Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP045150 Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pMT, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP045149 Yersinia pestis strain SCPM-O-DNA-18 (I-3113) chromosome, complete genome 5 crisprs csa3,cas3,cas1,cas3f,cas8f,cas5f,cas7f,cas6f,DEDDh,DinG 3 13 12 1
NZ_CP045152 Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pTP33, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP045151 Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pCD, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP045153 Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pPCP, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP045150
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 57063 58 Salmonella_phage(63.16%) integrase,transposase,tail attL 13549:13566|attR 26607:26624
DBSCAN-SWA_2 60334 : 97798 40 Salmonella_phage(94.87%) tail,transposase,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP045149
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045149_1 55859-55971 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045149_2 1020478-1020747 Orphan I-F
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045149_3 1629678-1630185 TypeI-F I-F
8 spacers
cas1,cas3f,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045149_4 2508718-2508927 Orphan I-F
3 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045149_5 2633874-2633995 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP045149_2 2.8|1020688|32|NZ_CP045149|CRISPRCasFinder,CRT 1020688-1020719 32 NZ_CP045149.1 2172107-2172138 0 1.0
NZ_CP045149_3 3.1|1629706|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629706-1629737 32 NZ_CP045149.1 2173421-2173452 0 1.0
NZ_CP045149_3 3.2|1629766|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629766-1629797 32 NZ_CP045149.1 2177672-2177703 0 1.0

1. spacer 2.8|1020688|32|NZ_CP045149|CRISPRCasFinder,CRT matches to position: 2172107-2172138, mismatch: 0, identity: 1.0

agactgatgcaagatggcggtatgcgtacaga	CRISPR spacer
agactgatgcaagatggcggtatgcgtacaga	Protospacer
********************************

2. spacer 3.1|1629706|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to position: 2173421-2173452, mismatch: 0, identity: 1.0

atgccaagaacagaggtagatgcagcctgatc	CRISPR spacer
atgccaagaacagaggtagatgcagcctgatc	Protospacer
********************************

3. spacer 3.2|1629766|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to position: 2177672-2177703, mismatch: 0, identity: 1.0

ctgatgggtaactttaatcccaaattcttttt	CRISPR spacer
ctgatgggtaactttaatcccaaattcttttt	Protospacer
********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045149_2 2.8|1020688|32|NZ_CP045149|CRISPRCasFinder,CRT 1020688-1020719 32 MT374852 Yersinia phage vB_YpM_3, complete genome 12-43 0 1.0
NZ_CP045149_2 2.4|1020686|34|NZ_CP045149|PILER-CR 1020686-1020719 34 MT374852 Yersinia phage vB_YpM_3, complete genome 10-43 1 0.971
NZ_CP045149_4 4.4|2508810|28|NZ_CP045149|PILER-CR 2508810-2508837 28 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 86944-86971 5 0.821
NZ_CP045149_4 4.4|2508810|28|NZ_CP045149|PILER-CR 2508810-2508837 28 MT774386 CrAssphage cr110_1, complete genome 42860-42887 5 0.821
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 MK820641 Gordonia phage EnalisNailo, complete genome 34088-34119 6 0.812
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 MK878898 Gordonia phage Zameen, complete genome 34513-34544 6 0.812
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 MK919483 Gordonia phage Suscepit, complete genome 34514-34545 6 0.812
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 MK284520 Gordonia phage Lilas, complete genome 35799-35830 6 0.812
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 MK016492 Gordonia phage Bialota, complete genome 35265-35296 6 0.812
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 MK820642 Gordonia phage Polly, complete genome 33956-33987 6 0.812
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 NC_041883 Gordonia phage Attis, complete genome 31646-31677 6 0.812
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 MK814755 Gordonia phage Antonio, complete genome 34513-34544 6 0.812
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 MK875796 Gordonia phage Tayonia, complete genome 34513-34544 6 0.812
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 MK801734 Gordonia phage LordFarquaad, complete genome 31627-31658 6 0.812
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 MK433274 Gordonia phage Bradissa, complete genome 34554-34585 6 0.812
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 KU963257 Gordonia phage Kita, complete genome 34522-34553 6 0.812
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 NC_031251 Gordonia phage SoilAssassin, complete genome 31645-31676 6 0.812
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 NC_031097 Gordonia phage Zirinka, complete genome 35253-35284 6 0.812
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 NZ_CP005086 Sphingobium sp. TKS plasmid pTK2, complete sequence 138555-138586 6 0.812
NZ_CP045149_4 4.4|2508810|28|NZ_CP045149|PILER-CR 2508810-2508837 28 NZ_CP028934 Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence 25851-25878 6 0.786
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 440819-440850 7 0.781
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 282870-282901 7 0.781
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 KJ433975 Mycobacterium phage 40BC, complete genome 23231-23262 7 0.781
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 KJ433973 Mycobacterium phage 39HC, complete genome 23231-23262 7 0.781
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 NC_024145 Mycobacterium phage Hosp, complete genome 21427-21458 7 0.781
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 JF974294 Aeromonas phage pIS4-A genomic sequence 21965-21996 7 0.781
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 NC_021534 Vibrio phage pYD38-A genomic sequence 3299-3330 7 0.781
NZ_CP045149_3 3.8|1630126|32|NZ_CP045149|CRISPRCasFinder,CRT 1630126-1630157 32 CP049262 Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence 69636-69667 7 0.781
NZ_CP045149_4 4.2|2508806|32|NZ_CP045149|CRISPRCasFinder,CRT 2508806-2508837 32 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 86942-86973 7 0.781
NZ_CP045149_4 4.4|2508810|28|NZ_CP045149|PILER-CR 2508810-2508837 28 MK415408 CrAssphage GF1-2_000079F, complete genome 71106-71133 7 0.75
NZ_CP045149_3 3.2|1629766|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629766-1629797 32 NZ_CP047125 Lactobacillus hilgardii strain FLUB plasmid unnamed4 1912-1943 8 0.75
NZ_CP045149_3 3.3|1629826|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629826-1629857 32 NZ_CP024873 Leptospira mayottensis 200901116 plasmid p1_L200901116, complete sequence 14979-15010 8 0.75
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 112580-112611 8 0.75
NZ_CP045149_4 4.2|2508806|32|NZ_CP045149|CRISPRCasFinder,CRT 2508806-2508837 32 NZ_CP010358 Acinetobacter johnsonii XBB1 plasmid pXBB1-8, complete sequence 46720-46751 8 0.75
NZ_CP045149_4 4.2|2508806|32|NZ_CP045149|CRISPRCasFinder,CRT 2508806-2508837 32 NC_019694 Oscillatoria acuminata PCC 6304 plasmid pOSCIL6304.02, complete sequence 20911-20942 8 0.75
NZ_CP045149_2 2.7|1020627|33|NZ_CP045149|CRISPRCasFinder,CRT 1020627-1020659 33 NZ_CP040366 Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence 923-955 9 0.727
NZ_CP045149_3 3.1|1629706|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629706-1629737 32 NZ_CP045721 Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence 19697-19728 9 0.719
NZ_CP045149_3 3.1|1629706|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629706-1629737 32 NZ_CP022517 Pantoea vagans strain FBS135 plasmid pPant1, complete sequence 384938-384969 9 0.719
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 MF679145 Escherichia coli plasmid pBJ114-96, complete sequence 37586-37617 9 0.719
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 60831-60862 9 0.719
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 NZ_CP021340 Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence 67671-67702 9 0.719
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 NZ_CP021336 Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence 67672-67703 9 0.719
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 NZ_CP040920 Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence 33435-33466 9 0.719
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 NZ_CP024832 Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence 33830-33861 9 0.719
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 NZ_CP024817 Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence 62769-62800 9 0.719
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 15616-15647 9 0.719
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 NZ_CP023961 Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence 16858-16889 9 0.719
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 AP023222 Escherichia coli M505 plasmid pM505-b DNA, complete genome 93734-93765 9 0.719
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 AP023233 Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome 47570-47601 9 0.719
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 NZ_CP019075 Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence 16520-16551 9 0.719
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 NZ_CP015837 Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence 3287-3318 9 0.719
NZ_CP045149_3 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630006-1630037 32 NZ_CP011063 Escherichia coli str. Sanji plasmid pSJ_98, complete sequence 37637-37668 9 0.719
NZ_CP045149_3 3.7|1630066|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1630066-1630097 32 NZ_CP031943 Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence 4006-4037 9 0.719
NZ_CP045149_4 4.2|2508806|32|NZ_CP045149|CRISPRCasFinder,CRT 2508806-2508837 32 MT774386 CrAssphage cr110_1, complete genome 42858-42889 9 0.719
NZ_CP045149_4 4.2|2508806|32|NZ_CP045149|CRISPRCasFinder,CRT 2508806-2508837 32 NZ_CP028934 Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence 25849-25880 9 0.719
NZ_CP045149_2 2.3|1020625|35|NZ_CP045149|PILER-CR 1020625-1020659 35 NZ_CP040366 Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence 923-957 10 0.714
NZ_CP045149_3 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629946-1629977 32 NZ_JX627581 Methylobacterium oryzae CBMB20 plasmid pMOC2, complete sequence 30496-30527 10 0.688
NZ_CP045149_3 3.3|1629826|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629826-1629857 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 815356-815387 11 0.656
NZ_CP045149_3 3.3|1629826|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629826-1629857 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 820287-820318 11 0.656
NZ_CP045149_3 3.3|1629826|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629826-1629857 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2180994-2181025 11 0.656
NZ_CP045149_3 3.3|1629826|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT 1629826-1629857 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2185925-2185956 11 0.656

1. spacer 2.8|1020688|32|NZ_CP045149|CRISPRCasFinder,CRT matches to MT374852 (Yersinia phage vB_YpM_3, complete genome) position: , mismatch: 0, identity: 1.0

agactgatgcaagatggcggtatgcgtacaga	CRISPR spacer
agactgatgcaagatggcggtatgcgtacaga	Protospacer
********************************

2. spacer 2.4|1020686|34|NZ_CP045149|PILER-CR matches to MT374852 (Yersinia phage vB_YpM_3, complete genome) position: , mismatch: 1, identity: 0.971

aaagactgatgcaagatggcggtatgcgtacaga	CRISPR spacer
caagactgatgcaagatggcggtatgcgtacaga	Protospacer
 *********************************

3. spacer 4.4|2508810|28|NZ_CP045149|PILER-CR matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 5, identity: 0.821

aagttctttttgtcagcatctttaataa	CRISPR spacer
ataatctttttatcagcatcttttataa	Protospacer
* . *******.*********** ****

4. spacer 4.4|2508810|28|NZ_CP045149|PILER-CR matches to MT774386 (CrAssphage cr110_1, complete genome) position: , mismatch: 5, identity: 0.821

aagttctttttgtcagcatctttaataa	CRISPR spacer
agtttctttttatcagcatcttcaatag	Protospacer
*. ********.**********.****.

5. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to MK820641 (Gordonia phage EnalisNailo, complete genome) position: , mismatch: 6, identity: 0.812

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
tcgcgagcgcgctcaggatcacggcg-gacgac	Protospacer
******.********** ****** . *.*** 

6. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to MK878898 (Gordonia phage Zameen, complete genome) position: , mismatch: 6, identity: 0.812

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
tcgcgagcgcgctcaggatcacggcg-gacgac	Protospacer
******.********** ****** . *.*** 

7. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to MK919483 (Gordonia phage Suscepit, complete genome) position: , mismatch: 6, identity: 0.812

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
tcgcgagcgcgctcaggatcacggcg-gacgac	Protospacer
******.********** ****** . *.*** 

8. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to MK284520 (Gordonia phage Lilas, complete genome) position: , mismatch: 6, identity: 0.812

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
tcgcgagcgcgctcaggatcacggcg-gacgac	Protospacer
******.********** ****** . *.*** 

9. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to MK016492 (Gordonia phage Bialota, complete genome) position: , mismatch: 6, identity: 0.812

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
tcgcgagcgcgctcaggatcacggcg-gacgac	Protospacer
******.********** ****** . *.*** 

10. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to MK820642 (Gordonia phage Polly, complete genome) position: , mismatch: 6, identity: 0.812

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
tcgcgagcgcgctcaggatcacggcg-gacgac	Protospacer
******.********** ****** . *.*** 

11. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NC_041883 (Gordonia phage Attis, complete genome) position: , mismatch: 6, identity: 0.812

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
tcgcgagcgcgctcaggatcacggcg-gacgac	Protospacer
******.********** ****** . *.*** 

12. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to MK814755 (Gordonia phage Antonio, complete genome) position: , mismatch: 6, identity: 0.812

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
tcgcgagcgcgctcaggatcacggcg-gacgac	Protospacer
******.********** ****** . *.*** 

13. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to MK875796 (Gordonia phage Tayonia, complete genome) position: , mismatch: 6, identity: 0.812

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
tcgcgagcgcgctcaggatcacggcg-gacgac	Protospacer
******.********** ****** . *.*** 

14. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to MK801734 (Gordonia phage LordFarquaad, complete genome) position: , mismatch: 6, identity: 0.812

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
tcgcgagcgcgctcaggatcacggcg-gacgac	Protospacer
******.********** ****** . *.*** 

15. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to MK433274 (Gordonia phage Bradissa, complete genome) position: , mismatch: 6, identity: 0.812

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
tcgcgagcgcgctcaggatcacggcg-gacgac	Protospacer
******.********** ****** . *.*** 

16. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to KU963257 (Gordonia phage Kita, complete genome) position: , mismatch: 6, identity: 0.812

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
tcgcgagcgcgctcaggatcacggcg-gacgac	Protospacer
******.********** ****** . *.*** 

17. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NC_031251 (Gordonia phage SoilAssassin, complete genome) position: , mismatch: 6, identity: 0.812

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
tcgcgagcgcgctcaggatcacggcg-gacgac	Protospacer
******.********** ****** . *.*** 

18. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NC_031097 (Gordonia phage Zirinka, complete genome) position: , mismatch: 6, identity: 0.812

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
tcgcgagcgcgctcaggatcacggcg-gacgac	Protospacer
******.********** ****** . *.*** 

19. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 6, identity: 0.812

--tcgcgaacgcgctcaggttcacggaatggcga	CRISPR spacer
ggtcacga--tcgctcaggttcagggaaaggcga	Protospacer
  **.***   ************ **** *****

20. spacer 4.4|2508810|28|NZ_CP045149|PILER-CR matches to NZ_CP028934 (Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence) position: , mismatch: 6, identity: 0.786

aagttctttttgtcagcatctttaataa	CRISPR spacer
actttctttttgtcagcgtctgtaatgt	Protospacer
*  **************.*** ****. 

21. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

tcgcgaacgcgctcaggttcacggaatggcga----	CRISPR spacer
tcgcgaacgcgcccaggttcccg----agcgaggtg	Protospacer
************.******* **    .****    

22. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.781

tcgcgaacgcgctcaggttcacggaatggcga----	CRISPR spacer
tcgcgaacgcgcccaggttcccg----agcgaggtg	Protospacer
************.******* **    .****    

23. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to KJ433975 (Mycobacterium phage 40BC, complete genome) position: , mismatch: 7, identity: 0.781

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
gcgcgaacgcgctcgggtacacgg-gcggcggg	Protospacer
 *************.*** ***** ..****. 

24. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to KJ433973 (Mycobacterium phage 39HC, complete genome) position: , mismatch: 7, identity: 0.781

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
gcgcgaacgcgctcgggtacacgg-gcggcggg	Protospacer
 *************.*** ***** ..****. 

25. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 7, identity: 0.781

tcgcgaacgcgctcaggttcacggaatggcga-	CRISPR spacer
gcgcgaacgcgctcgggtacacgg-gcggcggg	Protospacer
 *************.*** ***** ..****. 

26. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to JF974294 (Aeromonas phage pIS4-A genomic sequence) position: , mismatch: 7, identity: 0.781

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
atcaggcataaagcaaatgccattcaggtaat	Protospacer
*** *   .**** *************.****

27. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NC_021534 (Vibrio phage pYD38-A genomic sequence) position: , mismatch: 7, identity: 0.781

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
atcaggcataaagcaaatgccattcaggtaat	Protospacer
*** *   .**** *************.****

28. spacer 3.8|1630126|32|NZ_CP045149|CRISPRCasFinder,CRT matches to CP049262 (Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence) position: , mismatch: 7, identity: 0.781

atcatgaaagacattgttcgccagtcccctga	CRISPR spacer
atcatgaaagagattgttcgccagcgcgacgt	Protospacer
*********** ************. *  .* 

29. spacer 4.2|2508806|32|NZ_CP045149|CRISPRCasFinder,CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 7, identity: 0.781

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
taataatctttttatcagcatcttttataatt	Protospacer
* * . *******.*********** **** *

30. spacer 4.4|2508810|28|NZ_CP045149|PILER-CR matches to MK415408 (CrAssphage GF1-2_000079F, complete genome) position: , mismatch: 7, identity: 0.75

aagttctttttgtcagcatctttaataa	CRISPR spacer
ataagacttttatcagcatctttaataa	Protospacer
* .   .****.****************

31. spacer 3.2|1629766|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047125 (Lactobacillus hilgardii strain FLUB plasmid unnamed4) position: , mismatch: 8, identity: 0.75

ctgatgggtaactttaatcccaaattcttttt	CRISPR spacer
attttgaataactttaatcccaaaagctttta	Protospacer
 *  **..****************  ***** 

32. spacer 3.3|1629826|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024873 (Leptospira mayottensis 200901116 plasmid p1_L200901116, complete sequence) position: , mismatch: 8, identity: 0.75

tgttaaatcgtcgcctaaatttgtttgaccga	CRISPR spacer
tttagaatcgtcgcctcaacttgtttgagtaa	Protospacer
* * .*********** **.******** ..*

33. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 8, identity: 0.75

atctgc-gccaaagaaaatgccattcagataat	CRISPR spacer
-taaacagttaaagaaactgccaatcagataat	Protospacer
 *  .* *..******* ***** *********

34. spacer 4.2|2508806|32|NZ_CP045149|CRISPRCasFinder,CRT matches to NZ_CP010358 (Acinetobacter johnsonii XBB1 plasmid pXBB1-8, complete sequence) position: , mismatch: 8, identity: 0.75

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
gtgccatattttcgtcagcatcattaataaat	Protospacer
 *.   * ****.********* *********

35. spacer 4.2|2508806|32|NZ_CP045149|CRISPRCasFinder,CRT matches to NC_019694 (Oscillatoria acuminata PCC 6304 plasmid pOSCIL6304.02, complete sequence) position: , mismatch: 8, identity: 0.75

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
ttgatgctcttttggcagcttctttaataaat	Protospacer
**.*  ...***** **** ************

36. spacer 2.7|1020627|33|NZ_CP045149|CRISPRCasFinder,CRT matches to NZ_CP040366 (Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence) position: , mismatch: 9, identity: 0.727

ccgaaatcatcagatgtaattaagatttttgct	CRISPR spacer
aatggattatcagatgtaattaagtttttttcc	Protospacer
   ..**.**************** ***** *.

37. spacer 3.1|1629706|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045721 (Pantoea eucalypti strain LMG 24197 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atgccaagaacagaggtagatgcagcctgatc	CRISPR spacer
agggaaagaacagtggttgatgcagcctttct	Protospacer
* *  ******** *** **********  ..

38. spacer 3.1|1629706|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022517 (Pantoea vagans strain FBS135 plasmid pPant1, complete sequence) position: , mismatch: 9, identity: 0.719

atgccaagaacagaggtagatgcagcctgatc	CRISPR spacer
agggaaagaacagtggttgatgcagcctttct	Protospacer
* *  ******** *** **********  ..

39. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to MF679145 (Escherichia coli plasmid pBJ114-96, complete sequence) position: , mismatch: 9, identity: 0.719

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaaacagttaaagaaactgccaatcagataat	Protospacer
*     *..******* ***** *********

40. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 9, identity: 0.719

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaaacagttaaagaaactgccaatcagataat	Protospacer
*     *..******* ***** *********

41. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021340 (Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence) position: , mismatch: 9, identity: 0.719

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaaacagttaaagaaactgccaatcagataat	Protospacer
*     *..******* ***** *********

42. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021336 (Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence) position: , mismatch: 9, identity: 0.719

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaaacagttaaagaaactgccaatcagataat	Protospacer
*     *..******* ***** *********

43. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040920 (Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence) position: , mismatch: 9, identity: 0.719

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaaacagttaaagaaactgccaatcagataat	Protospacer
*     *..******* ***** *********

44. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024832 (Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence) position: , mismatch: 9, identity: 0.719

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaaacagttaaagaaactgccaatcagataat	Protospacer
*     *..******* ***** *********

45. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024817 (Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence) position: , mismatch: 9, identity: 0.719

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaaacagttaaagaaactgccaatcagataat	Protospacer
*     *..******* ***** *********

46. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 9, identity: 0.719

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaaacagttaaagaaactgccaatcagataat	Protospacer
*     *..******* ***** *********

47. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023961 (Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaaacagttaaagaaactgccaatcagataat	Protospacer
*     *..******* ***** *********

48. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to AP023222 (Escherichia coli M505 plasmid pM505-b DNA, complete genome) position: , mismatch: 9, identity: 0.719

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaaacagttaaagaaactgccaatcagataat	Protospacer
*     *..******* ***** *********

49. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to AP023233 (Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome) position: , mismatch: 9, identity: 0.719

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaaacagttaaagaaactgccaatcagataat	Protospacer
*     *..******* ***** *********

50. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019075 (Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence) position: , mismatch: 9, identity: 0.719

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaaacagttaaagaaactgccaatcagataat	Protospacer
*     *..******* ***** *********

51. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015837 (Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence) position: , mismatch: 9, identity: 0.719

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaaacagttaaagaaactgccaatcagataat	Protospacer
*     *..******* ***** *********

52. spacer 3.6|1630006|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011063 (Escherichia coli str. Sanji plasmid pSJ_98, complete sequence) position: , mismatch: 9, identity: 0.719

atctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaaacagttaaagaaactgccaatcagataat	Protospacer
*     *..******* ***** *********

53. spacer 3.7|1630066|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031943 (Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

aactactagaagcttgcccatcttaccttttc	CRISPR spacer
taccactaaaagcttgcccatctttctcataa	Protospacer
 **.****.*************** *.. *  

54. spacer 4.2|2508806|32|NZ_CP045149|CRISPRCasFinder,CRT matches to MT774386 (CrAssphage cr110_1, complete genome) position: , mismatch: 9, identity: 0.719

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
caagtttctttttatcagcatcttcaatagca	Protospacer
. *. ********.**********.****.  

55. spacer 4.2|2508806|32|NZ_CP045149|CRISPRCasFinder,CRT matches to NZ_CP028934 (Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence) position: , mismatch: 9, identity: 0.719

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
taactttctttttgtcagcgtctgtaatgtgc	Protospacer
* *  **************.*** ****. ..

56. spacer 2.3|1020625|35|NZ_CP045149|PILER-CR matches to NZ_CP040366 (Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence) position: , mismatch: 10, identity: 0.714

aaccgaaatcatcagatgtaattaagatttttgct	CRISPR spacer
ataatggattatcagatgtaattaagtttttttcc	Protospacer
*    ..**.**************** ***** *.

57. spacer 3.5|1629946|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_JX627581 (Methylobacterium oryzae CBMB20 plasmid pMOC2, complete sequence) position: , mismatch: 10, identity: 0.688

tcgcgaacgcgctcaggttcacggaatggcga	CRISPR spacer
acgcgaatgcgctgaggttcacggctcgttag	Protospacer
 ******.***** **********  .* ...

58. spacer 3.3|1629826|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 11, identity: 0.656

tgttaaatcgtcgcctaaatttgtttgaccga	CRISPR spacer
cagcggctccttgcctaaatttgtttgaccac	Protospacer
.. ... ** *.******************. 

59. spacer 3.3|1629826|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 11, identity: 0.656

tgttaaatcgtcgcctaaatttgtttgaccga	CRISPR spacer
cagcggctccttgcctaaatttgtttgaccac	Protospacer
.. ... ** *.******************. 

60. spacer 3.3|1629826|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 11, identity: 0.656

tgttaaatcgtcgcctaaatttgtttgaccga	CRISPR spacer
cagcggctccttgcctaaatttgtttgaccac	Protospacer
.. ... ** *.******************. 

61. spacer 3.3|1629826|32|NZ_CP045149|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 11, identity: 0.656

tgttaaatcgtcgcctaaatttgtttgaccga	CRISPR spacer
cagcggctccttgcctaaatttgtttgaccac	Protospacer
.. ... ** *.******************. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 235910 : 303339 51 Escherichia_phage(40.0%) transposase NA
DBSCAN-SWA_2 958314 : 1013069 54 uncultured_virus(20.0%) transposase,tRNA,protease,integrase attL 953652:953670|attR 1029696:1029714
DBSCAN-SWA_3 1375280 : 1444142 60 Escherichia_phage(38.46%) plate,tRNA,transposase NA
DBSCAN-SWA_4 1772238 : 1790209 15 Escherichia_phage(50.0%) coat,protease,transposase NA
DBSCAN-SWA_5 2080387 : 2200025 119 Escherichia_phage(13.79%) lysis,integrase,tRNA,transposase,tail attL 2085387:2085446|attR 2198433:2198545
DBSCAN-SWA_6 2551399 : 2595917 36 Indivirus(14.29%) plate,lysis,tRNA,transposase NA
DBSCAN-SWA_7 2620781 : 2662549 38 Escherichia_phage(40.0%) plate,protease,transposase NA
DBSCAN-SWA_8 2859147 : 2877512 19 Vibrio_phage(25.0%) plate,coat,transposase,tail NA
DBSCAN-SWA_9 2955512 : 2991728 30 uncultured_virus(12.5%) holin,tRNA,transposase NA
DBSCAN-SWA_10 3061460 : 3067632 8 Escherichia_phage(33.33%) transposase NA
DBSCAN-SWA_11 3681232 : 3757109 56 Escherichia_phage(20.0%) plate,transposase NA
DBSCAN-SWA_12 3882582 : 3948531 60 Escherichia_phage(12.5%) plate,protease,transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP045149.1|WP_002214494.1|2143766_2144123_-|hypothetical-protein 2143766_2144123_- 118 aa aa NA NA NA 2080387-2200025 yes
3. NZ_CP045152
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 20652 25 Haemophilus_phage(55.56%) tail,plate NA
DBSCAN-SWA_2 24607 : 33666 12 Salmonella_phage(30.0%) terminase,integrase,holin attL 21105:21119|attR 30841:30855
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP045151
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 43586 : 66559 20 Enterobacteria_phage(50.0%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage