Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP045026 Bacillus thuringiensis strain JW-1 plasmid p4, complete sequence 2 crisprs csa3 0 2 1 0
NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 2 crisprs NA 3 10 1 0
NZ_CP045023 Bacillus thuringiensis strain JW-1 plasmid p1, complete sequence 0 crisprs cas14j,csa3,RT 0 0 2 0
NZ_CP045029 Bacillus thuringiensis strain JW-1 plasmid p7, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP045025 Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence 0 crisprs RT,cas4 0 0 2 1
NZ_CP045030 Bacillus thuringiensis strain JW-1 chromosome, complete genome 4 crisprs cas3,cas14k,csa3,WYL,c2c9_V-U4,cas14j,DinG,DEDDh 1 5 13 0
NZ_CP045027 Bacillus thuringiensis strain JW-1 plasmid p5, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP045028 Bacillus thuringiensis strain JW-1 plasmid p6, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP045026
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045026_1 8339-8480 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045026_2 8599-8714 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045026_2 2.1|8631|52|NZ_CP045026|CRISPRCasFinder 8631-8682 52 NZ_KY352353 Bacillus thuringiensis serovar israelensis strain 1.24 plasmid pT0124-4, complete sequence 8631-8682 0 1.0
NZ_CP045026_2 2.1|8631|52|NZ_CP045026|CRISPRCasFinder 8631-8682 52 NC_010076 Bacillus thuringiensis serovar israelensis plasmid pBtoxis, complete sequence 8631-8682 0 1.0
NZ_CP045026_2 2.1|8631|52|NZ_CP045026|CRISPRCasFinder 8631-8682 52 NZ_CP039725 Bacillus thuringiensis strain BT-59 plasmid p4, complete sequence 8328-8379 0 1.0
NZ_CP045026_2 2.1|8631|52|NZ_CP045026|CRISPRCasFinder 8631-8682 52 NZ_CP045026 Bacillus thuringiensis strain JW-1 plasmid p4, complete sequence 8631-8682 0 1.0
NZ_CP045026_2 2.1|8631|52|NZ_CP045026|CRISPRCasFinder 8631-8682 52 LC128536 Bacillus thuringiensis serovar israelensis plasmid pBTI-6 DNA, complete sequence, strain: HD522 108635-108686 0 1.0
NZ_CP045026_2 2.1|8631|52|NZ_CP045026|CRISPRCasFinder 8631-8682 52 NC_018510 Bacillus thuringiensis HD-789 plasmid pBTHD789-3, complete sequence 69934-69985 0 1.0
NZ_CP045026_2 2.1|8631|52|NZ_CP045026|CRISPRCasFinder 8631-8682 52 NZ_CP053973 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed4, complete sequence 22225-22276 0 1.0
NZ_CP045026_2 2.1|8631|52|NZ_CP045026|CRISPRCasFinder 8631-8682 52 NZ_CP013279 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-4-128K, complete sequence 119257-119308 0 1.0
NZ_CP045026_2 2.1|8631|52|NZ_CP045026|CRISPRCasFinder 8631-8682 52 NZ_CP053973 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed4, complete sequence 150096-150147 4 0.923
NZ_CP045026_1 1.1|8371|77|NZ_CP045026|CRISPRCasFinder 8371-8447 77 NZ_KY352353 Bacillus thuringiensis serovar israelensis strain 1.24 plasmid pT0124-4, complete sequence 8371-8447 17 0.779
NZ_CP045026_1 1.1|8371|77|NZ_CP045026|CRISPRCasFinder 8371-8447 77 NC_010076 Bacillus thuringiensis serovar israelensis plasmid pBtoxis, complete sequence 8371-8447 17 0.779
NZ_CP045026_1 1.1|8371|77|NZ_CP045026|CRISPRCasFinder 8371-8447 77 NZ_CP039725 Bacillus thuringiensis strain BT-59 plasmid p4, complete sequence 8068-8144 17 0.779
NZ_CP045026_1 1.1|8371|77|NZ_CP045026|CRISPRCasFinder 8371-8447 77 NZ_CP045026 Bacillus thuringiensis strain JW-1 plasmid p4, complete sequence 8371-8447 17 0.779
NZ_CP045026_1 1.1|8371|77|NZ_CP045026|CRISPRCasFinder 8371-8447 77 NC_018510 Bacillus thuringiensis HD-789 plasmid pBTHD789-3, complete sequence 70169-70245 17 0.779
NZ_CP045026_1 1.1|8371|77|NZ_CP045026|CRISPRCasFinder 8371-8447 77 NZ_CP053973 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed4, complete sequence 22460-22536 17 0.779
NZ_CP045026_1 1.1|8371|77|NZ_CP045026|CRISPRCasFinder 8371-8447 77 NZ_CP053973 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed4, complete sequence 150331-150407 17 0.779
NZ_CP045026_1 1.1|8371|77|NZ_CP045026|CRISPRCasFinder 8371-8447 77 NZ_CP013279 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-4-128K, complete sequence 119492-119568 17 0.779

1. spacer 2.1|8631|52|NZ_CP045026|CRISPRCasFinder matches to NZ_KY352353 (Bacillus thuringiensis serovar israelensis strain 1.24 plasmid pT0124-4, complete sequence) position: , mismatch: 0, identity: 1.0

atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	CRISPR spacer
atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	Protospacer
****************************************************

2. spacer 2.1|8631|52|NZ_CP045026|CRISPRCasFinder matches to NC_010076 (Bacillus thuringiensis serovar israelensis plasmid pBtoxis, complete sequence) position: , mismatch: 0, identity: 1.0

atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	CRISPR spacer
atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	Protospacer
****************************************************

3. spacer 2.1|8631|52|NZ_CP045026|CRISPRCasFinder matches to NZ_CP039725 (Bacillus thuringiensis strain BT-59 plasmid p4, complete sequence) position: , mismatch: 0, identity: 1.0

atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	CRISPR spacer
atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	Protospacer
****************************************************

4. spacer 2.1|8631|52|NZ_CP045026|CRISPRCasFinder matches to NZ_CP045026 (Bacillus thuringiensis strain JW-1 plasmid p4, complete sequence) position: , mismatch: 0, identity: 1.0

atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	CRISPR spacer
atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	Protospacer
****************************************************

5. spacer 2.1|8631|52|NZ_CP045026|CRISPRCasFinder matches to LC128536 (Bacillus thuringiensis serovar israelensis plasmid pBTI-6 DNA, complete sequence, strain: HD522) position: , mismatch: 0, identity: 1.0

atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	CRISPR spacer
atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	Protospacer
****************************************************

6. spacer 2.1|8631|52|NZ_CP045026|CRISPRCasFinder matches to NC_018510 (Bacillus thuringiensis HD-789 plasmid pBTHD789-3, complete sequence) position: , mismatch: 0, identity: 1.0

atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	CRISPR spacer
atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	Protospacer
****************************************************

7. spacer 2.1|8631|52|NZ_CP045026|CRISPRCasFinder matches to NZ_CP053973 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	CRISPR spacer
atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	Protospacer
****************************************************

8. spacer 2.1|8631|52|NZ_CP045026|CRISPRCasFinder matches to NZ_CP013279 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-4-128K, complete sequence) position: , mismatch: 0, identity: 1.0

atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	CRISPR spacer
atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	Protospacer
****************************************************

9. spacer 2.1|8631|52|NZ_CP045026|CRISPRCasFinder matches to NZ_CP053973 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.923

atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaaagat	CRISPR spacer
atttttaatgtatatctgtagatttaaatgtaaaatgttgcttattaagata	Protospacer
************************************************..  

10. spacer 1.1|8371|77|NZ_CP045026|CRISPRCasFinder matches to NZ_KY352353 (Bacillus thuringiensis serovar israelensis strain 1.24 plasmid pT0124-4, complete sequence) position: , mismatch: 17, identity: 0.779

ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	CRISPR spacer
ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	Protospacer
************************************************************

11. spacer 1.1|8371|77|NZ_CP045026|CRISPRCasFinder matches to NC_010076 (Bacillus thuringiensis serovar israelensis plasmid pBtoxis, complete sequence) position: , mismatch: 17, identity: 0.779

ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	CRISPR spacer
ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	Protospacer
************************************************************

12. spacer 1.1|8371|77|NZ_CP045026|CRISPRCasFinder matches to NZ_CP039725 (Bacillus thuringiensis strain BT-59 plasmid p4, complete sequence) position: , mismatch: 17, identity: 0.779

ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	CRISPR spacer
ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	Protospacer
************************************************************

13. spacer 1.1|8371|77|NZ_CP045026|CRISPRCasFinder matches to NZ_CP045026 (Bacillus thuringiensis strain JW-1 plasmid p4, complete sequence) position: , mismatch: 17, identity: 0.779

ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	CRISPR spacer
ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	Protospacer
************************************************************

14. spacer 1.1|8371|77|NZ_CP045026|CRISPRCasFinder matches to NC_018510 (Bacillus thuringiensis HD-789 plasmid pBTHD789-3, complete sequence) position: , mismatch: 17, identity: 0.779

ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	CRISPR spacer
ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	Protospacer
************************************************************

15. spacer 1.1|8371|77|NZ_CP045026|CRISPRCasFinder matches to NZ_CP053973 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed4, complete sequence) position: , mismatch: 17, identity: 0.779

ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	CRISPR spacer
ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	Protospacer
************************************************************

16. spacer 1.1|8371|77|NZ_CP045026|CRISPRCasFinder matches to NZ_CP053973 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed4, complete sequence) position: , mismatch: 17, identity: 0.779

ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	CRISPR spacer
ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	Protospacer
************************************************************

17. spacer 1.1|8371|77|NZ_CP045026|CRISPRCasFinder matches to NZ_CP013279 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-4-128K, complete sequence) position: , mismatch: 17, identity: 0.779

ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	CRISPR spacer
ttatttgatgagactttattaagtaaaaattaaaagaaatcctttaataacactattctc	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2336 : 86737 54 Streptococcus_phage(35.71%) tRNA,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP045030
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045030_1 652257-652332 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045030_2 1232164-1232291 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045030_3 4984198-4984314 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045030_4 5239636-5239769 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP045030_2 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder 1232244-1232262 19 NZ_CP045030.1 1232280-1232298 0 1.0
NZ_CP045030_2 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder 1232244-1232262 19 NZ_CP045030.1 1232289-1232307 0 1.0
NZ_CP045030_2 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder 1232244-1232262 19 NZ_CP045030.1 1232298-1232316 0 1.0
NZ_CP045030_2 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder 1232244-1232262 19 NZ_CP045030.1 259994-260012 2 0.895
NZ_CP045030_2 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder 1232244-1232262 19 NZ_CP045030.1 2063820-2063838 2 0.895
NZ_CP045030_2 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder 1232244-1232262 19 NZ_CP045030.1 2063910-2063928 2 0.895
NZ_CP045030_2 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder 1232244-1232262 19 NZ_CP045025.1 175527-175545 2 0.895

1. spacer 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder matches to position: 1232280-1232298, mismatch: 0, identity: 1.0

caagaacaacaagaacaac	CRISPR spacer
caagaacaacaagaacaac	Protospacer
*******************

2. spacer 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder matches to position: 1232289-1232307, mismatch: 0, identity: 1.0

caagaacaacaagaacaac	CRISPR spacer
caagaacaacaagaacaac	Protospacer
*******************

3. spacer 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder matches to position: 1232298-1232316, mismatch: 0, identity: 1.0

caagaacaacaagaacaac	CRISPR spacer
caagaacaacaagaacaac	Protospacer
*******************

4. spacer 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder matches to position: 259994-260012, mismatch: 2, identity: 0.895

caagaacaacaagaacaac	CRISPR spacer
caacaagaacaagaacaac	Protospacer
*** ** ************

5. spacer 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder matches to position: 2063820-2063838, mismatch: 2, identity: 0.895

caagaacaacaagaacaac	CRISPR spacer
caagaacaacaatatcaac	Protospacer
************ * ****

6. spacer 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder matches to position: 2063910-2063928, mismatch: 2, identity: 0.895

caagaacaacaagaacaac	CRISPR spacer
caagaacaacaatatcaac	Protospacer
************ * ****

7. spacer 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder matches to position: 175527-175545, mismatch: 2, identity: 0.895

caagaacaacaagaacaac	CRISPR spacer
caacaacaacaacaacaac	Protospacer
*** ******** ******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045030_2 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder 1232244-1232262 19 NZ_CP017942 Phyllobacterium zundukense strain Tri-48 plasmid unnamed3, complete sequence 310855-310873 0 1.0
NZ_CP045030_2 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder 1232244-1232262 19 NZ_CP007006 Vibrio parahaemolyticus UCM-V493 plasmid pVPUCMV, complete sequence 35754-35772 0 1.0
NZ_CP045030_2 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder 1232244-1232262 19 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1605979-1605997 0 1.0
NZ_CP045030_2 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder 1232244-1232262 19 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 568408-568426 0 1.0
NZ_CP045030_2 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder 1232244-1232262 19 AP013455 Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-U-MedDCM-OCT-S38-C40 22145-22163 0 1.0
NZ_CP045030_2 2.1|1232193|22|NZ_CP045030|CRISPRCasFinder 1232193-1232214 22 NZ_AP022840 Legionella sp. TUM19329 plasmid pTUM19329-1 98069-98090 3 0.864
NZ_CP045030_1 1.1|652282|26|NZ_CP045030|CRISPRCasFinder 652282-652307 26 NZ_CP045855 Agrobacterium sp. MA01 plasmid punnamed1, complete sequence 103187-103212 5 0.808
NZ_CP045030_4 4.1|5239659|31|NZ_CP045030|CRISPRCasFinder 5239659-5239689 31 JX238501 Bacillus phage phiAGATE, complete genome 124559-124589 8 0.742
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 NZ_CP014851 Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence 100650-100683 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 MN812210 Flavobacterium phage vB_FspS_hemulen9-1, complete genome 22854-22887 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 MN812215 Flavobacterium phage vB_FspS_lillamy9-4, complete genome 22191-22224 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 MN812216 Flavobacterium phage vB_FspS_lillamy9-5, complete genome 22191-22224 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 NC_048835 Flavobacterium phage vB_FspS_lillamy9-1, complete genome 22191-22224 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 MN812213 Flavobacterium phage vB_FspS_lillamy9-2, complete genome 22191-22224 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 MN812230 Flavobacterium phage vB_FspS_sniff9-2, complete genome 21831-21864 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 MN812209 Flavobacterium phage vB_FspS_hemulen6-2, complete genome 22983-23016 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 MN812218 Flavobacterium phage vB_FspS_lillamy9-7, complete genome 21454-21487 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 MN812233 Flavobacterium phage vB_FspS_snork9-1, complete genome 22007-22040 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 MN812219 Flavobacterium phage vB_FspS_morran9-1, complete genome 22308-22341 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 MN812217 Flavobacterium phage vB_FspS_lillamy9-6, complete genome 21930-21963 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 NC_048840 Flavobacterium phage vB_FspS_snork6-1, complete genome 22137-22170 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 NC_048839 Flavobacterium phage vB_FspS_sniff9-1, complete genome 22057-22090 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 NC_048842 Flavobacterium phage vB_FspS_stinky9-1, complete genome 21673-21706 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 MN812232 Flavobacterium phage vB_FspS_snork6-2, complete genome 21655-21688 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 MN812208 Flavobacterium phage vB_FspS_hemulen6-1, complete genome 22983-23016 8 0.765
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 47181-47214 11 0.676
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 47565-47598 11 0.676
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 47949-47982 11 0.676
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 48333-48366 11 0.676
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 48717-48750 11 0.676
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 49101-49134 11 0.676
NZ_CP045030_4 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder 5239713-5239746 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 49485-49518 11 0.676

1. spacer 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder matches to NZ_CP017942 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

caagaacaacaagaacaac	CRISPR spacer
caagaacaacaagaacaac	Protospacer
*******************

2. spacer 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder matches to NZ_CP007006 (Vibrio parahaemolyticus UCM-V493 plasmid pVPUCMV, complete sequence) position: , mismatch: 0, identity: 1.0

caagaacaacaagaacaac	CRISPR spacer
caagaacaacaagaacaac	Protospacer
*******************

3. spacer 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 0, identity: 1.0

caagaacaacaagaacaac	CRISPR spacer
caagaacaacaagaacaac	Protospacer
*******************

4. spacer 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 0, identity: 1.0

caagaacaacaagaacaac	CRISPR spacer
caagaacaacaagaacaac	Protospacer
*******************

5. spacer 2.2|1232244|19|NZ_CP045030|CRISPRCasFinder matches to AP013455 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-U-MedDCM-OCT-S38-C40) position: , mismatch: 0, identity: 1.0

caagaacaacaagaacaac	CRISPR spacer
caagaacaacaagaacaac	Protospacer
*******************

6. spacer 2.1|1232193|22|NZ_CP045030|CRISPRCasFinder matches to NZ_AP022840 (Legionella sp. TUM19329 plasmid pTUM19329-1) position: , mismatch: 3, identity: 0.864

cagcaagtggaagaaaaaatag	CRISPR spacer
tagcaagtggaagaaaaaatgc	Protospacer
.*******************. 

7. spacer 1.1|652282|26|NZ_CP045030|CRISPRCasFinder matches to NZ_CP045855 (Agrobacterium sp. MA01 plasmid punnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

tggtgggcacaatcataacggcggac	CRISPR spacer
atctgggcacaatcatagcggcggaa	Protospacer
   **************.******* 

8. spacer 4.1|5239659|31|NZ_CP045030|CRISPRCasFinder matches to JX238501 (Bacillus phage phiAGATE, complete genome) position: , mismatch: 8, identity: 0.742

ttcttcttttttgtcactagttgaaccgctt	CRISPR spacer
ctaaccttttttgccactagttaaaccgccc	Protospacer
.*  .********.********.******..

9. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to NZ_CP014851 (Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tttatcttcttttttattttctggtttattttcc	Protospacer
.**.****** ****************  * ..*

10. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to MN812210 (Flavobacterium phage vB_FspS_hemulen9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

11. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to MN812215 (Flavobacterium phage vB_FspS_lillamy9-4, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

12. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to MN812216 (Flavobacterium phage vB_FspS_lillamy9-5, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

13. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to NC_048835 (Flavobacterium phage vB_FspS_lillamy9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

14. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to MN812213 (Flavobacterium phage vB_FspS_lillamy9-2, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

15. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to MN812230 (Flavobacterium phage vB_FspS_sniff9-2, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

16. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to MN812209 (Flavobacterium phage vB_FspS_hemulen6-2, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

17. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to MN812218 (Flavobacterium phage vB_FspS_lillamy9-7, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

18. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to MN812233 (Flavobacterium phage vB_FspS_snork9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

19. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to MN812219 (Flavobacterium phage vB_FspS_morran9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

20. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to MN812217 (Flavobacterium phage vB_FspS_lillamy9-6, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

21. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to NC_048840 (Flavobacterium phage vB_FspS_snork6-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

22. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to NC_048839 (Flavobacterium phage vB_FspS_sniff9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

23. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to NC_048842 (Flavobacterium phage vB_FspS_stinky9-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

24. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to MN812232 (Flavobacterium phage vB_FspS_snork6-2, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

25. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to MN812208 (Flavobacterium phage vB_FspS_hemulen6-1, complete genome) position: , mismatch: 8, identity: 0.765

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ********************* **   *.

26. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

27. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

28. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

29. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

30. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

31. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

32. spacer 4.2|5239713|34|NZ_CP045030|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttattttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 327896 : 336272 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 674857 : 683015 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_3 1864578 : 1873433 8 Bacillus_phage(71.43%) NA NA
DBSCAN-SWA_4 2059943 : 2066853 9 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_5 3360614 : 3452358 88 Bacillus_phage(81.82%) holin,integrase,capsid,terminase,coat,portal,tail,protease,head attL 3440459:3440476|attR 3463296:3463313
DBSCAN-SWA_6 3511864 : 3522213 11 Bacillus_phage(100.0%) bacteriocin NA
DBSCAN-SWA_7 3526653 : 3552394 36 Bacillus_phage(56.52%) terminase,integrase,capsid attL 3516169:3516187|attR 3563340:3563358
DBSCAN-SWA_8 3667716 : 3676972 13 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_9 3731067 : 3861210 118 Bacillus_phage(43.4%) holin,integrase,bacteriocin,capsid,terminase,coat,portal,head,tail,protease,tRNA attL 3752033:3752050|attR 3860445:3860462
DBSCAN-SWA_10 4279373 : 4290616 11 Bacillus_phage(100.0%) bacteriocin NA
DBSCAN-SWA_11 4297445 : 4319935 25 Bacillus_phage(75.0%) terminase,integrase attL 4311975:4311990|attR 4325606:4325621
DBSCAN-SWA_12 4454933 : 4518062 60 Klosneuvirus(20.0%) protease,coat,transposase,tRNA NA
DBSCAN-SWA_13 4560264 : 4567952 9 Staphylococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP045023
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 29852 : 83627 38 Bacillus_phage(33.33%) protease,transposase NA
DBSCAN-SWA_2 97737 : 161500 55 Bacillus_phage(70.59%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP045025
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 169981 : 180958 14 Bacillus_phage(55.56%) NA NA
DBSCAN-SWA_2 198935 : 234649 52 Bacillus_phage(60.71%) tRNA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP045025.1|WP_000156298.1|179937_180216_+|hypothetical-protein 179937_180216_+ 92 aa aa NA NA NA 169981-180958 yes
5. NZ_CP045024
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045024_1 132396-132856 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP045024_2 288933-289070 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP045024_1 1.4|132554|19|NZ_CP045024|CRISPRCasFinder 132554-132572 19 NZ_CP045024.1 321934-321952 1 0.947
NZ_CP045024_1 1.4|132554|19|NZ_CP045024|CRISPRCasFinder 132554-132572 19 NZ_CP045030.1 4548287-4548305 2 0.895
NZ_CP045024_1 1.5|132596|19|NZ_CP045024|CRISPRCasFinder 132596-132614 19 NZ_CP045024.1 321934-321952 2 0.895
NZ_CP045024_1 1.9|132815|19|NZ_CP045024|CRISPRCasFinder 132815-132833 19 NZ_CP045030.1 922271-922289 1 0.947
NZ_CP045024_1 1.9|132815|19|NZ_CP045024|CRISPRCasFinder 132815-132833 19 NZ_CP045030.1 275949-275967 2 0.895

1. spacer 1.4|132554|19|NZ_CP045024|CRISPRCasFinder matches to position: 321934-321952, mismatch: 1, identity: 0.947

agatttagaagacgaagat	CRISPR spacer
agaattagaagacgaagat	Protospacer
*** ***************

2. spacer 1.4|132554|19|NZ_CP045024|CRISPRCasFinder matches to position: 4548287-4548305, mismatch: 2, identity: 0.895

agatttagaagacgaagat	CRISPR spacer
agatttagaagaagatgat	Protospacer
************ ** ***

3. spacer 1.5|132596|19|NZ_CP045024|CRISPRCasFinder matches to position: 321934-321952, mismatch: 2, identity: 0.895

agaattagatgacgaggat	CRISPR spacer
agaattagaagacgaagat	Protospacer
********* *****.***

4. spacer 1.9|132815|19|NZ_CP045024|CRISPRCasFinder matches to position: 922271-922289, mismatch: 1, identity: 0.947

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacaaagat	Protospacer
*************.*****

5. spacer 1.9|132815|19|NZ_CP045024|CRISPRCasFinder matches to position: 275949-275967, mismatch: 2, identity: 0.895

ttttgaagaagacgaagat	CRISPR spacer
tttagaagaagccgaagat	Protospacer
*** ******* *******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP045024_1 1.1|132419|19|NZ_CP045024|CRISPRCasFinder 132419-132437 19 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74482-74500 0 1.0
NZ_CP045024_1 1.1|132419|19|NZ_CP045024|CRISPRCasFinder 132419-132437 19 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6377-6395 0 1.0
NZ_CP045024_1 1.1|132419|19|NZ_CP045024|CRISPRCasFinder 132419-132437 19 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264191-264209 0 1.0
NZ_CP045024_1 1.1|132419|19|NZ_CP045024|CRISPRCasFinder 132419-132437 19 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 132911-132929 0 1.0
NZ_CP045024_1 1.1|132419|19|NZ_CP045024|CRISPRCasFinder 132419-132437 19 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 249912-249930 0 1.0
NZ_CP045024_1 1.1|132419|19|NZ_CP045024|CRISPRCasFinder 132419-132437 19 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 132911-132929 0 1.0
NZ_CP045024_1 1.1|132419|19|NZ_CP045024|CRISPRCasFinder 132419-132437 19 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8678-8696 0 1.0
NZ_CP045024_1 1.1|132419|19|NZ_CP045024|CRISPRCasFinder 132419-132437 19 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132419-132437 0 1.0
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74428-74458 0 1.0
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6419-6449 0 1.0
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264233-264263 0 1.0
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 132953-132983 0 1.0
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 249954-249984 0 1.0
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 132953-132983 0 1.0
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8624-8654 0 1.0
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132461-132491 0 1.0
NZ_CP045024_1 1.4|132554|19|NZ_CP045024|CRISPRCasFinder 132554-132572 19 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74347-74365 0 1.0
NZ_CP045024_1 1.4|132554|19|NZ_CP045024|CRISPRCasFinder 132554-132572 19 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8543-8561 0 1.0
NZ_CP045024_1 1.4|132554|19|NZ_CP045024|CRISPRCasFinder 132554-132572 19 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6512-6530 0 1.0
NZ_CP045024_1 1.4|132554|19|NZ_CP045024|CRISPRCasFinder 132554-132572 19 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264326-264344 0 1.0
NZ_CP045024_1 1.4|132554|19|NZ_CP045024|CRISPRCasFinder 132554-132572 19 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 133046-133064 0 1.0
NZ_CP045024_1 1.4|132554|19|NZ_CP045024|CRISPRCasFinder 132554-132572 19 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 250047-250065 0 1.0
NZ_CP045024_1 1.4|132554|19|NZ_CP045024|CRISPRCasFinder 132554-132572 19 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 133046-133064 0 1.0
NZ_CP045024_1 1.4|132554|19|NZ_CP045024|CRISPRCasFinder 132554-132572 19 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132554-132572 0 1.0
NZ_CP045024_1 1.5|132596|19|NZ_CP045024|CRISPRCasFinder 132596-132614 19 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74305-74323 0 1.0
NZ_CP045024_1 1.5|132596|19|NZ_CP045024|CRISPRCasFinder 132596-132614 19 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8501-8519 0 1.0
NZ_CP045024_1 1.5|132596|19|NZ_CP045024|CRISPRCasFinder 132596-132614 19 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6554-6572 0 1.0
NZ_CP045024_1 1.5|132596|19|NZ_CP045024|CRISPRCasFinder 132596-132614 19 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264368-264386 0 1.0
NZ_CP045024_1 1.5|132596|19|NZ_CP045024|CRISPRCasFinder 132596-132614 19 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 133088-133106 0 1.0
NZ_CP045024_1 1.5|132596|19|NZ_CP045024|CRISPRCasFinder 132596-132614 19 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 250089-250107 0 1.0
NZ_CP045024_1 1.5|132596|19|NZ_CP045024|CRISPRCasFinder 132596-132614 19 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 133088-133106 0 1.0
NZ_CP045024_1 1.5|132596|19|NZ_CP045024|CRISPRCasFinder 132596-132614 19 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132596-132614 0 1.0
NZ_CP045024_1 1.6|132638|40|NZ_CP045024|CRISPRCasFinder 132638-132677 40 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6596-6635 0 1.0
NZ_CP045024_1 1.6|132638|40|NZ_CP045024|CRISPRCasFinder 132638-132677 40 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264410-264449 0 1.0
NZ_CP045024_1 1.6|132638|40|NZ_CP045024|CRISPRCasFinder 132638-132677 40 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 133130-133169 0 1.0
NZ_CP045024_1 1.6|132638|40|NZ_CP045024|CRISPRCasFinder 132638-132677 40 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 250131-250170 0 1.0
NZ_CP045024_1 1.6|132638|40|NZ_CP045024|CRISPRCasFinder 132638-132677 40 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 133130-133169 0 1.0
NZ_CP045024_1 1.6|132638|40|NZ_CP045024|CRISPRCasFinder 132638-132677 40 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132638-132677 0 1.0
NZ_CP045024_1 1.6|132638|40|NZ_CP045024|CRISPRCasFinder 132638-132677 40 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74242-74281 0 1.0
NZ_CP045024_1 1.6|132638|40|NZ_CP045024|CRISPRCasFinder 132638-132677 40 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8438-8477 0 1.0
NZ_CP045024_1 1.7|132701|28|NZ_CP045024|CRISPRCasFinder 132701-132728 28 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74191-74218 0 1.0
NZ_CP045024_1 1.7|132701|28|NZ_CP045024|CRISPRCasFinder 132701-132728 28 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8387-8414 0 1.0
NZ_CP045024_1 1.7|132701|28|NZ_CP045024|CRISPRCasFinder 132701-132728 28 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6659-6686 0 1.0
NZ_CP045024_1 1.7|132701|28|NZ_CP045024|CRISPRCasFinder 132701-132728 28 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264473-264500 0 1.0
NZ_CP045024_1 1.7|132701|28|NZ_CP045024|CRISPRCasFinder 132701-132728 28 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 133193-133220 0 1.0
NZ_CP045024_1 1.7|132701|28|NZ_CP045024|CRISPRCasFinder 132701-132728 28 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 250194-250221 0 1.0
NZ_CP045024_1 1.7|132701|28|NZ_CP045024|CRISPRCasFinder 132701-132728 28 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 133193-133220 0 1.0
NZ_CP045024_1 1.7|132701|28|NZ_CP045024|CRISPRCasFinder 132701-132728 28 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132701-132728 0 1.0
NZ_CP045024_1 1.8|132752|40|NZ_CP045024|CRISPRCasFinder 132752-132791 40 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6710-6749 0 1.0
NZ_CP045024_1 1.8|132752|40|NZ_CP045024|CRISPRCasFinder 132752-132791 40 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264524-264563 0 1.0
NZ_CP045024_1 1.8|132752|40|NZ_CP045024|CRISPRCasFinder 132752-132791 40 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 133244-133283 0 1.0
NZ_CP045024_1 1.8|132752|40|NZ_CP045024|CRISPRCasFinder 132752-132791 40 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 250245-250284 0 1.0
NZ_CP045024_1 1.8|132752|40|NZ_CP045024|CRISPRCasFinder 132752-132791 40 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 133244-133283 0 1.0
NZ_CP045024_1 1.8|132752|40|NZ_CP045024|CRISPRCasFinder 132752-132791 40 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132752-132791 0 1.0
NZ_CP045024_1 1.8|132752|40|NZ_CP045024|CRISPRCasFinder 132752-132791 40 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74128-74167 0 1.0
NZ_CP045024_1 1.8|132752|40|NZ_CP045024|CRISPRCasFinder 132752-132791 40 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8324-8363 0 1.0
NZ_CP045024_1 1.9|132815|19|NZ_CP045024|CRISPRCasFinder 132815-132833 19 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 74086-74104 0 1.0
NZ_CP045024_1 1.9|132815|19|NZ_CP045024|CRISPRCasFinder 132815-132833 19 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6773-6791 0 1.0
NZ_CP045024_1 1.9|132815|19|NZ_CP045024|CRISPRCasFinder 132815-132833 19 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264587-264605 0 1.0
NZ_CP045024_1 1.9|132815|19|NZ_CP045024|CRISPRCasFinder 132815-132833 19 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 133307-133325 0 1.0
NZ_CP045024_1 1.9|132815|19|NZ_CP045024|CRISPRCasFinder 132815-132833 19 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 250308-250326 0 1.0
NZ_CP045024_1 1.9|132815|19|NZ_CP045024|CRISPRCasFinder 132815-132833 19 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 133307-133325 0 1.0
NZ_CP045024_1 1.9|132815|19|NZ_CP045024|CRISPRCasFinder 132815-132833 19 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8282-8300 0 1.0
NZ_CP045024_1 1.9|132815|19|NZ_CP045024|CRISPRCasFinder 132815-132833 19 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132815-132833 0 1.0
NZ_CP045024_2 2.1|288957|36|NZ_CP045024|CRISPRCasFinder 288957-288992 36 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 267632-267667 0 1.0
NZ_CP045024_2 2.1|288957|36|NZ_CP045024|CRISPRCasFinder 288957-288992 36 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 162809-162844 0 1.0
NZ_CP045024_2 2.1|288957|36|NZ_CP045024|CRISPRCasFinder 288957-288992 36 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 71022-71057 0 1.0
NZ_CP045024_2 2.1|288957|36|NZ_CP045024|CRISPRCasFinder 288957-288992 36 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 289344-289379 0 1.0
NZ_CP045024_2 2.1|288957|36|NZ_CP045024|CRISPRCasFinder 288957-288992 36 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 56745-56780 0 1.0
NZ_CP045024_2 2.1|288957|36|NZ_CP045024|CRISPRCasFinder 288957-288992 36 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 289345-289380 0 1.0
NZ_CP045024_2 2.1|288957|36|NZ_CP045024|CRISPRCasFinder 288957-288992 36 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 201829-201864 0 1.0
NZ_CP045024_2 2.1|288957|36|NZ_CP045024|CRISPRCasFinder 288957-288992 36 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 288957-288992 0 1.0
NZ_CP045024_2 2.2|289017|30|NZ_CP045024|CRISPRCasFinder 289017-289046 30 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 267578-267607 0 1.0
NZ_CP045024_2 2.2|289017|30|NZ_CP045024|CRISPRCasFinder 289017-289046 30 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 162869-162898 0 1.0
NZ_CP045024_2 2.2|289017|30|NZ_CP045024|CRISPRCasFinder 289017-289046 30 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 71082-71111 0 1.0
NZ_CP045024_2 2.2|289017|30|NZ_CP045024|CRISPRCasFinder 289017-289046 30 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 289404-289433 0 1.0
NZ_CP045024_2 2.2|289017|30|NZ_CP045024|CRISPRCasFinder 289017-289046 30 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 56805-56834 0 1.0
NZ_CP045024_2 2.2|289017|30|NZ_CP045024|CRISPRCasFinder 289017-289046 30 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 289405-289434 0 1.0
NZ_CP045024_2 2.2|289017|30|NZ_CP045024|CRISPRCasFinder 289017-289046 30 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 201775-201804 0 1.0
NZ_CP045024_2 2.2|289017|30|NZ_CP045024|CRISPRCasFinder 289017-289046 30 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 289017-289046 0 1.0
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 KJ019094 Synechococcus phage ACG-2014e isolate Syn7803US33, complete genome 126876-126906 5 0.839
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 KJ019156 Synechococcus phage ACG-2014e isolate Syn7803C2, complete genome 126967-126997 5 0.839
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 KJ019054 Synechococcus phage ACG-2014e isolate Syn7803C85, complete genome 126967-126997 5 0.839
NZ_CP045024_2 2.2|289017|30|NZ_CP045024|CRISPRCasFinder 289017-289046 30 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 39281-39310 5 0.833
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 849306-849336 6 0.806
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MN694597 Marine virus AFVG_250M99, complete genome 9510-9540 6 0.806
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NC_041878 Pectobacterium phage CBB, complete genome 189070-189100 6 0.806
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 73969-73999 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 6878-6908 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 264692-264722 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 133412-133442 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 250413-250443 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 133412-133442 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 8165-8195 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 132920-132950 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MT325768 Psychrobacillus phage Perkons, complete genome 24091-24121 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NC_047815 Erwinia phage vB_EamM_Yoloswag, complete genome 248783-248813 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NC_041887 Rhodococcus phage Weasels2, complete genome 61428-61458 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NC_047920 Citrobacter phage vB_CroP_CrRp3, complete genome 3181-3211 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 LC494302 Escherichia phage SP27 DNA, complete genome 271901-271931 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MH622943 Myoviridae sp. isolate ctbc_4, complete genome 370932-370962 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MK817115 Escherichia phage vB_EcoM_phAPEC6, complete genome 204541-204571 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NC_027364 Escherichia phage PBECO 4, complete genome 12987-13017 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MH383160 Escherichia phage UB, complete genome 73575-73605 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MK327931 Escherichia phage vB_EcoM_G17, complete genome 229835-229865 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 LT603033 Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I 213513-213543 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 KM236246 Bacillus phage Moonbeam, complete genome 124274-124304 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 KM507819 Escherichia phage 121Q, complete genome 272645-272675 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NC_049857 Lactococcus phage P1048, complete genome 82457-82487 7 0.774
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 2052-2082 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP050837 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence 10031-10061 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP008843 Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence 2602-2632 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP024642 Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence 13775-13805 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP024642 Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence 144599-144629 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP042547 Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence 114591-114621 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP011634 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence 26911-26941 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP026718 Klebsiella oxytoca strain AR_0028 plasmid unitig_3_pilon, complete sequence 88033-88063 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MG967616 Bacillus phage v_B-Bak1, complete genome 44632-44662 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NC_047815 Erwinia phage vB_EamM_Yoloswag, complete genome 248759-248789 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 KC595511 Bacillus phage Basilisk, complete genome 45666-45696 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MG967618 Bacillus phage v_B-Bak10, complete genome 46060-46090 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MG967617 Bacillus phage v_B-Bak6, complete genome 44632-44662 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NC_013160 Rippkaea orientalis PCC 8802 plasmid pP880201, complete sequence 58963-58993 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP032289 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.4, complete sequence 43-73 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MG592495 Vibrio phage 1.121.O._10N.286.46.C4, partial genome 130932-130962 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MK448911 Streptococcus phage Javan34, complete genome 36795-36825 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MH518298 Pseudomonas phage SCYZ1, complete genome 16480-16510 8 0.742
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 255363-255393 9 0.71
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 175083-175113 9 0.71
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 83296-83326 9 0.71
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 301618-301648 9 0.71
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 69019-69049 9 0.71
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 301619-301649 9 0.71
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 189560-189590 9 0.71
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 301231-301261 9 0.71
NZ_CP045024_1 1.8|132752|40|NZ_CP045024|CRISPRCasFinder 132752-132791 40 MH844558 Exiguobacterium phage vB_EauM-23, complete genome 29181-29220 9 0.775
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MK448704 Streptococcus phage Javan213, complete genome 32825-32855 10 0.677
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NC_048080 Acinetobacter phage vB_AbaM_B09_Aci05, complete genome 92031-92061 10 0.677
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MT623546 Acinetobacter phage Ab_121, complete genome 42972-43002 10 0.677
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 NC_048074 Acinetobacter phage vB_AbaM_B09_Aci01-1, complete genome 92258-92288 10 0.677
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MH800199 Acinetobacter phage vB_AbaM_B09_Aci02-2, complete genome 92464-92494 10 0.677
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 MT121964 Phage DP SC_6_H4_2017 DNA cytosine methyltransferase and putative helicase genes, complete cds 66589-66619 11 0.645
NZ_CP045024_1 1.2|132461|31|NZ_CP045024|CRISPRCasFinder 132461-132491 31 AP014193 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C71-MedDCM-OCT-S24-C63, *** SEQUENCING IN PROGRESS *** 10293-10323 11 0.645

1. spacer 1.1|132419|19|NZ_CP045024|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

2. spacer 1.1|132419|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

3. spacer 1.1|132419|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

4. spacer 1.1|132419|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

5. spacer 1.1|132419|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

6. spacer 1.1|132419|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

7. spacer 1.1|132419|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

8. spacer 1.1|132419|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agagttcactcatgagccg	CRISPR spacer
agagttcactcatgagccg	Protospacer
*******************

9. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

10. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

11. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

12. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

13. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

14. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

15. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

16. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggaacttattgaagatgaagatgaggaagaa	Protospacer
*******************************

17. spacer 1.4|132554|19|NZ_CP045024|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

18. spacer 1.4|132554|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

19. spacer 1.4|132554|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

20. spacer 1.4|132554|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

21. spacer 1.4|132554|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

22. spacer 1.4|132554|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

23. spacer 1.4|132554|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

24. spacer 1.4|132554|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttagaagacgaagat	CRISPR spacer
agatttagaagacgaagat	Protospacer
*******************

25. spacer 1.5|132596|19|NZ_CP045024|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

26. spacer 1.5|132596|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

27. spacer 1.5|132596|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

28. spacer 1.5|132596|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

29. spacer 1.5|132596|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

30. spacer 1.5|132596|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

31. spacer 1.5|132596|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

32. spacer 1.5|132596|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agaattagatgacgaggat	CRISPR spacer
agaattagatgacgaggat	Protospacer
*******************

33. spacer 1.6|132638|40|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

34. spacer 1.6|132638|40|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

35. spacer 1.6|132638|40|NZ_CP045024|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

36. spacer 1.6|132638|40|NZ_CP045024|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

37. spacer 1.6|132638|40|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

38. spacer 1.6|132638|40|NZ_CP045024|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

39. spacer 1.6|132638|40|NZ_CP045024|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

40. spacer 1.6|132638|40|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

agatttggatgacgaggatgaagattcagaagacgaggat	CRISPR spacer
agatttggatgacgaggatgaagattcagaagacgaggat	Protospacer
****************************************

41. spacer 1.7|132701|28|NZ_CP045024|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

42. spacer 1.7|132701|28|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

43. spacer 1.7|132701|28|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

44. spacer 1.7|132701|28|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

45. spacer 1.7|132701|28|NZ_CP045024|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

46. spacer 1.7|132701|28|NZ_CP045024|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

47. spacer 1.7|132701|28|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

48. spacer 1.7|132701|28|NZ_CP045024|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgagagtggtttagtagacacggat	CRISPR spacer
tgatgagagtggtttagtagacacggat	Protospacer
****************************

49. spacer 1.8|132752|40|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

50. spacer 1.8|132752|40|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

51. spacer 1.8|132752|40|NZ_CP045024|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

52. spacer 1.8|132752|40|NZ_CP045024|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

53. spacer 1.8|132752|40|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

54. spacer 1.8|132752|40|NZ_CP045024|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

55. spacer 1.8|132752|40|NZ_CP045024|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

56. spacer 1.8|132752|40|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
ttctgaagaagacgaggacgaagaattagatgatgaagat	Protospacer
****************************************

57. spacer 1.9|132815|19|NZ_CP045024|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

58. spacer 1.9|132815|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

59. spacer 1.9|132815|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

60. spacer 1.9|132815|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

61. spacer 1.9|132815|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

62. spacer 1.9|132815|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

63. spacer 1.9|132815|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

64. spacer 1.9|132815|19|NZ_CP045024|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaagaagacgaagat	CRISPR spacer
ttttgaagaagacgaagat	Protospacer
*******************

65. spacer 2.1|288957|36|NZ_CP045024|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

66. spacer 2.1|288957|36|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

67. spacer 2.1|288957|36|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

68. spacer 2.1|288957|36|NZ_CP045024|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

69. spacer 2.1|288957|36|NZ_CP045024|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

70. spacer 2.1|288957|36|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

71. spacer 2.1|288957|36|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

72. spacer 2.1|288957|36|NZ_CP045024|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

aagcacctaaaccaacagaacagcctaaagaagagt	CRISPR spacer
aagcacctaaaccaacagaacagcctaaagaagagt	Protospacer
************************************

73. spacer 2.2|289017|30|NZ_CP045024|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

74. spacer 2.2|289017|30|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

75. spacer 2.2|289017|30|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

76. spacer 2.2|289017|30|NZ_CP045024|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

77. spacer 2.2|289017|30|NZ_CP045024|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

78. spacer 2.2|289017|30|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

79. spacer 2.2|289017|30|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

80. spacer 2.2|289017|30|NZ_CP045024|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcaaacacaacaagcgaagtctcaac	CRISPR spacer
ttgctcaaacacaacaagcgaagtctcaac	Protospacer
******************************

81. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to KJ019094 (Synechococcus phage ACG-2014e isolate Syn7803US33, complete genome) position: , mismatch: 5, identity: 0.839

ggaact--tattgaagatgaagatgaggaagaa	CRISPR spacer
--atctggtattgaagaggaagatgaagaagaa	Protospacer
  * **  ********* ********.******

82. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to KJ019156 (Synechococcus phage ACG-2014e isolate Syn7803C2, complete genome) position: , mismatch: 5, identity: 0.839

ggaact--tattgaagatgaagatgaggaagaa	CRISPR spacer
--atctggtattgaagaggaagatgaagaagaa	Protospacer
  * **  ********* ********.******

83. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to KJ019054 (Synechococcus phage ACG-2014e isolate Syn7803C85, complete genome) position: , mismatch: 5, identity: 0.839

ggaact--tattgaagatgaagatgaggaagaa	CRISPR spacer
--atctggtattgaagaggaagatgaagaagaa	Protospacer
  * **  ********* ********.******

84. spacer 2.2|289017|30|NZ_CP045024|CRISPRCasFinder matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 5, identity: 0.833

ttgctc-aaacacaacaagcgaagtctcaac	CRISPR spacer
-tgcacgaaacacaacaagcgaactcgcaaa	Protospacer
 *** * **************** ** *** 

85. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 6, identity: 0.806

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
gcagcttattgaagaggaagatgatgaagtt	Protospacer
* *.*********** ******** ****  

86. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MN694597 (Marine virus AFVG_250M99, complete genome) position: , mismatch: 6, identity: 0.806

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
gtatccttttgcagatgaagatgaggaggaa	Protospacer
* * *.* *** ***************.***

87. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NC_041878 (Pectobacterium phage CBB, complete genome) position: , mismatch: 6, identity: 0.806

ggaactta--ttgaagatgaagatgaggaagaa	CRISPR spacer
--aagtgaatttgatgatgaagatgacgaagaa	Protospacer
  ** * *  **** *********** ******

88. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

89. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

90. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

91. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

92. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

93. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

94. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

95. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgatatcatcgaagacgaagatgaggaagat	Protospacer
 **  *.**.*****.************** 

96. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MT325768 (Psychrobacillus phage Perkons, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
atggattattgaaaatgaatatgaggaagaa	Protospacer
. .. ********.***** ***********

97. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NC_047815 (Erwinia phage vB_EamM_Yoloswag, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ggacgaagatgaagatgaagatgaggacgaa	Protospacer
***    . ****************** ***

98. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NC_041887 (Rhodococcus phage Weasels2, complete genome) position: , mismatch: 7, identity: 0.774

----ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
gcgcgga----tttgaagatgaagatgagggagat	Protospacer
    ***     ******************.*** 

99. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NC_047920 (Citrobacter phage vB_CroP_CrRp3, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttat-tgaagatgaagatgaggaagaa	CRISPR spacer
-agtctggtatgaagatgaagaagaggaagaa	Protospacer
 .. ** .* ************ *********

100. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to LC494302 (Escherichia phage SP27 DNA, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaatcagttgaagaagacgatgaggaagaa	Protospacer
.***.. .******* ** ************

101. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MH622943 (Myoviridae sp. isolate ctbc_4, complete genome) position: , mismatch: 7, identity: 0.774

---ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
tatcgaat---ttgaagatgaagatgatgaggaa	Protospacer
    ***.   **************** **.***

102. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MK817115 (Escherichia phage vB_EcoM_phAPEC6, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaatcagttgaagaagacgatgaggaagaa	Protospacer
.***.. .******* ** ************

103. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NC_027364 (Escherichia phage PBECO 4, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaatcagttgaagaagacgatgaggaagaa	Protospacer
.***.. .******* ** ************

104. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MH383160 (Escherichia phage UB, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaatcagttgaagaagacgatgaggaagaa	Protospacer
.***.. .******* ** ************

105. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MK327931 (Escherichia phage vB_EcoM_G17, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaatcagttgaagaagacgatgaggaagaa	Protospacer
.***.. .******* ** ************

106. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to LT603033 (Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaatcagttgaagaagacgatgaggaagaa	Protospacer
.***.. .******* ** ************

107. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to KM236246 (Bacillus phage Moonbeam, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgaacgtattgtagatgaagatgaaaaacac	Protospacer
 **** ***** ************..** * 

108. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaatcagttgaagaagacgatgaggaagaa	Protospacer
.***.. .******* ** ************

109. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NC_049857 (Lactococcus phage P1048, complete genome) position: , mismatch: 7, identity: 0.774

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agagttatttgaagatgatgatgaagaagaa	Protospacer
.**..*  ********** *****.******

110. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
tgcctgtattgaagatgaagataaggcagat	Protospacer
 *  . ****************.*** *** 

111. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP050837 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ctacgtagatgaagatgaagatgaagaagaa	Protospacer
  *  * . ***************.******

112. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP008843 (Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ctacgtagatgaagatgaagatgaagaagaa	Protospacer
  *  * . ***************.******

113. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP024642 (Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ctacgtagatgaagatgaagatgaagaagaa	Protospacer
  *  * . ***************.******

114. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP024642 (Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ctacgtagatgaagatgaagatgaagaagaa	Protospacer
  *  * . ***************.******

115. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP042547 (Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ctacgtagatgaagatgaagatgaagaagaa	Protospacer
  *  * . ***************.******

116. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ctacgtagatgaagatgaagatgaagaagaa	Protospacer
  *  * . ***************.******

117. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP026718 (Klebsiella oxytoca strain AR_0028 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ctacgtagatgaagatgaagatgaagaagaa	Protospacer
  *  * . ***************.******

118. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MG967616 (Bacillus phage v_B-Bak1, complete genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agttggtattgaagatgaagttgaggaatta	Protospacer
.*    ************** *******  *

119. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NC_047815 (Erwinia phage vB_EamM_Yoloswag, complete genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
cgacgaagatgaagatgaagatgaggacgaa	Protospacer
 **    . ****************** ***

120. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to KC595511 (Bacillus phage Basilisk, complete genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agttggtattgaagatgaagttgaggaatta	Protospacer
.*    ************** *******  *

121. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MG967618 (Bacillus phage v_B-Bak10, complete genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agttggtattgaagatgaagttgaggaatta	Protospacer
.*    ************** *******  *

122. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MG967617 (Bacillus phage v_B-Bak6, complete genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agttggtattgaagatgaagttgaggaatta	Protospacer
.*    ************** *******  *

123. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NC_013160 (Rippkaea orientalis PCC 8802 plasmid pP880201, complete sequence) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ttatttaattgaacatgaagatgacgaagat	Protospacer
  * .* ****** ********** ***** 

124. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP032289 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.4, complete sequence) position: , mismatch: 8, identity: 0.742

---ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
ttcaaaat---ttgaagatgaagatgaagatgaa	Protospacer
   ..**.   ****************.** ***

125. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MG592495 (Vibrio phage 1.121.O._10N.286.46.C4, partial genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
tgtgtatcttgaagtagaagatgaggaagaa	Protospacer
 * .. * ******  ***************

126. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
tcagtttattgaagctgaagaggaggaaaag	Protospacer
  *..********* ****** ******.*.

127. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MH518298 (Pseudomonas phage SCYZ1, complete genome) position: , mismatch: 8, identity: 0.742

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
gttctatgttgaagatgaagaagaggaggaa	Protospacer
*   . *.************* *****.***

128. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

129. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

130. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

131. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

132. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

133. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

134. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

135. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.71

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
agaaccaattgaagatgaagatgaaatcgtt	Protospacer
.****. *****************..  *  

136. spacer 1.8|132752|40|NZ_CP045024|CRISPRCasFinder matches to MH844558 (Exiguobacterium phage vB_EauM-23, complete genome) position: , mismatch: 9, identity: 0.775

ttctgaagaagacgaggacgaagaattagatgatgaagat	CRISPR spacer
tgcctaaaccgacgaggacgaagaatgtgatgatgaagaa	Protospacer
* *. **.  ****************  *********** 

137. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MK448704 (Streptococcus phage Javan213, complete genome) position: , mismatch: 10, identity: 0.677

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
acgctggattgaagatgaagaacaggaagag	Protospacer
. . .  **************  *******.

138. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NC_048080 (Acinetobacter phage vB_AbaM_B09_Aci05, complete genome) position: , mismatch: 10, identity: 0.677

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
aagtattattgaggatgaagatgagcaattc	Protospacer
...  *******.************ **   

139. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MT623546 (Acinetobacter phage Ab_121, complete genome) position: , mismatch: 10, identity: 0.677

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
aagtattattgaggatgaagatgagcaattc	Protospacer
...  *******.************ **   

140. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to NC_048074 (Acinetobacter phage vB_AbaM_B09_Aci01-1, complete genome) position: , mismatch: 10, identity: 0.677

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
aagtattattgaggatgaagatgagcaattc	Protospacer
...  *******.************ **   

141. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MH800199 (Acinetobacter phage vB_AbaM_B09_Aci02-2, complete genome) position: , mismatch: 10, identity: 0.677

ggaacttattgaagatgaagatgaggaagaa	CRISPR spacer
aagtattattgaggatgaagatgagcaattc	Protospacer
...  *******.************ **   

142. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to MT121964 (Phage DP SC_6_H4_2017 DNA cytosine methyltransferase and putative helicase genes, complete cds) position: , mismatch: 11, identity: 0.645

ggaacttattgaagatgaagatgaggaagaa------	CRISPR spacer
------tactgatgatgaagatgaagaggaggaagaa	Protospacer
      **.*** ***********.**.**.      

143. spacer 1.2|132461|31|NZ_CP045024|CRISPRCasFinder matches to AP014193 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C71-MedDCM-OCT-S24-C63, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 11, identity: 0.645

ggaacttattgaagatgaagatgaggaagaa------	CRISPR spacer
------cgatgaagatgaagatgaagaagaggaagaa	Protospacer
      .. ***************.*****.      

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 116711 : 126511 16 Bacillus_phage(83.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CP045027
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 113 : 14576 22 Bacillus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage