Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP043036 Escherichia coli strain XDL plasmid pXDL-MCR-1.18, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP043033 Escherichia coli strain XDL chromosome, complete genome 3 crisprs cas3,csa3,WYL,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,DinG,c2c9_V-U4 0 19 7 0
NZ_CP043037 Escherichia coli strain XDL plasmid pXDL-4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP043034 Escherichia coli strain XDL plasmid pXDL-CTX-M-14, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP043035 Escherichia coli strain XDL plasmid pXDL-2, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP043038 Escherichia coli strain XDL plasmid pXDL-5, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP043034
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 71662 : 182069 117 Escherichia_phage(30.3%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP043033
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043033_1 97693-97831 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043033_2 1283198-1284507 TypeI-E I-E
21 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP043033_3 4173295-4173427 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP043033_3 3.1|4173312|42|NZ_CP043033|PILER-CR 4173312-4173353 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 1 0.976
NZ_CP043033_3 3.2|4173371|40|NZ_CP043033|PILER-CR 4173371-4173410 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95
NZ_CP043033_2 2.3|1283350|31|NZ_CP043033|PILER-CR 1283350-1283380 31 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 1147088-1147118 5 0.839
NZ_CP043033_2 2.7|1283349|32|NZ_CP043033|CRISPRCasFinder,CRT 1283349-1283380 32 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 1147087-1147118 6 0.812
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP019190 Salmonella enterica subsp. enterica serovar Poona str. ATCC BAA-1673 plasmid pATCCBAA1673_01, complete sequence 127024-127055 6 0.812
NZ_CP043033_2 2.2|1283289|31|NZ_CP043033|PILER-CR 1283289-1283319 31 NC_022995 Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence 549628-549658 7 0.774
NZ_CP043033_2 2.3|1283350|31|NZ_CP043033|PILER-CR 1283350-1283380 31 NZ_CP051294 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence 300773-300803 7 0.774
NZ_CP043033_2 2.3|1283350|31|NZ_CP043033|PILER-CR 1283350-1283380 31 NZ_CP033363 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence 300760-300790 7 0.774
NZ_CP043033_2 2.7|1283349|32|NZ_CP043033|CRISPRCasFinder,CRT 1283349-1283380 32 NZ_CP009882 Pantoea sp. PSNIH1 plasmid pPSP-26e, complete sequence 40690-40721 7 0.781
NZ_CP043033_2 2.7|1283349|32|NZ_CP043033|CRISPRCasFinder,CRT 1283349-1283380 32 NZ_CP051294 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence 300772-300803 7 0.781
NZ_CP043033_2 2.7|1283349|32|NZ_CP043033|CRISPRCasFinder,CRT 1283349-1283380 32 NZ_CP033363 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence 300759-300790 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP030198 Salmonella enterica strain SA20051401 plasmid pSA20051401.2, complete sequence 4936-4967 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP030198 Salmonella enterica strain SA20051401 plasmid pSA20051401.2, complete sequence 128920-128951 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP022035 Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed2, complete sequence 87665-87696 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP025255 Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 plasmid pSNE1-2010K-2159, complete sequence 50764-50795 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NC_019342 Salmonella sp. 14 plasmid p14-120, complete sequence 91854-91885 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NC_021871 Salmonella bongori N268-08 plasmid RM1, complete sequence 59417-59448 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP030197 Salmonella enterica strain SA20051401 plasmid pSA20051401.1, complete sequence 74730-74761 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP053580 Salmonella enterica strain 94-0093 plasmid unnamed, complete sequence 113674-113705 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP022137 Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed2, complete sequence 1091-1122 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP022118 Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence 88540-88571 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NC_019125 Salmonella enterica subsp. salamae plasmid pSGSC3045-121, complete sequence 51741-51772 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NC_019125 Salmonella enterica subsp. salamae plasmid pSGSC3045-121, complete sequence 57651-57682 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP022660 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence 171714-171745 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP045061 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence 170875-170906 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP023469 Salmonella enterica subsp. enterica strain BAA-1586 plasmid pSalMiami, complete sequence 43010-43041 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP045054 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence 170888-170919 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP045058 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence 170885-170916 7 0.781
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP045959 Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 plasmid pAUSMDU00010532_01, complete sequence 196996-197027 7 0.781
NZ_CP043033_2 2.24|1284386|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR 1284386-1284417 32 NZ_CP024975 Escherichia coli strain CV839-15 plasmid pCV839-15-p1, complete sequence 66116-66147 7 0.781
NZ_CP043033_2 2.6|1283288|32|NZ_CP043033|CRISPRCasFinder,CRT 1283288-1283319 32 NC_022995 Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence 549628-549659 8 0.75
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1551934-1551965 8 0.75
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP044528 Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence 28753-28784 8 0.75
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP008789 Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence 128146-128177 8 0.75
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 66428-66459 8 0.75
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 71946-71977 8 0.75
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP029143 Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence 109947-109978 8 0.75
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP011634 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence 138644-138675 8 0.75
NZ_CP043033_2 2.13|1283715|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR 1283715-1283746 32 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 220383-220414 8 0.75
NZ_CP043033_2 2.17|1283959|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR 1283959-1283990 32 MH133207 Acinetobacter phage vB_AbaM_B9, complete genome 87648-87679 8 0.75
NZ_CP043033_2 2.21|1284203|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR 1284203-1284234 32 NC_015170 Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence 58292-58323 8 0.75
NZ_CP043033_2 2.1|1283228|31|NZ_CP043033|PILER-CR 1283228-1283258 31 MN693415 Marine virus AFVG_25M102, complete genome 5687-5717 9 0.71
NZ_CP043033_2 2.4|1283411|31|NZ_CP043033|PILER-CR 1283411-1283441 31 MN937349 Stenotrophomonas phage vB_SmaS_BUCT548, complete genome 13859-13889 9 0.71
NZ_CP043033_2 2.7|1283349|32|NZ_CP043033|CRISPRCasFinder,CRT 1283349-1283380 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 126951-126982 9 0.719
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP041047 Citrobacter sp. CF971 plasmid pBM527-1, complete sequence 6870-6901 9 0.719
NZ_CP043033_2 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT 1283532-1283563 32 NZ_CP033743 Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence 70911-70942 9 0.719
NZ_CP043033_2 2.20|1284142|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR 1284142-1284173 32 NZ_CP032314 Pannonibacter phragmitetus BB plasmid p.BB_2, complete sequence 58546-58577 9 0.719
NZ_CP043033_2 2.23|1284325|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR 1284325-1284356 32 NC_020865 Cyanophage KBS-P-1A genomic sequence 41617-41648 9 0.719
NZ_CP043033_2 2.23|1284325|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR 1284325-1284356 32 HQ317389 Synechococcus phage S-RIP2 genomic sequence 22039-22070 9 0.719
NZ_CP043033_2 2.23|1284325|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR 1284325-1284356 32 KC011005 Synechococcus phage S-RIP2 isolate N_01_1007 photosystem II D1 protein (psbA) gene, complete cds 429-460 9 0.719
NZ_CP043033_2 2.24|1284386|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR 1284386-1284417 32 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1856586-1856617 9 0.719
NZ_CP043033_2 2.24|1284386|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR 1284386-1284417 32 MN234187 Mycobacterium phage DyoEdafos, complete genome 33938-33969 9 0.719
NZ_CP043033_2 2.24|1284386|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR 1284386-1284417 32 MG603697 Vibrio phage Vp_R1, complete genome 41873-41904 9 0.719
NZ_CP043033_2 2.5|1283227|32|NZ_CP043033|CRISPRCasFinder,CRT 1283227-1283258 32 MN693415 Marine virus AFVG_25M102, complete genome 5687-5718 10 0.688
NZ_CP043033_2 2.8|1283410|32|NZ_CP043033|CRISPRCasFinder,CRT 1283410-1283441 32 MN937349 Stenotrophomonas phage vB_SmaS_BUCT548, complete genome 13858-13889 10 0.688
NZ_CP043033_2 2.15|1283837|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR 1283837-1283868 32 NZ_CP032678 Pseudomonas sp. Leaf58 plasmid pBASL58, complete sequence 298322-298353 10 0.688
NZ_CP043033_2 2.22|1284264|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR 1284264-1284295 32 NZ_LN831184 Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence 302156-302187 11 0.656

1. spacer 3.1|4173312|42|NZ_CP043033|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.976

tgtcacacgcagataaatccaactttcaatattgttaagctc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
***************************************.**

2. spacer 3.2|4173371|40|NZ_CP043033|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95

catggcgtagcaaaaagaaattttcaatattgttttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********** *********************.*******

3. spacer 2.3|1283350|31|NZ_CP043033|PILER-CR matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.839

gaagaagcggtaaagcgggttccagttcagc--	CRISPR spacer
gaaggcgcggtaaagcgggttccgg--cagcgg	Protospacer
****. *****************.*  ****  

4. spacer 2.7|1283349|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ggaagaagcggtaaagcgggttccagttcagc--	CRISPR spacer
tgaaggcgcggtaaagcgggttccgg--cagcgg	Protospacer
 ****. *****************.*  ****  

5. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP019190 (Salmonella enterica subsp. enterica serovar Poona str. ATCC BAA-1673 plasmid pATCCBAA1673_01, complete sequence) position: , mismatch: 6, identity: 0.812

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccggaggccgatgcggtggccatgctgaaagg	Protospacer
**.*.*. *** ** *****************

6. spacer 2.2|1283289|31|NZ_CP043033|PILER-CR matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 7, identity: 0.774

tgaacgtgacaacgcccgcgacagaaacgtc	CRISPR spacer
ctaaaaagacaagggccgcgacagaaacgtc	Protospacer
. ** . ***** * ****************

7. spacer 2.3|1283350|31|NZ_CP043033|PILER-CR matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 7, identity: 0.774

gaagaagcggtaaagcgggttccagttcagc	CRISPR spacer
gccgaagcggtcgagcgggttccagtctggc	Protospacer
*  ******** .*************...**

8. spacer 2.3|1283350|31|NZ_CP043033|PILER-CR matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 7, identity: 0.774

gaagaagcggtaaagcgggttccagttcagc	CRISPR spacer
gccgaagcggtcgagcgggttccagtctggc	Protospacer
*  ******** .*************...**

9. spacer 2.7|1283349|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP009882 (Pantoea sp. PSNIH1 plasmid pPSP-26e, complete sequence) position: , mismatch: 7, identity: 0.781

ggaagaagcggtaaagcgggttccagttcagc--	CRISPR spacer
ggaagatccggtaaagcgggttcagg--cggctg	Protospacer
******  *************** .*  *.**  

10. spacer 2.7|1283349|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 7, identity: 0.781

ggaagaagcggtaaagcgggttccagttcagc	CRISPR spacer
ggccgaagcggtcgagcgggttccagtctggc	Protospacer
**  ******** .*************...**

11. spacer 2.7|1283349|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 7, identity: 0.781

ggaagaagcggtaaagcgggttccagttcagc	CRISPR spacer
ggccgaagcggtcgagcgggttccagtctggc	Protospacer
**  ******** .*************...**

12. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP030198 (Salmonella enterica strain SA20051401 plasmid pSA20051401.2, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggctatgctgaaagg	Protospacer
**.** . .** ********.***********

13. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP030198 (Salmonella enterica strain SA20051401 plasmid pSA20051401.2, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggctatgctgaaagg	Protospacer
**.** . .** ********.***********

14. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP022035 (Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggctatgctgaaagg	Protospacer
**.** . .** ********.***********

15. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP025255 (Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 plasmid pSNE1-2010K-2159, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggccatgctcaaagg	Protospacer
**.** . .** ************** *****

16. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NC_019342 (Salmonella sp. 14 plasmid p14-120, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggctatgctgaaagg	Protospacer
**.** . .** ********.***********

17. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NC_021871 (Salmonella bongori N268-08 plasmid RM1, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggctatgctgaaagg	Protospacer
**.** . .** ********.***********

18. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP030197 (Salmonella enterica strain SA20051401 plasmid pSA20051401.1, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggctatgctgaaagg	Protospacer
**.** . .** ********.***********

19. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP053580 (Salmonella enterica strain 94-0093 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggctatgctgaaagg	Protospacer
**.** . .** ********.***********

20. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP022137 (Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggctatgctgaaagg	Protospacer
**.** . .** ********.***********

21. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP022118 (Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggctatgctgaaagg	Protospacer
**.** . .** ********.***********

22. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NC_019125 (Salmonella enterica subsp. salamae plasmid pSGSC3045-121, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgcagatgcagtggccatgctgaaagg	Protospacer
**.** .  ** ** *****************

23. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NC_019125 (Salmonella enterica subsp. salamae plasmid pSGSC3045-121, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggctatgctgaaagg	Protospacer
**.** . .** ********.***********

24. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggctatgctgaaagg	Protospacer
**.** . .** ********.***********

25. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP045061 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggctatgctgaaagg	Protospacer
**.** . .** ********.***********

26. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP023469 (Salmonella enterica subsp. enterica strain BAA-1586 plasmid pSalMiami, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggctatgctgaaagg	Protospacer
**.** . .** ********.***********

27. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP045054 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggctatgctgaaagg	Protospacer
**.** . .** ********.***********

28. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP045058 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccgggtgctgatgctgtggctatgctgaaagg	Protospacer
**.** . .** ********.***********

29. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP045959 (Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 plasmid pAUSMDU00010532_01, complete sequence) position: , mismatch: 7, identity: 0.781

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccggaaaatgaggcggtggccatgctgaaagg	Protospacer
**.*..*..**.** *****************

30. spacer 2.24|1284386|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024975 (Escherichia coli strain CV839-15 plasmid pCV839-15-p1, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgccttaagttccttaacttcctctgtat	CRISPR spacer
ttgcgccttaagctccttaacctctccggcgt	Protospacer
************.********.**..* *..*

31. spacer 2.6|1283288|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 8, identity: 0.75

gtgaacgtgacaacgcccgcgacagaaacgtc	CRISPR spacer
cctaaaaagacaagggccgcgacagaaacgtc	Protospacer
 . ** . ***** * ****************

32. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.75

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
ccagggagcgaagctgtggcgatttatccaag	Protospacer
******************** ** .    *.*

33. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 8, identity: 0.75

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
cccgaagcggatgcggtggccatgctgaaagg	Protospacer
** *...  ** ** *****************

34. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 8, identity: 0.75

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
cccgaagcggatgcggtggccatgctgaaagg	Protospacer
** *...  ** ** *****************

35. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 8, identity: 0.75

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
cccgaagcggatgcggtggccatgctgaaagg	Protospacer
** *...  ** ** *****************

36. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 8, identity: 0.75

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
cccgaagcggatgcggtggccatgctgaaagg	Protospacer
** *...  ** ** *****************

37. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP029143 (Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
cccgaagcggatgcggtggccatgctgaaagg	Protospacer
** *...  ** ** *****************

38. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 8, identity: 0.75

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
cccgaagcggatgcggtggccatgctgaaagg	Protospacer
** *...  ** ** *****************

39. spacer 2.13|1283715|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gctgccgcgctttcggtgtgggagcagtatga	CRISPR spacer
gtcgccgagcattcggtgtgggagcagcgggt	Protospacer
*..**** ** ****************.. * 

40. spacer 2.17|1283959|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR matches to MH133207 (Acinetobacter phage vB_AbaM_B9, complete genome) position: , mismatch: 8, identity: 0.75

tcgttgatggtgtgatgagtgtacaaaaaaaa	CRISPR spacer
ttgagcttggtgtgattagtgtacaagaaaat	Protospacer
*.*    ********* *********.**** 

41. spacer 2.21|1284203|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR matches to NC_015170 (Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence) position: , mismatch: 8, identity: 0.75

tctgtgtattcgctaccagccagcaccggtac	CRISPR spacer
gccttgcattcgctaccagccagcgccgaagc	Protospacer
 *. **.*****************.***. .*

42. spacer 2.1|1283228|31|NZ_CP043033|PILER-CR matches to MN693415 (Marine virus AFVG_25M102, complete genome) position: , mismatch: 9, identity: 0.71

tgaccataagggcatttcatactgccttgct	CRISPR spacer
acaccataagggcgtttcattctgcgatata	Protospacer
  ***********.****** ****  *.. 

43. spacer 2.4|1283411|31|NZ_CP043033|PILER-CR matches to MN937349 (Stenotrophomonas phage vB_SmaS_BUCT548, complete genome) position: , mismatch: 9, identity: 0.71

aattaatttcgaaacgggcgttgatggtgaa	CRISPR spacer
gggttcgttcgaacagggcgttgatggtgag	Protospacer
.. *   ******  ***************.

44. spacer 2.7|1283349|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

ggaagaagcggtaaagcgggttccagttcagc	CRISPR spacer
ggaagaagcggccaagcgggttctgatagaag	Protospacer
***********. **********...*  *. 

45. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP041047 (Citrobacter sp. CF971 plasmid pBM527-1, complete sequence) position: , mismatch: 9, identity: 0.719

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
gacggcgctgaggcggtggccatgctgaaagg	Protospacer
   ** . .**.** *****************

46. spacer 2.10|1283532|32|NZ_CP043033|CRISPRCasFinder,CRT matches to NZ_CP033743 (Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ccagggagcgaagctgtggccatgctgaaagg	CRISPR spacer
tccgaagcggatgcggtggccatgctgaaagg	Protospacer
.* *...  ** ** *****************

47. spacer 2.20|1284142|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032314 (Pannonibacter phragmitetus BB plasmid p.BB_2, complete sequence) position: , mismatch: 9, identity: 0.719

cagtaaacgttcgcgcgttctcgcgctcacga	CRISPR spacer
cgggctctattcgctcgttctcgcgcgcacga	Protospacer
*.*    ..***** *********** *****

48. spacer 2.23|1284325|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR matches to NC_020865 (Cyanophage KBS-P-1A genomic sequence) position: , mismatch: 9, identity: 0.719

gggttttagcgaccggaccagagtacgcaaca	CRISPR spacer
tcgcagcggcgacaggagcagagtacgcaaca	Protospacer
  *.  ..***** *** **************

49. spacer 2.23|1284325|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR matches to HQ317389 (Synechococcus phage S-RIP2 genomic sequence) position: , mismatch: 9, identity: 0.719

gggttttagcgaccggaccagagtacgcaaca	CRISPR spacer
tcgcagcggcgacaggagcagagtacgcaaca	Protospacer
  *.  ..***** *** **************

50. spacer 2.23|1284325|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR matches to KC011005 (Synechococcus phage S-RIP2 isolate N_01_1007 photosystem II D1 protein (psbA) gene, complete cds) position: , mismatch: 9, identity: 0.719

gggttttagcgaccggaccagagtacgcaaca	CRISPR spacer
tcgcagcggcgacaggagcagagtacgcaaca	Protospacer
  *.  ..***** *** **************

51. spacer 2.24|1284386|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719

ttgcgccttaagttccttaacttcctctgtat	CRISPR spacer
gagcgccttaagttccttcgcttcctcgacgg	Protospacer
  **************** .******* ... 

52. spacer 2.24|1284386|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR matches to MN234187 (Mycobacterium phage DyoEdafos, complete genome) position: , mismatch: 9, identity: 0.719

ttgcgccttaagttccttaacttcctctgtat	CRISPR spacer
cgcggccttaagttcgttaactgcctcagcgt	Protospacer
.   *********** ****** **** *..*

53. spacer 2.24|1284386|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR matches to MG603697 (Vibrio phage Vp_R1, complete genome) position: , mismatch: 9, identity: 0.719

ttgcgcct----taagttccttaacttcctctgtat	CRISPR spacer
----gtttcggataatttccttagcttcctctgtaa	Protospacer
    *..*    *** *******.*********** 

54. spacer 2.5|1283227|32|NZ_CP043033|CRISPRCasFinder,CRT matches to MN693415 (Marine virus AFVG_25M102, complete genome) position: , mismatch: 10, identity: 0.688

gtgaccataagggcatttcatactgccttgct	CRISPR spacer
tacaccataagggcgtttcattctgcgatata	Protospacer
   ***********.****** ****  *.. 

55. spacer 2.8|1283410|32|NZ_CP043033|CRISPRCasFinder,CRT matches to MN937349 (Stenotrophomonas phage vB_SmaS_BUCT548, complete genome) position: , mismatch: 10, identity: 0.688

aaattaatttcgaaacgggcgttgatggtgaa	CRISPR spacer
tgggttcgttcgaacagggcgttgatggtgag	Protospacer
 .. *   ******  ***************.

56. spacer 2.15|1283837|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032678 (Pseudomonas sp. Leaf58 plasmid pBASL58, complete sequence) position: , mismatch: 10, identity: 0.688

ttggtattaacgggaatgtagtcactccagga	CRISPR spacer
cacagagaaacgtcaatgtagtcactccaggc	Protospacer
.  . *  ****  ***************** 

57. spacer 2.22|1284264|32|NZ_CP043033|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN831184 (Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence) position: , mismatch: 11, identity: 0.656

cagggtaactggctgctcctcaaccattccgc	CRISPR spacer
gtcatctactggctgcgcctcaatcattccag	Protospacer
   . . ********* ******.******. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 79809 : 126299 36 Stx2-converting_phage(43.75%) transposase NA
DBSCAN-SWA_2 977538 : 1010081 16 Escherichia_phage(25.0%) transposase NA
DBSCAN-SWA_3 1024482 : 1075893 42 Stx2-converting_phage(27.27%) transposase,integrase,tRNA attL 1043449:1043464|attR 1082396:1082411
DBSCAN-SWA_4 1668298 : 1681220 6 Escherichia_phage(83.33%) integrase attL 1661109:1661123|attR 1670932:1670946
DBSCAN-SWA_5 2970899 : 3022271 63 Escherichia_phage(45.83%) protease,tail,integrase,portal,capsid,transposase,head,terminase,holin attL 2999160:2999175|attR 3029195:3029210
DBSCAN-SWA_6 3079489 : 3166105 94 Shigella_phage(48.39%) tail,plate,protease,integrase,portal,capsid,transposase,head,terminase,holin attL 3080439:3080454|attR 3171537:3171552
DBSCAN-SWA_7 3898908 : 3917974 21 Salmonella_phage(12.5%) integrase attL 3910643:3910657|attR 3917354:3917368
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP043035
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 33888 : 97048 59 Stx2-converting_phage(27.27%) integrase,transposase attL 60693:60708|attR 86156:86171
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage