Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP042549 Klebsiella michiganensis strain C52 plasmid pC52_004, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP042548 Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence 1 crisprs NA 0 1 1 0
NZ_CP042550 Klebsiella michiganensis strain C52 plasmid pC52_005, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP042545 Klebsiella michiganensis strain C52 chromosome, complete genome 4 crisprs cas14j,csa3,RT,cas3,DEDDh,DinG,WYL 0 2 4 0
NZ_CP042546 Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence 0 crisprs csa3,cas3 0 0 1 0
NZ_CP042547 Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence 0 crisprs RT 0 0 2 0

Results visualization

1. NZ_CP042545
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042545_1 428869-428959 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042545_2 4230235-4230442 Orphan I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042545_3 4581622-4581731 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042545_4 5489094-5489219 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP022118 Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence 380154-380185 2 0.938
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP030176 Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 plasmid pIncFII.1, complete sequence 104205-104236 2 0.938
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP026283 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence 32224-32255 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 121749-121780 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP032197 Klebsiella pneumoniae strain AR_0097 plasmid unnamed3, complete sequence 61807-61838 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_KP345882 Escherichia coli strain BK32533 plasmid pBK32533, complete sequence 15850-15881 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP043048 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-2, complete sequence 36554-36585 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP019900 Raoultella planticola strain GODA plasmid unnamed1, complete sequence 31159-31190 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP029448 Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence 184972-185003 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 87219-87250 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP025039 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence 1948-1979 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP031811 Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence 160072-160103 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 86044-86075 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 180553-180584 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 MN310380 Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence 153684-153715 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP023840 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence 13418-13449 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP018815 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence 96313-96344 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP042483 Klebsiella pneumoniae strain C51 plasmid pC51_002, complete sequence 198101-198132 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP027616 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence 96499-96530 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP010881 Escherichia coli strain MNCRE44 plasmid pMNCRE44_5, complete sequence 110494-110525 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP009275 Klebsiella variicola strain DX120E plasmid pKV1, complete sequence 63439-63470 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NC_025131 Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence 83844-83875 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP029583 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence 98483-98514 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP010363 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence 30013-30044 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 150899-150930 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 123521-123552 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP009773 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pKPC-63d, complete sequence 15852-15883 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP009776 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPC-def, complete sequence 15844-15875 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP006926 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N2, complete sequence 15852-15883 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP022825 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence 45342-45373 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP015387 Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence 83836-83867 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP038276 Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence 26799-26830 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NC_021199 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence 15327-15358 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP011641 Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence 129965-129996 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP011633 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence 34201-34232 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP011633 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence 47402-47433 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP014697 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence 42078-42109 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 256525-256556 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 15757-15788 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP035211 Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence 125920-125951 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 56886-56917 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 67607-67638 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 103997-104028 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP021900 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0136 plasmid tig00001437_pilon, complete sequence 18960-18991 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP021778 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_3, complete sequence 6216-6247 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP044049 Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence 108487-108518 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_LR130540 Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2 151980-152011 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 155914-155945 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 171530-171561 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 171657-171688 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_MG462728 Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence 180671-180702 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP033755 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence 19828-19859 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 NZ_CP054255 Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence 96507-96538 3 0.906
NZ_CP042545_2 2.1|4230263|32|NZ_CP042545|CRT 4230263-4230294 32 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 173343-173374 4 0.875
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP022118 Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence 380153-380189 6 0.838
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP030176 Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 plasmid pIncFII.1, complete sequence 104204-104240 6 0.838
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP032197 Klebsiella pneumoniae strain AR_0097 plasmid unnamed3, complete sequence 61806-61842 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_KP345882 Escherichia coli strain BK32533 plasmid pBK32533, complete sequence 15849-15885 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP043048 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-2, complete sequence 36553-36589 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP019900 Raoultella planticola strain GODA plasmid unnamed1, complete sequence 31158-31194 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP029448 Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence 184971-185007 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 87218-87254 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP025039 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence 1947-1983 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 86043-86079 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP023840 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence 13417-13453 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP009275 Klebsiella variicola strain DX120E plasmid pKV1, complete sequence 63438-63474 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NC_025131 Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence 83843-83879 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP010363 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence 30012-30048 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 123520-123556 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP009773 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pKPC-63d, complete sequence 15851-15887 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP009776 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPC-def, complete sequence 15843-15879 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP006926 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N2, complete sequence 15851-15887 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP022825 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence 45341-45377 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP015387 Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence 83835-83871 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NC_021199 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence 15326-15362 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 56885-56921 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 67606-67642 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 103996-104032 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP033755 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence 19827-19863 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP026283 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence 32220-32256 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 121745-121781 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP031811 Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence 160068-160104 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 180549-180585 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 MN310380 Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence 153680-153716 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP018815 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence 96309-96345 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP042483 Klebsiella pneumoniae strain C51 plasmid pC51_002, complete sequence 198097-198133 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP027616 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence 96495-96531 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP010881 Escherichia coli strain MNCRE44 plasmid pMNCRE44_5, complete sequence 110490-110526 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP029583 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence 98479-98515 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 150895-150931 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP038276 Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence 26795-26831 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP011641 Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence 129961-129997 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP011633 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence 34197-34233 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP011633 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence 47398-47434 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP014697 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence 42074-42110 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 256521-256557 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 15753-15789 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP035211 Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence 125916-125952 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP021900 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0136 plasmid tig00001437_pilon, complete sequence 18956-18992 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP021778 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_3, complete sequence 6212-6248 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP044049 Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence 108483-108519 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_LR130540 Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2 151976-152012 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 155910-155946 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 171526-171562 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 171653-171689 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_MG462728 Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence 180667-180703 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 NZ_CP054255 Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence 96503-96539 7 0.811
NZ_CP042545_2 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder 4230262-4230298 37 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 173339-173375 8 0.784

1. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP022118 (Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
tagagccacaacctgtcgcattggctgtccag	Protospacer
**.*****.***********************

2. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP030176 (Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 plasmid pIncFII.1, complete sequence) position: , mismatch: 2, identity: 0.938

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
tagagccacaacctgtcgcattggctgtccag	Protospacer
**.*****.***********************

3. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

4. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

5. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP032197 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

6. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_KP345882 (Escherichia coli strain BK32533 plasmid pBK32533, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

7. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP043048 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-2, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

8. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP019900 (Raoultella planticola strain GODA plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

9. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

10. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

11. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

12. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

13. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

14. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

15. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

16. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

17. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

18. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP042483 (Klebsiella pneumoniae strain C51 plasmid pC51_002, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

19. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP027616 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

20. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP010881 (Escherichia coli strain MNCRE44 plasmid pMNCRE44_5, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

21. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

22. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

23. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

24. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

25. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

26. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

27. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP009773 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pKPC-63d, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

28. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP009776 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPC-def, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

29. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP006926 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N2, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

30. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

31. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

32. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP038276 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

33. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

34. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP011641 (Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

35. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

36. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

37. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

38. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

39. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

40. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

41. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

42. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

43. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

44. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP021900 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0136 plasmid tig00001437_pilon, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

45. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP021778 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_3, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

46. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP044049 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

47. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_LR130540 (Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

48. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

49. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

50. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

51. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

52. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

53. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to NZ_CP054255 (Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattggctgtccag	Protospacer
.* *****.***********************

54. spacer 2.1|4230263|32|NZ_CP042545|CRT matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 4, identity: 0.875

taaagccataacctgtcgcattggctgtccag	CRISPR spacer
catagccacaacctgtcgcattagctgtccag	Protospacer
.* *****.*************.*********

55. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP022118 (Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.838

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
atagagccacaacctgtcgcattggctgtccagggtg	Protospacer
.**.*****.***********************  * 

56. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP030176 (Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 plasmid pIncFII.1, complete sequence) position: , mismatch: 6, identity: 0.838

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
atagagccacaacctgtcgcattggctgtccagggtg	Protospacer
.**.*****.***********************  * 

57. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP032197 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

58. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_KP345882 (Escherichia coli strain BK32533 plasmid pBK32533, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

59. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP043048 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-2, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

60. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP019900 (Raoultella planticola strain GODA plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

61. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

62. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

63. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

64. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

65. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

66. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

67. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

68. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

69. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

70. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP009773 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pKPC-63d, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

71. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP009776 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPC-def, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

72. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP006926 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N2, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

73. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

74. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

75. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

76. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

77. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

78. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

79. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

80. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

81. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

82. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

83. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

84. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

85. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

86. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP042483 (Klebsiella pneumoniae strain C51 plasmid pC51_002, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

87. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP027616 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

88. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP010881 (Escherichia coli strain MNCRE44 plasmid pMNCRE44_5, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

89. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

90. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

91. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP038276 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

92. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP011641 (Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

93. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

94. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

95. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

96. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

97. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

98. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

99. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP021900 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0136 plasmid tig00001437_pilon, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

100. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP021778 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_3, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

101. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP044049 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

102. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_LR130540 (Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

103. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

104. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

105. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

106. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

107. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to NZ_CP054255 (Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.811

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattggctgtccagggtg	Protospacer
..* *****.***********************  * 

108. spacer 2.4|4230262|37|NZ_CP042545|CRISPRCasFinder matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 8, identity: 0.784

gtaaagccataacctgtcgcattggctgtccagtttc	CRISPR spacer
acatagccacaacctgtcgcattagctgtccagggtg	Protospacer
..* *****.*************.*********  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1696292 : 1778380 92 Klebsiella_phage(61.11%) portal,holin,tRNA,integrase,capsid,transposase,head,protease,tail,terminase attL 1685311:1685326|attR 1770820:1770835
DBSCAN-SWA_2 2044991 : 2117150 58 Pseudomonas_phage(13.33%) holin,integrase,plate,transposase,protease attL 2040455:2040472|attR 2073178:2073195
DBSCAN-SWA_3 2264152 : 2272547 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_4 3545544 : 3566459 18 Cronobacter_phage(25.0%) tail,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP042548
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042548_1 16584-16711 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP015078 Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence 32887-32909 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP034403 Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence 34726-34748 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_EF219134 Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence 51055-51077 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP022277 Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence 20150-20172 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP050010 Citrobacter sp. Y3 plasmid unnamed1, complete sequence 32455-32477 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP027617 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence 20308-20330 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP024879 Klebsiella pneumoniae strain NH25 plasmid pNH25.5, complete sequence 34833-34855 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP043856 Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence 276-298 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP026184 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence 39010-39032 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP011646 Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence 33130-33152 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP040826 Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence 29824-29846 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP043516 Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence 44764-44786 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 MN583554 Escherichia coli strain M17224 plasmid p17511_70, complete sequence 39767-39789 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP027125 Escherichia coli strain AR_0374 plasmid unnamed3 3381-3403 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP026279 Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence 481-503 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_KX784503 Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence 10869-10891 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_KX784502 Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence 10854-10876 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_KT148595 Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence 31495-31517 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_KT345947 Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence 10976-10998 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP010378 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence 51379-51401 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 MN967025 Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence 11482-11504 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 MK368725 Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence 10989-11011 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NC_019163 Klebsiella pneumoniae plasmid pTR4, complete sequence 10987-11009 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 139357-139379 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP029112 Escherichia coli strain AR436 plasmid unnamed3, complete sequence 52046-52068 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP026205 Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence 113-135 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_LT985223 Escherichia coli strain 711 plasmid RCS25_p, complete sequence 3799-3821 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP034398 Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence 8450-8472 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP042548 Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence 16661-16683 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NC_015872 Escherichia coli plasmid p271A, complete sequence 20552-20574 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP027137 Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence 47670-47692 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP026232 Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence 47772-47794 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP019907 Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence 18732-18754 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_LT985250 Escherichia coli strain 170 plasmid RCS38_p, complete sequence 186437-186459 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NC_024954 Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence 10989-11011 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP010382 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence 52783-52805 0 1.0
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 NZ_CP035471 Escherichia coli strain U12A plasmid pU12A_D, complete sequence 8523-8545 2 0.913
NZ_CP042548_1 1.2|16673|23|NZ_CP042548|PILER-CR 16673-16695 23 KX863569 Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence 11643-11665 2 0.913

1. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP015078 (Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

2. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP034403 (Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

3. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_EF219134 (Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

4. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP022277 (Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

5. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP050010 (Citrobacter sp. Y3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

6. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP027617 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

7. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP024879 (Klebsiella pneumoniae strain NH25 plasmid pNH25.5, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

8. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP043856 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

9. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP026184 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

10. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

11. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP040826 (Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

12. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP043516 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

13. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to MN583554 (Escherichia coli strain M17224 plasmid p17511_70, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

14. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP027125 (Escherichia coli strain AR_0374 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

15. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP026279 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

16. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_KX784503 (Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

17. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_KX784502 (Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

18. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_KT148595 (Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

19. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_KT345947 (Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

20. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP010378 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

21. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to MN967025 (Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

22. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to MK368725 (Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

23. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NC_019163 (Klebsiella pneumoniae plasmid pTR4, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

24. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

25. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP029112 (Escherichia coli strain AR436 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

26. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP026205 (Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

27. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_LT985223 (Escherichia coli strain 711 plasmid RCS25_p, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

28. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP034398 (Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

29. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP042548 (Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

30. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NC_015872 (Escherichia coli plasmid p271A, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

31. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP027137 (Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

32. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP026232 (Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

33. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP019907 (Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

34. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_LT985250 (Escherichia coli strain 170 plasmid RCS38_p, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

35. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NC_024954 (Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

36. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP010382 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggct	CRISPR spacer
gtttcttctgttgctcactggct	Protospacer
***********************

37. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to NZ_CP035471 (Escherichia coli strain U12A plasmid pU12A_D, complete sequence) position: , mismatch: 2, identity: 0.913

gtttcttctgttgctcactggct	CRISPR spacer
ttttcttttgttgctcactggct	Protospacer
 ******.***************

38. spacer 1.2|16673|23|NZ_CP042548|PILER-CR matches to KX863569 (Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence) position: , mismatch: 2, identity: 0.913

gtttcttctgttgctcactggct	CRISPR spacer
ttttcttttgttgctcactggct	Protospacer
 ******.***************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2478 : 51787 60 Salmonella_phage(27.27%) integrase,transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP042547
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3297 : 111376 104 Escherichia_phage(18.52%) transposase,integrase attL 48203:48249|attR 60558:60604
DBSCAN-SWA_2 121885 : 130215 13 Faecalibacterium_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP042546
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1319 : 132757 119 Escherichia_phage(25.58%) integrase,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage