
NZ_CP045258_4 4.1|2784920|32|NZ_CP045258|CRISPRCasFinder,CRT 2784920-2784951 32 CP049262 Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence 69636-69667 7 0.781
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 JF974294 Aeromonas phage pIS4-A genomic sequence 21965-21996 7 0.781
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 NC_021534 Vibrio phage pYD38-A genomic sequence 3299-3330 7 0.781
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 440819-440850 7 0.781
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 282870-282901 7 0.781
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 KJ433975 Mycobacterium phage 40BC, complete genome 23231-23262 7 0.781
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 KJ433973 Mycobacterium phage 39HC, complete genome 23231-23262 7 0.781
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 NC_024145 Mycobacterium phage Hosp, complete genome 21427-21458 7 0.781
NZ_CP045258_2 2.2|2369765|32|NZ_CP045258|CRISPRCasFinder,CRT 2369765-2369796 32 NZ_CP010358 Acinetobacter johnsonii XBB1 plasmid pXBB1-8, complete sequence 46720-46751 8 0.75
NZ_CP045258_2 2.2|2369765|32|NZ_CP045258|CRISPRCasFinder,CRT 2369765-2369796 32 NC_019694 Oscillatoria acuminata PCC 6304 plasmid pOSCIL6304.02, complete sequence 20911-20942 8 0.75
NZ_CP045258_2 2.4|2369767|30|NZ_CP045258|PILER-CR 2369767-2369796 30 NZ_CP028934 Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence 25851-25880 8 0.733
NZ_CP045258_2 2.4|2369767|30|NZ_CP045258|PILER-CR 2369767-2369796 30 NC_019694 Oscillatoria acuminata PCC 6304 plasmid pOSCIL6304.02, complete sequence 20911-20940 8 0.733
NZ_CP045258_4 4.6|2785220|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785220-2785251 32 NZ_CP024873 Leptospira mayottensis 200901116 plasmid p1_L200901116, complete sequence 14979-15010 8 0.75
NZ_CP045258_4 4.7|2785280|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785280-2785311 32 NZ_CP047125 Lactobacillus hilgardii strain FLUB plasmid unnamed4 1912-1943 8 0.75
NZ_CP045258_2 2.2|2369765|32|NZ_CP045258|CRISPRCasFinder,CRT 2369765-2369796 32 MT774386 CrAssphage cr110_1, complete genome 42858-42889 9 0.719
NZ_CP045258_2 2.2|2369765|32|NZ_CP045258|CRISPRCasFinder,CRT 2369765-2369796 32 NZ_CP028934 Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence 25849-25880 9 0.719
NZ_CP045258_2 2.4|2369767|30|NZ_CP045258|PILER-CR 2369767-2369796 30 MK415408 CrAssphage GF1-2_000079F, complete genome 71106-71135 9 0.7
NZ_CP045258_4 4.2|2784980|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2784980-2785011 32 NZ_CP031943 Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence 4006-4037 9 0.719
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 MF679145 Escherichia coli plasmid pBJ114-96, complete sequence 37586-37617 9 0.719
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 60831-60862 9 0.719
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 NZ_CP021340 Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence 67671-67702 9 0.719
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 NZ_CP021336 Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence 67672-67703 9 0.719
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 NZ_CP040920 Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence 33435-33466 9 0.719
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 NZ_CP024832 Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence 33830-33861 9 0.719
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 NZ_CP024817 Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence 62769-62800 9 0.719
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 15616-15647 9 0.719
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 112580-112611 9 0.719
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 NZ_CP023961 Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence 16858-16889 9 0.719
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 AP023222 Escherichia coli M505 plasmid pM505-b DNA, complete genome 93734-93765 9 0.719
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 AP023233 Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome 47570-47601 9 0.719
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 NZ_CP019075 Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence 16520-16551 9 0.719
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 NZ_CP015837 Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence 3287-3318 9 0.719
NZ_CP045258_4 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785040-2785071 32 NZ_CP011063 Escherichia coli str. Sanji plasmid pSJ_98, complete sequence 37637-37668 9 0.719
NZ_CP045258_5 5.2|3395099|33|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 3395099-3395131 33 NZ_CP040366 Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence 923-955 9 0.727
NZ_CP045258_4 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785100-2785131 32 NZ_JX627581 Methylobacterium oryzae CBMB20 plasmid pMOC2, complete sequence 30496-30527 10 0.688
NZ_CP045258_4 4.6|2785220|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785220-2785251 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 815356-815387 11 0.656
NZ_CP045258_4 4.6|2785220|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785220-2785251 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 820287-820318 11 0.656
NZ_CP045258_4 4.6|2785220|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785220-2785251 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2180994-2181025 11 0.656
NZ_CP045258_4 4.6|2785220|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR 2785220-2785251 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2185925-2185956 11 0.656

1. spacer 5.1|3395039|32|NZ_CP045258|CRISPRCasFinder,CRT matches to MT374852 (Yersinia phage vB_YpM_3, complete genome) position: , mismatch: 0, identity: 1.0

tctgtacgcataccgccatcttgcatcagtct	CRISPR spacer
tctgtacgcataccgccatcttgcatcagtct	Protospacer
********************************

2. spacer 2.4|2369767|30|NZ_CP045258|PILER-CR matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 6, identity: 0.8

aagttctttttgtcagcatctttaataaat	CRISPR spacer
ataatctttttatcagcatcttttataatt	Protospacer
* . *******.*********** **** *

3. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to MK820641 (Gordonia phage EnalisNailo, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

4. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to MK878898 (Gordonia phage Zameen, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

5. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to MK919483 (Gordonia phage Suscepit, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

6. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to MK284520 (Gordonia phage Lilas, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

7. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to MK016492 (Gordonia phage Bialota, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

8. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to MK820642 (Gordonia phage Polly, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

9. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NC_041883 (Gordonia phage Attis, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

10. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to MK814755 (Gordonia phage Antonio, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

11. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to MK875796 (Gordonia phage Tayonia, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

12. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to MK801734 (Gordonia phage LordFarquaad, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

13. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to MK433274 (Gordonia phage Bradissa, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

14. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to KU963257 (Gordonia phage Kita, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

15. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NC_031251 (Gordonia phage SoilAssassin, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

16. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NC_031097 (Gordonia phage Zirinka, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

17. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 6, identity: 0.812

tcgccattccgtgaacctgagcgcgttcgcga--	CRISPR spacer
tcgcctttccctgaacctga--gcgatcgtgacc	Protospacer
***** **** *********  *** ***.**  

18. spacer 2.2|2369765|32|NZ_CP045258|CRISPRCasFinder,CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 7, identity: 0.781

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
taataatctttttatcagcatcttttataatt	Protospacer
* * . *******.*********** **** *

19. spacer 2.4|2369767|30|NZ_CP045258|PILER-CR matches to NZ_CP010358 (Acinetobacter johnsonii XBB1 plasmid pXBB1-8, complete sequence) position: , mismatch: 7, identity: 0.767

aagttctttttgtcagcatctttaataaat	CRISPR spacer
gccatattttcgtcagcatcattaataaat	Protospacer
.   * ****.********* *********

20. spacer 2.4|2369767|30|NZ_CP045258|PILER-CR matches to MT774386 (CrAssphage cr110_1, complete genome) position: , mismatch: 7, identity: 0.767

aagttctttttgtcagcatctttaataaat	CRISPR spacer
agtttctttttatcagcatcttcaatagca	Protospacer
*. ********.**********.****.  

21. spacer 4.1|2784920|32|NZ_CP045258|CRISPRCasFinder,CRT matches to CP049262 (Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence) position: , mismatch: 7, identity: 0.781

tcaggggactggcgaacaatgtctttcatgat	CRISPR spacer
acgtcgcgctggcgaacaatctctttcatgat	Protospacer
 *.  * .************ ***********

22. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to JF974294 (Aeromonas phage pIS4-A genomic sequence) position: , mismatch: 7, identity: 0.781

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attacctgaatggcatttgctttatgcctgat	Protospacer
****.************* ****.   * ***

23. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NC_021534 (Vibrio phage pYD38-A genomic sequence) position: , mismatch: 7, identity: 0.781

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attacctgaatggcatttgctttatgcctgat	Protospacer
****.************* ****.   * ***

24. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

----tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
cacctcgc----tcgggaacctgggcgcgttcgcga	Protospacer
    ****    .** *******.************

25. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.781

----tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
cacctcgc----tcgggaacctgggcgcgttcgcga	Protospacer
    ****    .** *******.************

26. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to KJ433975 (Mycobacterium phage 40BC, complete genome) position: , mismatch: 7, identity: 0.781

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
cccgccg-cccgtgtacccgagcgcgttcgcgc	Protospacer
 .****. .***** ***.************* 

27. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to KJ433973 (Mycobacterium phage 39HC, complete genome) position: , mismatch: 7, identity: 0.781

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
cccgccg-cccgtgtacccgagcgcgttcgcgc	Protospacer
 .****. .***** ***.************* 

28. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 7, identity: 0.781

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
cccgccg-cccgtgtacccgagcgcgttcgcgc	Protospacer
 .****. .***** ***.************* 

29. spacer 2.2|2369765|32|NZ_CP045258|CRISPRCasFinder,CRT matches to NZ_CP010358 (Acinetobacter johnsonii XBB1 plasmid pXBB1-8, complete sequence) position: , mismatch: 8, identity: 0.75

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
gtgccatattttcgtcagcatcattaataaat	Protospacer
 *.   * ****.********* *********

30. spacer 2.2|2369765|32|NZ_CP045258|CRISPRCasFinder,CRT matches to NC_019694 (Oscillatoria acuminata PCC 6304 plasmid pOSCIL6304.02, complete sequence) position: , mismatch: 8, identity: 0.75

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
ttgatgctcttttggcagcttctttaataaat	Protospacer
**.*  ...***** **** ************

31. spacer 2.4|2369767|30|NZ_CP045258|PILER-CR matches to NZ_CP028934 (Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence) position: , mismatch: 8, identity: 0.733

aagttctttttgtcagcatctttaataaat	CRISPR spacer
actttctttttgtcagcgtctgtaatgtgc	Protospacer
*  **************.*** ****. ..

32. spacer 2.4|2369767|30|NZ_CP045258|PILER-CR matches to NC_019694 (Oscillatoria acuminata PCC 6304 plasmid pOSCIL6304.02, complete sequence) position: , mismatch: 8, identity: 0.733

aagttctttttgtcagcatctttaataaat	CRISPR spacer
gatgctcttttggcagcttctttaataaat	Protospacer
.*  ...***** **** ************

33. spacer 4.6|2785220|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024873 (Leptospira mayottensis 200901116 plasmid p1_L200901116, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtcaaacaaatttaggcgacgatttaaca	CRISPR spacer
ttactcaaacaagttgaggcgacgattctaaa	Protospacer
*.. ********.** ***********. * *

34. spacer 4.7|2785280|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047125 (Lactobacillus hilgardii strain FLUB plasmid unnamed4) position: , mismatch: 8, identity: 0.75

aaaaagaatttgggattaaagttacccatcag	CRISPR spacer
taaaagcttttgggattaaagttattcaaaat	Protospacer
 *****  ****************..**  * 

35. spacer 2.2|2369765|32|NZ_CP045258|CRISPRCasFinder,CRT matches to MT774386 (CrAssphage cr110_1, complete genome) position: , mismatch: 9, identity: 0.719

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
caagtttctttttatcagcatcttcaatagca	Protospacer
. *. ********.**********.****.  

36. spacer 2.2|2369765|32|NZ_CP045258|CRISPRCasFinder,CRT matches to NZ_CP028934 (Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence) position: , mismatch: 9, identity: 0.719

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
taactttctttttgtcagcgtctgtaatgtgc	Protospacer
* *  **************.*** ****. ..

37. spacer 2.4|2369767|30|NZ_CP045258|PILER-CR matches to MK415408 (CrAssphage GF1-2_000079F, complete genome) position: , mismatch: 9, identity: 0.7

aagttctttttgtcagcatctttaataaat	CRISPR spacer
ataagacttttatcagcatctttaataatc	Protospacer
* .   .****.**************** .

38. spacer 4.2|2784980|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031943 (Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

gaaaaggtaagatgggcaagcttctagtagtt	CRISPR spacer
ttatgagaaagatgggcaagcttttagtggta	Protospacer
  * ..* ***************.****.** 

39. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to MF679145 (Escherichia coli plasmid pBJ114-96, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

40. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

41. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021340 (Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

42. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021336 (Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

43. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040920 (Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

44. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024832 (Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

45. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024817 (Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

46. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

47. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat-----	CRISPR spacer
attatctgattggcagtttctttaac-----tgttta	Protospacer
********* ***** *******..*     *     

48. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023961 (Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

49. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to AP023222 (Escherichia coli M505 plasmid pM505-b DNA, complete genome) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

50. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to AP023233 (Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

51. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019075 (Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

52. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015837 (Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

53. spacer 4.3|2785040|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011063 (Escherichia coli str. Sanji plasmid pSJ_98, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

54. spacer 5.2|3395099|33|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040366 (Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence) position: , mismatch: 9, identity: 0.727

agcaaaaatcttaattacatctgatgatttcgg	CRISPR spacer
ggaaaaaaacttaattacatctgataatccatt	Protospacer
.* ***** ****************.**..   

55. spacer 4.4|2785100|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_JX627581 (Methylobacterium oryzae CBMB20 plasmid pMOC2, complete sequence) position: , mismatch: 10, identity: 0.688

tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
ctaacgagccgtgaacctcagcgcattcgcgt	Protospacer
... *.  ********** *****.****** 

56. spacer 4.6|2785220|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 11, identity: 0.656

tcggtcaaacaaatttaggcgacgatttaaca	CRISPR spacer
gtggtcaaacaaatttaggcaaggagccgctg	Protospacer
 .******************.* ** ... ..

57. spacer 4.6|2785220|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 11, identity: 0.656

tcggtcaaacaaatttaggcgacgatttaaca	CRISPR spacer
gtggtcaaacaaatttaggcaaggagccgctg	Protospacer
 .******************.* ** ... ..

58. spacer 4.6|2785220|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 11, identity: 0.656

tcggtcaaacaaatttaggcgacgatttaaca	CRISPR spacer
gtggtcaaacaaatttaggcaaggagccgctg	Protospacer
 .******************.* ** ... ..

59. spacer 4.6|2785220|32|NZ_CP045258|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 11, identity: 0.656

tcggtcaaacaaatttaggcgacgatttaaca	CRISPR spacer
gtggtcaaacaaatttaggcaaggagccgctg	Protospacer
 .******************.* ** ... ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 384292 : 451721 51 Escherichia_phage(40.0%) transposase NA
DBSCAN-SWA_2 877852 : 973929 56 Escherichia_phage(50.0%) protease,tRNA,transposase,plate NA
DBSCAN-SWA_3 1396902 : 1478646 70 Pseudomonas_phage(17.86%) plate,protease,tail,transposase,coat NA
DBSCAN-SWA_4 1531964 : 1575622 36 Escherichia_phage(14.29%) protease,transposase,coat NA
DBSCAN-SWA_5 1979751 : 2080026 102 Escherichia_phage(14.81%) lysis,integrase,tail,tRNA,transposase attL 1990303:1990333|attR 2031317:2031347
DBSCAN-SWA_6 2412357 : 2456875 36 Indivirus(14.29%) lysis,tRNA,transposase,plate NA
DBSCAN-SWA_7 2481738 : 2548858 56 Streptococcus_phage(20.0%) tRNA,protease,plate,transposase NA
DBSCAN-SWA_8 2919483 : 2989377 60 Escherichia_phage(25.0%) tRNA,transposase,plate NA
DBSCAN-SWA_9 3402748 : 3448119 46 Escherichia_phage(22.22%) tRNA,protease,integrase,transposase attL 3418493:3418507|attR 3446078:3446092
DBSCAN-SWA_10 3915585 : 3991519 56 Escherichia_phage(20.0%) plate,transposase NA
DBSCAN-SWA_11 4119628 : 4185596 60 Escherichia_phage(12.5%) protease,plate,transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP045258.1|WP_002214494.1|2035654_2036011_+|hypothetical-protein 2035654_2036011_+ 118 aa aa NA HTH_GNTR NA 1979751-2080026 yes
4. NZ_CP045261
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7636 : 33627 34 Haemophilus_phage(40.74%) holin,integrase,tail,terminase,plate attL 4156:4170|attR 13870:13884
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage