Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP045155 Yersinia pestis strain SCPM-O-B-5935 (I-1996) plasmid pMT, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP045157 Yersinia pestis strain SCPM-O-B-5935 (I-1996) plasmid pPCP, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP045154 Yersinia pestis strain SCPM-O-B-5935 (I-1996) chromosome, complete genome 5 crisprs csa3,cas3,DinG,DEDDh,cas6f,cas7f,cas5f,cas8f,cas3f,cas1 1 10 13 1
NZ_CP045156 Yersinia pestis strain SCPM-O-B-5935 (I-1996) plasmid pCD, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP045155
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 96100 95 Salmonella_phage(78.38%) integrase,terminase,tail,transposase attL 13549:13566|attR 26607:26624
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP045154
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045154_1 259346-259458 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045154_2 1429754-1430023 Orphan I-F
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045154_3 1986282-1986403 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045154_4 2112086-2112293 Orphan I-F
3 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045154_5 3088686-3088895 TypeI-F I-F
3 spacers
cas1,cas3f,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP045154_2 2.8|1429964|32|NZ_CP045154|CRISPRCasFinder,CRT 1429964-1429995 32 NZ_CP045154.1 2549031-2549062 0 1.0

1. spacer 2.8|1429964|32|NZ_CP045154|CRISPRCasFinder,CRT matches to position: 2549031-2549062, mismatch: 0, identity: 1.0

agactgatgcaagatggcggtatgcgtacaga	CRISPR spacer
agactgatgcaagatggcggtatgcgtacaga	Protospacer
********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045154_2 2.8|1429964|32|NZ_CP045154|CRISPRCasFinder,CRT 1429964-1429995 32 MT374852 Yersinia phage vB_YpM_3, complete genome 12-43 0 1.0
NZ_CP045154_2 2.4|1429962|34|NZ_CP045154|PILER-CR 1429962-1429995 34 MT374852 Yersinia phage vB_YpM_3, complete genome 10-43 1 0.971
NZ_CP045154_4 4.2|2112174|32|NZ_CP045154|PILER-CR,CRISPRCasFinder,CRT 2112174-2112205 32 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 86942-86973 7 0.781
NZ_CP045154_5 5.1|3088715|31|NZ_CP045154|CRISPRCasFinder,CRT 3088715-3088745 31 CP049262 Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence 69637-69667 7 0.774
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 NC_021534 Vibrio phage pYD38-A genomic sequence 3299-3329 7 0.774
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 JF974294 Aeromonas phage pIS4-A genomic sequence 21966-21996 7 0.774
NZ_CP045154_5 5.4|3088776|30|NZ_CP045154|PILER-CR 3088776-3088805 30 NZ_CP031943 Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence 4007-4036 7 0.767
NZ_CP045154_5 5.5|3088836|30|NZ_CP045154|PILER-CR 3088836-3088865 30 NZ_CP013487 Vibrio alginolyticus strain ATCC 33787 plasmid pMBL287, complete sequence 166773-166802 7 0.767
NZ_CP045154_4 4.2|2112174|32|NZ_CP045154|PILER-CR,CRISPRCasFinder,CRT 2112174-2112205 32 NZ_CP010358 Acinetobacter johnsonii XBB1 plasmid pXBB1-8, complete sequence 46720-46751 8 0.75
NZ_CP045154_4 4.2|2112174|32|NZ_CP045154|PILER-CR,CRISPRCasFinder,CRT 2112174-2112205 32 NC_019694 Oscillatoria acuminata PCC 6304 plasmid pOSCIL6304.02, complete sequence 20911-20942 8 0.75
NZ_CP045154_5 5.2|3088775|31|NZ_CP045154|CRISPRCasFinder,CRT 3088775-3088805 31 NZ_CP031943 Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence 4007-4037 8 0.742
NZ_CP045154_2 2.7|1429903|33|NZ_CP045154|CRISPRCasFinder,CRT 1429903-1429935 33 NZ_CP040366 Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence 923-955 9 0.727
NZ_CP045154_4 4.2|2112174|32|NZ_CP045154|PILER-CR,CRISPRCasFinder,CRT 2112174-2112205 32 MT774386 CrAssphage cr110_1, complete genome 42858-42889 9 0.719
NZ_CP045154_4 4.2|2112174|32|NZ_CP045154|PILER-CR,CRISPRCasFinder,CRT 2112174-2112205 32 NZ_CP028934 Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence 25849-25880 9 0.719
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 MF679145 Escherichia coli plasmid pBJ114-96, complete sequence 37586-37616 9 0.71
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 60831-60861 9 0.71
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 NZ_CP021340 Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence 67671-67701 9 0.71
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 NZ_CP021336 Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence 67672-67702 9 0.71
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 NZ_CP024832 Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence 33830-33860 9 0.71
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 NZ_CP024817 Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence 62769-62799 9 0.71
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 15616-15646 9 0.71
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 112580-112610 9 0.71
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 NZ_CP023961 Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence 16858-16888 9 0.71
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 AP023233 Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome 47570-47600 9 0.71
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 NZ_CP019075 Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence 16520-16550 9 0.71
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 NZ_CP015837 Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence 3287-3317 9 0.71
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 NZ_CP011063 Escherichia coli str. Sanji plasmid pSJ_98, complete sequence 37637-37667 9 0.71
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 NZ_CP040920 Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence 33436-33466 9 0.71
NZ_CP045154_5 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT 3088835-3088865 31 AP023222 Escherichia coli M505 plasmid pM505-b DNA, complete genome 93735-93765 9 0.71
NZ_CP045154_5 5.4|3088776|30|NZ_CP045154|PILER-CR 3088776-3088805 30 AP014500 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S32-C79, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces 26487-26516 9 0.7
NZ_CP045154_2 2.3|1429901|35|NZ_CP045154|PILER-CR 1429901-1429935 35 NZ_CP040366 Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence 923-957 10 0.714

1. spacer 2.8|1429964|32|NZ_CP045154|CRISPRCasFinder,CRT matches to MT374852 (Yersinia phage vB_YpM_3, complete genome) position: , mismatch: 0, identity: 1.0

agactgatgcaagatggcggtatgcgtacaga	CRISPR spacer
agactgatgcaagatggcggtatgcgtacaga	Protospacer
********************************

2. spacer 2.4|1429962|34|NZ_CP045154|PILER-CR matches to MT374852 (Yersinia phage vB_YpM_3, complete genome) position: , mismatch: 1, identity: 0.971

aaagactgatgcaagatggcggtatgcgtacaga	CRISPR spacer
caagactgatgcaagatggcggtatgcgtacaga	Protospacer
 *********************************

3. spacer 4.2|2112174|32|NZ_CP045154|PILER-CR,CRISPRCasFinder,CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 7, identity: 0.781

atttattaaagatgctgacaaaaagaacttaa	CRISPR spacer
aattataaaagatgctgataaaaagattatta	Protospacer
* **** ***********.******* . * *

4. spacer 5.1|3088715|31|NZ_CP045154|CRISPRCasFinder,CRT matches to CP049262 (Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence) position: , mismatch: 7, identity: 0.774

tcaggggactggcgaacaatgtctttcatga	CRISPR spacer
acgtcgcgctggcgaacaatctctttcatga	Protospacer
 *.  * .************ **********

5. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to NC_021534 (Vibrio phage pYD38-A genomic sequence) position: , mismatch: 7, identity: 0.774

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attacctgaatggcatttgctttatgcctga	Protospacer
****.************* ****.   * **

6. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to JF974294 (Aeromonas phage pIS4-A genomic sequence) position: , mismatch: 7, identity: 0.774

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attacctgaatggcatttgctttatgcctga	Protospacer
****.************* ****.   * **

7. spacer 5.4|3088776|30|NZ_CP045154|PILER-CR matches to NZ_CP031943 (Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

aaaaggtaagatgggcaagcttctagtagt	CRISPR spacer
tatgagaaagatgggcaagcttttagtggt	Protospacer
 * ..* ***************.****.**

8. spacer 5.5|3088836|30|NZ_CP045154|PILER-CR matches to NZ_CP013487 (Vibrio alginolyticus strain ATCC 33787 plasmid pMBL287, complete sequence) position: , mismatch: 7, identity: 0.767

ttatctgaatggcattttctttggcgcaga	CRISPR spacer
cttgttcagtggcattttctttggcacaga	Protospacer
.*  .* *.****************.****

9. spacer 4.2|2112174|32|NZ_CP045154|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010358 (Acinetobacter johnsonii XBB1 plasmid pXBB1-8, complete sequence) position: , mismatch: 8, identity: 0.75

atttattaaagatgctgacaaaaagaacttaa	CRISPR spacer
atttattaatgatgctgacgaaaatatggcac	Protospacer
********* *********.**** *   .* 

10. spacer 4.2|2112174|32|NZ_CP045154|PILER-CR,CRISPRCasFinder,CRT matches to NC_019694 (Oscillatoria acuminata PCC 6304 plasmid pOSCIL6304.02, complete sequence) position: , mismatch: 8, identity: 0.75

atttattaaagatgctgacaaaaagaacttaa	CRISPR spacer
atttattaaagaagctgccaaaagagcatcaa	Protospacer
************ **** *****...  *.**

11. spacer 5.2|3088775|31|NZ_CP045154|CRISPRCasFinder,CRT matches to NZ_CP031943 (Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.742

gaaaaggtaagatgggcaagcttctagtagt	CRISPR spacer
ttatgagaaagatgggcaagcttttagtggt	Protospacer
  * ..* ***************.****.**

12. spacer 2.7|1429903|33|NZ_CP045154|CRISPRCasFinder,CRT matches to NZ_CP040366 (Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence) position: , mismatch: 9, identity: 0.727

ccgaaatcatcagatgtaattaagatttttgct	CRISPR spacer
aatggattatcagatgtaattaagtttttttcc	Protospacer
   ..**.**************** ***** *.

13. spacer 4.2|2112174|32|NZ_CP045154|PILER-CR,CRISPRCasFinder,CRT matches to MT774386 (CrAssphage cr110_1, complete genome) position: , mismatch: 9, identity: 0.719

atttattaaagatgctgacaaaaagaacttaa	CRISPR spacer
tgctattgaagatgctgataaaaagaaacttg	Protospacer
  .****.**********.******** .* .

14. spacer 4.2|2112174|32|NZ_CP045154|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028934 (Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence) position: , mismatch: 9, identity: 0.719

atttattaaagatgctgacaaaaagaacttaa	CRISPR spacer
gcacattacagacgctgacaaaaagaaagtta	Protospacer
.. .**** ***.**************  * *

15. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to MF679145 (Escherichia coli plasmid pBJ114-96, complete sequence) position: , mismatch: 9, identity: 0.71

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attatctgattggcagtttctttaactgttt	Protospacer
********* ***** *******..*     

16. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 9, identity: 0.71

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attatctgattggcagtttctttaactgttt	Protospacer
********* ***** *******..*     

17. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to NZ_CP021340 (Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence) position: , mismatch: 9, identity: 0.71

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attatctgattggcagtttctttaactgttt	Protospacer
********* ***** *******..*     

18. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to NZ_CP021336 (Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence) position: , mismatch: 9, identity: 0.71

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attatctgattggcagtttctttaactgttt	Protospacer
********* ***** *******..*     

19. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to NZ_CP024832 (Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence) position: , mismatch: 9, identity: 0.71

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attatctgattggcagtttctttaactgttt	Protospacer
********* ***** *******..*     

20. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to NZ_CP024817 (Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence) position: , mismatch: 9, identity: 0.71

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attatctgattggcagtttctttaactgttt	Protospacer
********* ***** *******..*     

21. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 9, identity: 0.71

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attatctgattggcagtttctttaactgttt	Protospacer
********* ***** *******..*     

22. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 9, identity: 0.71

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attatctgattggcagtttctttaactgttt	Protospacer
********* ***** *******..*     

23. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to NZ_CP023961 (Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attatctgattggcagtttctttaactgttt	Protospacer
********* ***** *******..*     

24. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to AP023233 (Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome) position: , mismatch: 9, identity: 0.71

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attatctgattggcagtttctttaactgttt	Protospacer
********* ***** *******..*     

25. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to NZ_CP019075 (Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence) position: , mismatch: 9, identity: 0.71

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attatctgattggcagtttctttaactgttt	Protospacer
********* ***** *******..*     

26. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to NZ_CP015837 (Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence) position: , mismatch: 9, identity: 0.71

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attatctgattggcagtttctttaactgttt	Protospacer
********* ***** *******..*     

27. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to NZ_CP011063 (Escherichia coli str. Sanji plasmid pSJ_98, complete sequence) position: , mismatch: 9, identity: 0.71

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attatctgattggcagtttctttaactgttt	Protospacer
********* ***** *******..*     

28. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to NZ_CP040920 (Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence) position: , mismatch: 9, identity: 0.71

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attatctgattggcagtttctttaactgttt	Protospacer
********* ***** *******..*     

29. spacer 5.3|3088835|31|NZ_CP045154|CRISPRCasFinder,CRT matches to AP023222 (Escherichia coli M505 plasmid pM505-b DNA, complete genome) position: , mismatch: 9, identity: 0.71

attatctgaatggcattttctttggcgcaga	CRISPR spacer
attatctgattggcagtttctttaactgttt	Protospacer
********* ***** *******..*     

30. spacer 5.4|3088776|30|NZ_CP045154|PILER-CR matches to AP014500 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S32-C79, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 9, identity: 0.7

aaaaggtaagatgggcaagcttctagtagt	CRISPR spacer
gttgtagaagatgtgcaagcttctagtaat	Protospacer
.  . . ****** **************.*

31. spacer 2.3|1429901|35|NZ_CP045154|PILER-CR matches to NZ_CP040366 (Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence) position: , mismatch: 10, identity: 0.714

aaccgaaatcatcagatgtaattaagatttttgct	CRISPR spacer
ataatggattatcagatgtaattaagtttttttcc	Protospacer
*    ..**.**************** ***** *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 438042 : 510633 58 Escherichia_phage(25.0%) transposase NA
DBSCAN-SWA_2 627733 : 690092 46 Bodo_saltans_virus(16.67%) plate,tRNA,transposase NA
DBSCAN-SWA_3 1222713 : 1267349 38 uncultured_Mediterranean_phage(23.08%) tRNA,transposase,holin NA
DBSCAN-SWA_4 1367590 : 1422345 54 uncultured_virus(20.0%) integrase,tRNA,transposase,protease attL 1362928:1362946|attR 1438956:1438974
DBSCAN-SWA_5 1704423 : 1749782 39 Pseudomonas_phage(25.0%) transposase,coat,plate,tail,protease NA
DBSCAN-SWA_6 1872642 : 2034842 120 Escherichia_phage(15.62%) plate,protease,tRNA,transposase NA
DBSCAN-SWA_7 2521142 : 2621628 104 Escherichia_phage(14.81%) transposase,lysis,integrase,tRNA,tail attL 2531694:2531724|attR 2572708:2572738
DBSCAN-SWA_8 2885123 : 2943890 52 Tupanvirus(18.18%) tRNA,transposase,protease,coat NA
DBSCAN-SWA_9 3222365 : 3292391 60 uncultured_virus(22.22%) plate,tRNA,transposase NA
DBSCAN-SWA_10 3427737 : 3504175 59 Bacillus_phage(18.75%) tRNA,transposase,holin NA
DBSCAN-SWA_11 3573889 : 3580061 8 Escherichia_phage(33.33%) transposase NA
DBSCAN-SWA_12 3820059 : 3895410 54 Staphylococcus_phage(25.0%) plate,protease,tRNA,transposase NA
DBSCAN-SWA_13 4230023 : 4292459 55 uncultured_Mediterranean_phage(18.18%) tail,protease,transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP045154.1|WP_002214494.1|2577045_2577402_+|hypothetical-protein 2577045_2577402_+ 118 aa aa NA HTH_GNTR NA 2521142-2621628 yes
3. NZ_CP045156
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 43798 : 66770 20 Enterobacteria_phage(50.0%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage