Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP042511 Leclercia adecarboxylata strain E1 plasmid pE1_006, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP042506 Leclercia adecarboxylata strain E1 plasmid pE1_001, complete sequence 0 crisprs csa3 0 0 4 0
NZ_CP042505 Leclercia adecarboxylata strain E1 chromosome, complete genome 8 crisprs DEDDh,csa3,WYL,DinG,cas3,RT,cas2,cas1,cas6e,cas5 0 27 4 0
NZ_CP042510 Leclercia adecarboxylata strain E1 plasmid pE1_005, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP042508 Leclercia adecarboxylata strain E1 plasmid pE1_003, complete sequence 0 crisprs NA 0 0 4 0
NZ_CP042509 Leclercia adecarboxylata strain E1 plasmid pE1_004, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP042507 Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence 0 crisprs csa3 0 0 2 0

Results visualization

1. NZ_CP042506
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 115949 : 174346 57 uncultured_Caudovirales_phage(35.29%) transposase,integrase attL 115898:115957|attR 147148:147967
DBSCAN-SWA_2 182752 : 219751 38 Escherichia_phage(60.0%) transposase,integrase attL 172166:172225|attR 213683:215960
DBSCAN-SWA_3 265374 : 298373 36 Bacillus_phage(12.5%) transposase NA
DBSCAN-SWA_4 330330 : 337807 10 Stx2-converting_phage(28.57%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP042505
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042505_1 1183832-1183971 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042505_2 1312664-1312796 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042505_3 1958902-1959032 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042505_4 3225057-3225183 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042505_5 3610087-3610175 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042505_6 3692993-3693085 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042505_7 3746392-3747823 Unclear I-E
23 spacers
cas2,cas1,cas6e,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP042505_8 4627848-4627945 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 MT261384 Salmonella virus PAT1, complete genome 34703-34734 1 0.969
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 MT580116 Salmonella phage 65FD, complete genome 8281-8312 1 0.969
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 MT580117 Salmonella phage 66FD, complete genome 40320-40351 1 0.969
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 MT261384 Salmonella virus PAT1, complete genome 34703-34734 1 0.969
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 MT580116 Salmonella phage 65FD, complete genome 8281-8312 1 0.969
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 MT580117 Salmonella phage 66FD, complete genome 40320-40351 1 0.969
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 KC911857 Salmonella phage SPC32N, complete genome 9395-9426 2 0.938
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 KC911856 Salmonella phage SPC32H, complete genome 9395-9426 2 0.938
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NC_016761 Salmonella phage SPN1S, complete genome 9423-9454 2 0.938
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 JQ691610 Salmonella phage SPN9TCW, complete genome 9424-9455 2 0.938
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NC_004775 Enterobacteria phage epsilon15, complete genome 9152-9183 2 0.938
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 KC911857 Salmonella phage SPC32N, complete genome 9395-9426 2 0.938
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 KC911856 Salmonella phage SPC32H, complete genome 9395-9426 2 0.938
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NC_016761 Salmonella phage SPN1S, complete genome 9423-9454 2 0.938
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 JQ691610 Salmonella phage SPN9TCW, complete genome 9424-9455 2 0.938
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NC_004775 Enterobacteria phage epsilon15, complete genome 9152-9183 2 0.938
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 CP054565 Escherichia coli strain SCU-478 isolate rectal swab from healthy college student plasmid pSCU-478-1, complete sequence 66962-66993 3 0.906
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 CP054565 Escherichia coli strain SCU-478 isolate rectal swab from healthy college student plasmid pSCU-478-1, complete sequence 66962-66993 3 0.906
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP025860 Escherichia coli strain 504239 plasmid p504239_101, complete sequence 52652-52683 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP025922 Escherichia coli strain 103605 plasmid p103605_83, complete sequence 6647-6678 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP025912 Escherichia coli strain 204446 plasmid p204446_92, complete sequence 79001-79032 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_KT845955 Escherichia coli strain EP28 plasmid pHNEP28_cfr, complete sequence 80595-80626 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP042629 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-2, complete sequence 103264-103295 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP042633 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence 64686-64717 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP025904 Escherichia coli strain 300709 plasmid p300709_97, complete sequence 42566-42597 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP025858 Escherichia coli strain 504838 plasmid p504838_88, complete sequence 56398-56429 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP043219 Escherichia coli O80:H26 strain EC-107 plasmid pET6.2-IncFII, complete sequence 54368-54399 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP018113 Escherichia coli strain MRSN346595 plasmid pMRSN346595_62.2, complete sequence 19584-19615 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP023348 Escherichia coli strain ETEC-2265 plasmid unnamed2, complete sequence 43996-44027 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP011135 Escherichia coli VR50 plasmid pVR50A, complete sequence 33309-33340 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP017846 Escherichia coli strain FMU073332 plasmid pEcoFMU073332b sequence 6526-6557 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP024276 Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed1 6348-6379 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_LT838198 Escherichia coli isolate WI1 isolate plasmid pWI1-incFII, complete sequence 20272-20303 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP049082 Escherichia coli strain p10A plasmid p10A_p1, complete sequence 105693-105724 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP024287 Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence 120967-120998 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 107428-107459 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 CP042642 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-4_MCR3, complete sequence 36209-36240 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP027385 Escherichia coli strain 2013C-3250 plasmid unnamed5, complete sequence 3022-3053 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP041414 Escherichia coli strain STEC719 plasmid pSTEC719_3, complete sequence 79443-79474 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP047381 Escherichia coli strain CAU16175 plasmid pCAU16175_3, complete sequence 31166-31197 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP041420 Escherichia coli strain STEC711 plasmid pSTEC711_4, complete sequence 7759-7790 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP038299 Escherichia coli O157:H7 strain TB182A plasmid pTB182A-5, complete sequence 7262-7293 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 AP014877 Escherichia coli plasmid pV085-c DNA, complete sequence, strain: V085 35822-35853 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP010123 Escherichia coli strain C5 plasmid A, complete genome 67132-67163 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP010124 Escherichia coli strain C5 plasmid B, complete genome 4446-4477 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NC_022333 Escherichia coli plasmid pCss165Kan DNA, complete genome, strain: 4266 delta cssB::Km 43272-43303 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_AP018811 Escherichia coli strain E2865 plasmid pE2865-3, complete sequence 31524-31555 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NC_019094 Escherichia coli plasmid p417H-90, complete sequence 1656-1687 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP027598 Escherichia coli strain 86-3153 plasmid unnamed 22455-22486 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP022913 Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed1, complete sequence 55975-56006 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NC_017643 Escherichia coli UMNK88 plasmid pUMNK88_Hly, complete sequence 2099-2130 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NC_019037 Escherichia coli plasmid pChi7122-2, complete sequence 44814-44845 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 CP025909 Escherichia coli strain 204576 plasmid p204576_83, complete sequence 26875-26906 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP042885 Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_01, complete sequence 51582-51613 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP023354 Escherichia coli strain 746 plasmid p62, complete sequence 23184-23215 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP027588 Escherichia coli strain 2013C-4974 plasmid unnamed 10632-10663 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP032836 Klebsiella pneumoniae strain INF237 plasmid pINF237_03, complete sequence 34009-34040 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP029982 Escherichia coli strain 99-3165 plasmid unnamed3, complete sequence 27238-27269 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP034167 Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-3, complete sequence 24065-24096 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP030785 Escherichia albertii strain 2012EL-1823B plasmid unnamed2, complete sequence 45816-45847 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP030786 Escherichia albertii strain 2012EL-1823B plasmid unnamed3, complete sequence 92834-92865 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 AP018354 Escherichia coli plasmid pVE155 DNA, complete genome, strain: E155 44184-44215 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NC_013362 Escherichia coli O26:H11 str. 11368 plasmid pO26_2, complete sequence 20748-20779 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP018107 Escherichia coli strain MRSN352231 plasmid pMR0716_IncFII, complete sequence 19584-19615 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP020338 Shigella flexneri 4c strain 1602 plasmid unnamed2, complete sequence 10738-10769 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 CP025971 Escherichia coli strain 11573 a-1 plasmid p11573a1_92, complete sequence 41324-41355 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 CP025974 Escherichia coli strain 10802 a plasmid p10802a_92, complete sequence 49977-50008 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 CP025977 Escherichia coli strain 10754 a-1 plasmid p10754a1_92, complete sequence 83720-83751 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP019910 Escherichia coli strain MDR_56 plasmid unnamed4, complete sequence 7379-7410 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP026931 Escherichia coli strain CFS3246 plasmid pCFS3246-2, complete sequence 20688-20719 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_LT985265 Escherichia coli strain 364 plasmid RCS57TR364_p, complete sequence 66894-66925 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NC_017724 Escherichia coli ETEC H10407 plasmid p948, complete sequence 55083-55114 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_MG904998 Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence 17565-17596 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP025918 Escherichia coli strain 120899 plasmid p120899_76, complete sequence 32661-32692 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 CP043740 Escherichia coli strain CVM N17EC0320 plasmid pN17EC0320-1, complete sequence 88989-89020 4 0.875
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP023828 Escherichia coli strain 4/4 plasmid p4_4.2, complete sequence 32834-32865 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP025860 Escherichia coli strain 504239 plasmid p504239_101, complete sequence 52652-52683 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP025922 Escherichia coli strain 103605 plasmid p103605_83, complete sequence 6647-6678 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP025912 Escherichia coli strain 204446 plasmid p204446_92, complete sequence 79001-79032 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_KT845955 Escherichia coli strain EP28 plasmid pHNEP28_cfr, complete sequence 80595-80626 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP042629 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-2, complete sequence 103264-103295 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP042633 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence 64686-64717 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP025904 Escherichia coli strain 300709 plasmid p300709_97, complete sequence 42566-42597 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP025858 Escherichia coli strain 504838 plasmid p504838_88, complete sequence 56398-56429 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP043219 Escherichia coli O80:H26 strain EC-107 plasmid pET6.2-IncFII, complete sequence 54368-54399 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP018113 Escherichia coli strain MRSN346595 plasmid pMRSN346595_62.2, complete sequence 19584-19615 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP023348 Escherichia coli strain ETEC-2265 plasmid unnamed2, complete sequence 43996-44027 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP011135 Escherichia coli VR50 plasmid pVR50A, complete sequence 33309-33340 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP017846 Escherichia coli strain FMU073332 plasmid pEcoFMU073332b sequence 6526-6557 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP024276 Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed1 6348-6379 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_LT838198 Escherichia coli isolate WI1 isolate plasmid pWI1-incFII, complete sequence 20272-20303 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP049082 Escherichia coli strain p10A plasmid p10A_p1, complete sequence 105693-105724 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP024287 Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence 120967-120998 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 107428-107459 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 CP042642 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-4_MCR3, complete sequence 36209-36240 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP027385 Escherichia coli strain 2013C-3250 plasmid unnamed5, complete sequence 3022-3053 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP041414 Escherichia coli strain STEC719 plasmid pSTEC719_3, complete sequence 79443-79474 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP047381 Escherichia coli strain CAU16175 plasmid pCAU16175_3, complete sequence 31166-31197 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP041420 Escherichia coli strain STEC711 plasmid pSTEC711_4, complete sequence 7759-7790 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP038299 Escherichia coli O157:H7 strain TB182A plasmid pTB182A-5, complete sequence 7262-7293 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 AP014877 Escherichia coli plasmid pV085-c DNA, complete sequence, strain: V085 35822-35853 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP010123 Escherichia coli strain C5 plasmid A, complete genome 67132-67163 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP010124 Escherichia coli strain C5 plasmid B, complete genome 4446-4477 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NC_022333 Escherichia coli plasmid pCss165Kan DNA, complete genome, strain: 4266 delta cssB::Km 43272-43303 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_AP018811 Escherichia coli strain E2865 plasmid pE2865-3, complete sequence 31524-31555 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NC_019094 Escherichia coli plasmid p417H-90, complete sequence 1656-1687 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP027598 Escherichia coli strain 86-3153 plasmid unnamed 22455-22486 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP022913 Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed1, complete sequence 55975-56006 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NC_017643 Escherichia coli UMNK88 plasmid pUMNK88_Hly, complete sequence 2099-2130 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NC_019037 Escherichia coli plasmid pChi7122-2, complete sequence 44814-44845 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 CP025909 Escherichia coli strain 204576 plasmid p204576_83, complete sequence 26875-26906 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP042885 Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_01, complete sequence 51582-51613 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP023354 Escherichia coli strain 746 plasmid p62, complete sequence 23184-23215 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP027588 Escherichia coli strain 2013C-4974 plasmid unnamed 10632-10663 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP032836 Klebsiella pneumoniae strain INF237 plasmid pINF237_03, complete sequence 34009-34040 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP029982 Escherichia coli strain 99-3165 plasmid unnamed3, complete sequence 27238-27269 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP034167 Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-3, complete sequence 24065-24096 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP030785 Escherichia albertii strain 2012EL-1823B plasmid unnamed2, complete sequence 45816-45847 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP030786 Escherichia albertii strain 2012EL-1823B plasmid unnamed3, complete sequence 92834-92865 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 AP018354 Escherichia coli plasmid pVE155 DNA, complete genome, strain: E155 44184-44215 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NC_013362 Escherichia coli O26:H11 str. 11368 plasmid pO26_2, complete sequence 20748-20779 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP018107 Escherichia coli strain MRSN352231 plasmid pMR0716_IncFII, complete sequence 19584-19615 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP020338 Shigella flexneri 4c strain 1602 plasmid unnamed2, complete sequence 10738-10769 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 CP025971 Escherichia coli strain 11573 a-1 plasmid p11573a1_92, complete sequence 41324-41355 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 CP025974 Escherichia coli strain 10802 a plasmid p10802a_92, complete sequence 49977-50008 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 CP025977 Escherichia coli strain 10754 a-1 plasmid p10754a1_92, complete sequence 83720-83751 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP019910 Escherichia coli strain MDR_56 plasmid unnamed4, complete sequence 7379-7410 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP026931 Escherichia coli strain CFS3246 plasmid pCFS3246-2, complete sequence 20688-20719 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_LT985265 Escherichia coli strain 364 plasmid RCS57TR364_p, complete sequence 66894-66925 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NC_017724 Escherichia coli ETEC H10407 plasmid p948, complete sequence 55083-55114 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_MG904998 Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence 17565-17596 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP025918 Escherichia coli strain 120899 plasmid p120899_76, complete sequence 32661-32692 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 CP043740 Escherichia coli strain CVM N17EC0320 plasmid pN17EC0320-1, complete sequence 88989-89020 4 0.875
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP023828 Escherichia coli strain 4/4 plasmid p4_4.2, complete sequence 32834-32865 4 0.875
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 688133-688164 5 0.844
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 688133-688164 5 0.844
NZ_CP042505_6 6.1|3693023|33|NZ_CP042505|CRISPRCasFinder 3693023-3693055 33 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 196155-196187 6 0.818
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NZ_CP013125 Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence 187746-187777 6 0.812
NZ_CP042505_7 7.20|3747580|32|NZ_CP042505|CRISPRCasFinder,CRT 3747580-3747611 32 NZ_KJ599675 Micrococcus sp. A7 plasmid pLMA7, complete sequence 17886-17917 6 0.812
NZ_CP042505_7 7.20|3747580|32|NZ_CP042505|CRISPRCasFinder,CRT 3747580-3747611 32 NZ_KR152226 Micrococcus sp. MG-2010-D12 plasmid pJD12, complete sequence 11384-11415 6 0.812
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NZ_CP013125 Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence 187746-187777 6 0.812
NZ_CP042505_7 7.42|3747581|32|NZ_CP042505|PILER-CR 3747581-3747612 32 NZ_KJ599675 Micrococcus sp. A7 plasmid pLMA7, complete sequence 17886-17917 6 0.812
NZ_CP042505_7 7.42|3747581|32|NZ_CP042505|PILER-CR 3747581-3747612 32 NZ_KR152226 Micrococcus sp. MG-2010-D12 plasmid pJD12, complete sequence 11384-11415 6 0.812
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 628506-628537 7 0.781
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 NZ_CP018030 Alteromonas mediterranea strain RG65 plasmid MRG65-300, complete sequence 12420-12451 7 0.781
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 628506-628537 7 0.781
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 NZ_CP018030 Alteromonas mediterranea strain RG65 plasmid MRG65-300, complete sequence 12420-12451 7 0.781
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 MK552105 Escherichia phage Jahat_MG145, complete genome 38023-38054 8 0.75
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NZ_KX786187 Enterobacter cloacae strain N14-0444 plasmid pIMI-6, complete sequence 34127-34158 8 0.75
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NZ_KT225520 Raoultella ornithinolytica strain RJ46C plasmid pRJ46C, complete sequence 155616-155647 8 0.75
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 KT780723 Uncultured bacterium plasmid pGA45, complete sequence 110193-110224 8 0.75
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 181032-181063 8 0.75
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 MT657341 Mycobacterium phage Estes, complete genome 58722-58753 8 0.75
NZ_CP042505_7 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT 3746787-3746818 32 JF937105 Mycobacterium phage Rey, complete genome 58954-58985 8 0.75
NZ_CP042505_7 7.17|3747397|32|NZ_CP042505|CRISPRCasFinder,CRT 3747397-3747428 32 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 572016-572047 8 0.75
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 MK552105 Escherichia phage Jahat_MG145, complete genome 38023-38054 8 0.75
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NZ_KX786187 Enterobacter cloacae strain N14-0444 plasmid pIMI-6, complete sequence 34127-34158 8 0.75
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NZ_KT225520 Raoultella ornithinolytica strain RJ46C plasmid pRJ46C, complete sequence 155616-155647 8 0.75
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 KT780723 Uncultured bacterium plasmid pGA45, complete sequence 110193-110224 8 0.75
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 181032-181063 8 0.75
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 MT657341 Mycobacterium phage Estes, complete genome 58722-58753 8 0.75
NZ_CP042505_7 7.29|3746788|32|NZ_CP042505|PILER-CR 3746788-3746819 32 JF937105 Mycobacterium phage Rey, complete genome 58954-58985 8 0.75
NZ_CP042505_7 7.39|3747398|32|NZ_CP042505|PILER-CR 3747398-3747429 32 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 572016-572047 8 0.75
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NZ_CP028270 Pediococcus pentosaceus strain SRCM102740 plasmid unnamed1, complete sequence 13457-13488 9 0.719
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NZ_CP028267 Pediococcus pentosaceus strain SRCM102739 plasmid unnamed1, complete sequence 163-194 9 0.719
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NZ_CP015919 Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence 1896-1927 9 0.719
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NZ_CP028265 Pediococcus pentosaceus strain SRCM102738 plasmid unnamed1, complete sequence 22748-22779 9 0.719
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NZ_CP031004 Lactobacillus curvatus strain TMW 1.1928 plasmid p-1.1928_1, complete sequence 41058-41089 9 0.719
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NZ_CP021928 Pediococcus pentosaceus strain SRCM100194 plasmid pPP194-2, complete sequence 16218-16249 9 0.719
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 982599-982630 9 0.719
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NC_019369 Burkholderia cepacia plasmid pYS1, complete sequence 57587-57618 9 0.719
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 MN693890 Marine virus AFVG_250M637, complete genome 35981-36012 9 0.719
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 MN693630 Marine virus AFVG_250M640, complete genome 7790-7821 9 0.719
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 MN693538 Marine virus AFVG_25M196, complete genome 18902-18933 9 0.719
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 MN693980 Marine virus AFVG_250M1182, complete genome 7748-7779 9 0.719
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 MN694080 Marine virus AFVG_250M639, complete genome 7715-7746 9 0.719
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 MN694696 Marine virus AFVG_250M540, complete genome 37900-37931 9 0.719
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 MN694192 Marine virus AFVG_250M638, complete genome 36440-36471 9 0.719
NZ_CP042505_7 7.10|3746970|32|NZ_CP042505|CRISPRCasFinder,CRT 3746970-3747001 32 NZ_KX015668 Enterobacter cloacae strain CY01 plasmid pCY-CTX, complete sequence 70244-70275 9 0.719
NZ_CP042505_7 7.10|3746970|32|NZ_CP042505|CRISPRCasFinder,CRT 3746970-3747001 32 NZ_CP030078 Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence 39149-39180 9 0.719
NZ_CP042505_7 7.10|3746970|32|NZ_CP042505|CRISPRCasFinder,CRT 3746970-3747001 32 NZ_CP029247 Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_F, complete sequence 39129-39160 9 0.719
NZ_CP042505_7 7.10|3746970|32|NZ_CP042505|CRISPRCasFinder,CRT 3746970-3747001 32 NZ_CP051133 Enterobacter hormaechei strain AMS-38 plasmid pAMS-38a, complete sequence 91049-91080 9 0.719
NZ_CP042505_7 7.11|3747031|32|NZ_CP042505|CRISPRCasFinder,CRT 3747031-3747062 32 NC_018067 Desulfosporosinus acidiphilus SJ4 plasmid pDESACI.02, complete sequence 3801-3832 9 0.719
NZ_CP042505_7 7.11|3747031|32|NZ_CP042505|CRISPRCasFinder,CRT 3747031-3747062 32 NZ_MN366357 Bacterium plasmid pALTS28, complete sequence 35951-35982 9 0.719
NZ_CP042505_7 7.11|3747031|32|NZ_CP042505|CRISPRCasFinder,CRT 3747031-3747062 32 NZ_CP020047 Thiomonas intermedia strain ATCC 15466 plasmid pXI1, complete sequence 32705-32736 9 0.719
NZ_CP042505_7 7.11|3747031|32|NZ_CP042505|CRISPRCasFinder,CRT 3747031-3747062 32 MF495477 Aeromonas salmonicida plasmid pS28-3, complete sequence 7891-7922 9 0.719
NZ_CP042505_7 7.11|3747031|32|NZ_CP042505|CRISPRCasFinder,CRT 3747031-3747062 32 KJ850907 Uncultured bacterium plasmid pSFA231, complete sequence 35183-35214 9 0.719
NZ_CP042505_7 7.14|3747214|32|NZ_CP042505|CRISPRCasFinder,CRT 3747214-3747245 32 NZ_CP037863 Citrobacter sp. LY-1 plasmid unnamed2, complete sequence 122208-122239 9 0.719
NZ_CP042505_7 7.17|3747397|32|NZ_CP042505|CRISPRCasFinder,CRT 3747397-3747428 32 NC_011879 Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence 177410-177441 9 0.719
NZ_CP042505_7 7.19|3747519|32|NZ_CP042505|CRISPRCasFinder,CRT 3747519-3747550 32 NZ_KU980950 Escherichia coli strain WE-0250 plasmid U2501, complete sequence 2344-2375 9 0.719
NZ_CP042505_7 7.19|3747519|32|NZ_CP042505|CRISPRCasFinder,CRT 3747519-3747550 32 MH422554 Escherichia phage P1, complete genome 29258-29289 9 0.719
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NZ_CP028270 Pediococcus pentosaceus strain SRCM102740 plasmid unnamed1, complete sequence 13457-13488 9 0.719
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NZ_CP028267 Pediococcus pentosaceus strain SRCM102739 plasmid unnamed1, complete sequence 163-194 9 0.719
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NZ_CP015919 Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence 1896-1927 9 0.719
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NZ_CP028265 Pediococcus pentosaceus strain SRCM102738 plasmid unnamed1, complete sequence 22748-22779 9 0.719
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NZ_CP031004 Lactobacillus curvatus strain TMW 1.1928 plasmid p-1.1928_1, complete sequence 41058-41089 9 0.719
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NZ_CP021928 Pediococcus pentosaceus strain SRCM100194 plasmid pPP194-2, complete sequence 16218-16249 9 0.719
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 982599-982630 9 0.719
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NC_019369 Burkholderia cepacia plasmid pYS1, complete sequence 57587-57618 9 0.719
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 MN693890 Marine virus AFVG_250M637, complete genome 35981-36012 9 0.719
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 MN693630 Marine virus AFVG_250M640, complete genome 7790-7821 9 0.719
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 MN693538 Marine virus AFVG_25M196, complete genome 18902-18933 9 0.719
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 MN693980 Marine virus AFVG_250M1182, complete genome 7748-7779 9 0.719
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 MN694080 Marine virus AFVG_250M639, complete genome 7715-7746 9 0.719
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 MN694696 Marine virus AFVG_250M540, complete genome 37900-37931 9 0.719
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 MN694192 Marine virus AFVG_250M638, complete genome 36440-36471 9 0.719
NZ_CP042505_7 7.32|3746971|32|NZ_CP042505|PILER-CR 3746971-3747002 32 NZ_KX015668 Enterobacter cloacae strain CY01 plasmid pCY-CTX, complete sequence 70244-70275 9 0.719
NZ_CP042505_7 7.32|3746971|32|NZ_CP042505|PILER-CR 3746971-3747002 32 NZ_CP030078 Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence 39149-39180 9 0.719
NZ_CP042505_7 7.32|3746971|32|NZ_CP042505|PILER-CR 3746971-3747002 32 NZ_CP029247 Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_F, complete sequence 39129-39160 9 0.719
NZ_CP042505_7 7.32|3746971|32|NZ_CP042505|PILER-CR 3746971-3747002 32 NZ_CP051133 Enterobacter hormaechei strain AMS-38 plasmid pAMS-38a, complete sequence 91049-91080 9 0.719
NZ_CP042505_7 7.33|3747032|32|NZ_CP042505|PILER-CR 3747032-3747063 32 NC_018067 Desulfosporosinus acidiphilus SJ4 plasmid pDESACI.02, complete sequence 3801-3832 9 0.719
NZ_CP042505_7 7.33|3747032|32|NZ_CP042505|PILER-CR 3747032-3747063 32 NZ_MN366357 Bacterium plasmid pALTS28, complete sequence 35951-35982 9 0.719
NZ_CP042505_7 7.33|3747032|32|NZ_CP042505|PILER-CR 3747032-3747063 32 NZ_CP020047 Thiomonas intermedia strain ATCC 15466 plasmid pXI1, complete sequence 32705-32736 9 0.719
NZ_CP042505_7 7.33|3747032|32|NZ_CP042505|PILER-CR 3747032-3747063 32 MF495477 Aeromonas salmonicida plasmid pS28-3, complete sequence 7891-7922 9 0.719
NZ_CP042505_7 7.33|3747032|32|NZ_CP042505|PILER-CR 3747032-3747063 32 KJ850907 Uncultured bacterium plasmid pSFA231, complete sequence 35183-35214 9 0.719
NZ_CP042505_7 7.36|3747215|32|NZ_CP042505|PILER-CR 3747215-3747246 32 NZ_CP037863 Citrobacter sp. LY-1 plasmid unnamed2, complete sequence 122208-122239 9 0.719
NZ_CP042505_7 7.39|3747398|32|NZ_CP042505|PILER-CR 3747398-3747429 32 NC_011879 Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence 177410-177441 9 0.719
NZ_CP042505_7 7.41|3747520|32|NZ_CP042505|PILER-CR 3747520-3747551 32 NZ_KU980950 Escherichia coli strain WE-0250 plasmid U2501, complete sequence 2344-2375 9 0.719
NZ_CP042505_7 7.41|3747520|32|NZ_CP042505|PILER-CR 3747520-3747551 32 MH422554 Escherichia phage P1, complete genome 29258-29289 9 0.719
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 MN850643 Escherichia phage tiwna, complete genome 10098-10129 10 0.688
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NC_048206 Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1 10425-10456 10 0.688
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 LR027385 Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1 31666-31697 10 0.688
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 MN850641 Escherichia phage tonijn, complete genome 49963-49994 10 0.688
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 464820-464851 10 0.688
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 KJ944830 Pseudoalteromonas phage B8b, partial genome 7759-7790 10 0.688
NZ_CP042505_7 7.3|3746543|32|NZ_CP042505|CRISPRCasFinder,CRT 3746543-3746574 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 469654-469685 10 0.688
NZ_CP042505_7 7.6|3746726|32|NZ_CP042505|CRISPRCasFinder,CRT 3746726-3746757 32 MN694742 Marine virus AFVG_250M371, complete genome 33251-33282 10 0.688
NZ_CP042505_7 7.13|3747153|32|NZ_CP042505|CRISPRCasFinder,CRT 3747153-3747184 32 NZ_CP034939 Pectobacterium odoriferum strain JK2.1 plasmid p.Jk2_1, complete sequence 76408-76439 10 0.688
NZ_CP042505_7 7.14|3747214|32|NZ_CP042505|CRISPRCasFinder,CRT 3747214-3747245 32 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 2652-2683 10 0.688
NZ_CP042505_7 7.19|3747519|32|NZ_CP042505|CRISPRCasFinder,CRT 3747519-3747550 32 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 32908-32939 10 0.688
NZ_CP042505_7 7.23|3747763|32|NZ_CP042505|CRISPRCasFinder,CRT 3747763-3747794 32 NC_022061 Mycobacterium phage KayaCho, complete genome 34280-34311 10 0.688
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 MN850643 Escherichia phage tiwna, complete genome 10098-10129 10 0.688
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NC_048206 Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1 10425-10456 10 0.688
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 LR027385 Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1 31666-31697 10 0.688
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 MN850641 Escherichia phage tonijn, complete genome 49963-49994 10 0.688
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 464820-464851 10 0.688
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 KJ944830 Pseudoalteromonas phage B8b, partial genome 7759-7790 10 0.688
NZ_CP042505_7 7.25|3746544|32|NZ_CP042505|PILER-CR 3746544-3746575 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 469654-469685 10 0.688
NZ_CP042505_7 7.28|3746727|32|NZ_CP042505|PILER-CR 3746727-3746758 32 MN694742 Marine virus AFVG_250M371, complete genome 33251-33282 10 0.688
NZ_CP042505_7 7.35|3747154|32|NZ_CP042505|PILER-CR 3747154-3747185 32 NZ_CP034939 Pectobacterium odoriferum strain JK2.1 plasmid p.Jk2_1, complete sequence 76408-76439 10 0.688
NZ_CP042505_7 7.36|3747215|32|NZ_CP042505|PILER-CR 3747215-3747246 32 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 2652-2683 10 0.688
NZ_CP042505_7 7.41|3747520|32|NZ_CP042505|PILER-CR 3747520-3747551 32 NC_011880 Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence 32908-32939 10 0.688
NZ_CP042505_7 7.45|3747764|32|NZ_CP042505|PILER-CR 3747764-3747795 32 NC_022061 Mycobacterium phage KayaCho, complete genome 34280-34311 10 0.688
NZ_CP042505_7 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT 3746482-3746513 32 NZ_CP041164 Leisingera aquaemixtae strain R2C4 plasmid unnamed3, complete sequence 17592-17623 11 0.656
NZ_CP042505_7 7.8|3746848|32|NZ_CP042505|CRISPRCasFinder,CRT 3746848-3746879 32 NZ_CP049359 Deinococcus wulumuqiensis R12 plasmid unnamed2, complete sequence 18017-18048 11 0.656
NZ_CP042505_7 7.24|3746483|32|NZ_CP042505|PILER-CR 3746483-3746514 32 NZ_CP041164 Leisingera aquaemixtae strain R2C4 plasmid unnamed3, complete sequence 17592-17623 11 0.656
NZ_CP042505_7 7.30|3746849|32|NZ_CP042505|PILER-CR 3746849-3746880 32 NZ_CP049359 Deinococcus wulumuqiensis R12 plasmid unnamed2, complete sequence 18017-18048 11 0.656

1. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MT261384 (Salmonella virus PAT1, complete genome) position: , mismatch: 1, identity: 0.969 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtaattgttccggtgctggcgctggcgtatac	Protospacer
***** **************************

2. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MT580116 (Salmonella phage 65FD, complete genome) position: , mismatch: 1, identity: 0.969 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtaattgttccggtgctggcgctggcgtatac	Protospacer
***** **************************

3. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MT580117 (Salmonella phage 66FD, complete genome) position: , mismatch: 1, identity: 0.969 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtaattgttccggtgctggcgctggcgtatac	Protospacer
***** **************************

4. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to MT261384 (Salmonella virus PAT1, complete genome) position: , mismatch: 1, identity: 0.969 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtaattgttccggtgctggcgctggcgtatac	Protospacer
***** **************************

5. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to MT580116 (Salmonella phage 65FD, complete genome) position: , mismatch: 1, identity: 0.969 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtaattgttccggtgctggcgctggcgtatac	Protospacer
***** **************************

6. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to MT580117 (Salmonella phage 66FD, complete genome) position: , mismatch: 1, identity: 0.969 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtaattgttccggtgctggcgctggcgtatac	Protospacer
***** **************************

7. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to KC911857 (Salmonella phage SPC32N, complete genome) position: , mismatch: 2, identity: 0.938 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtgatggtgccggtgctggcgctggcgtatac	Protospacer
**.***** ***********************

8. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to KC911856 (Salmonella phage SPC32H, complete genome) position: , mismatch: 2, identity: 0.938 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtgatggtgccggtgctggcgctggcgtatac	Protospacer
**.***** ***********************

9. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NC_016761 (Salmonella phage SPN1S, complete genome) position: , mismatch: 2, identity: 0.938 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtgatggtgccggtgctggcgctggcgtatac	Protospacer
**.***** ***********************

10. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to JQ691610 (Salmonella phage SPN9TCW, complete genome) position: , mismatch: 2, identity: 0.938 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtgatggtgccggtgctggcgctggcgtatac	Protospacer
**.***** ***********************

11. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NC_004775 (Enterobacteria phage epsilon15, complete genome) position: , mismatch: 2, identity: 0.938 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtaattgttccggtgctggcgctggcgtagac	Protospacer
***** *********************** **

12. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to KC911857 (Salmonella phage SPC32N, complete genome) position: , mismatch: 2, identity: 0.938 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtgatggtgccggtgctggcgctggcgtatac	Protospacer
**.***** ***********************

13. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to KC911856 (Salmonella phage SPC32H, complete genome) position: , mismatch: 2, identity: 0.938 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtgatggtgccggtgctggcgctggcgtatac	Protospacer
**.***** ***********************

14. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NC_016761 (Salmonella phage SPN1S, complete genome) position: , mismatch: 2, identity: 0.938 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtgatggtgccggtgctggcgctggcgtatac	Protospacer
**.***** ***********************

15. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to JQ691610 (Salmonella phage SPN9TCW, complete genome) position: , mismatch: 2, identity: 0.938 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtgatggtgccggtgctggcgctggcgtatac	Protospacer
**.***** ***********************

16. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NC_004775 (Enterobacteria phage epsilon15, complete genome) position: , mismatch: 2, identity: 0.938 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gtaattgttccggtgctggcgctggcgtagac	Protospacer
***** *********************** **

17. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to CP054565 (Escherichia coli strain SCU-478 isolate rectal swab from healthy college student plasmid pSCU-478-1, complete sequence) position: , mismatch: 3, identity: 0.906 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcaaggcaaacaaacaggctgaatgcgatta	Protospacer
**. *************.**************

18. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to CP054565 (Escherichia coli strain SCU-478 isolate rectal swab from healthy college student plasmid pSCU-478-1, complete sequence) position: , mismatch: 3, identity: 0.906 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcaaggcaaacaaacaggctgaatgcgatta	Protospacer
**. *************.**************

19. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP025860 (Escherichia coli strain 504239 plasmid p504239_101, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

20. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP025922 (Escherichia coli strain 103605 plasmid p103605_83, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

21. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP025912 (Escherichia coli strain 204446 plasmid p204446_92, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

22. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_KT845955 (Escherichia coli strain EP28 plasmid pHNEP28_cfr, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

23. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP042629 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

24. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP042633 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

25. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP025904 (Escherichia coli strain 300709 plasmid p300709_97, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

26. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP025858 (Escherichia coli strain 504838 plasmid p504838_88, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

27. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP043219 (Escherichia coli O80:H26 strain EC-107 plasmid pET6.2-IncFII, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

28. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP018113 (Escherichia coli strain MRSN346595 plasmid pMRSN346595_62.2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

29. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP023348 (Escherichia coli strain ETEC-2265 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

30. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP011135 (Escherichia coli VR50 plasmid pVR50A, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcggggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

31. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP017846 (Escherichia coli strain FMU073332 plasmid pEcoFMU073332b sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

32. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP024276 (Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed1) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

33. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_LT838198 (Escherichia coli isolate WI1 isolate plasmid pWI1-incFII, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

34. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP049082 (Escherichia coli strain p10A plasmid p10A_p1, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

35. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP024287 (Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

36. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

37. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to CP042642 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-4_MCR3, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

38. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP027385 (Escherichia coli strain 2013C-3250 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

39. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP041414 (Escherichia coli strain STEC719 plasmid pSTEC719_3, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

40. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP047381 (Escherichia coli strain CAU16175 plasmid pCAU16175_3, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

41. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP041420 (Escherichia coli strain STEC711 plasmid pSTEC711_4, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

42. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP038299 (Escherichia coli O157:H7 strain TB182A plasmid pTB182A-5, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

43. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to AP014877 (Escherichia coli plasmid pV085-c DNA, complete sequence, strain: V085) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

44. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP010123 (Escherichia coli strain C5 plasmid A, complete genome) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

45. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP010124 (Escherichia coli strain C5 plasmid B, complete genome) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

46. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NC_022333 (Escherichia coli plasmid pCss165Kan DNA, complete genome, strain: 4266 delta cssB::Km) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

47. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_AP018811 (Escherichia coli strain E2865 plasmid pE2865-3, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

48. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NC_019094 (Escherichia coli plasmid p417H-90, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

49. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP027598 (Escherichia coli strain 86-3153 plasmid unnamed) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

50. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP022913 (Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

51. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NC_017643 (Escherichia coli UMNK88 plasmid pUMNK88_Hly, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

52. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NC_019037 (Escherichia coli plasmid pChi7122-2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

53. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to CP025909 (Escherichia coli strain 204576 plasmid p204576_83, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

54. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP042885 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_01, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

55. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP023354 (Escherichia coli strain 746 plasmid p62, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

56. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP027588 (Escherichia coli strain 2013C-4974 plasmid unnamed) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

57. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP032836 (Klebsiella pneumoniae strain INF237 plasmid pINF237_03, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

58. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP029982 (Escherichia coli strain 99-3165 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

59. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP034167 (Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-3, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

60. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP030785 (Escherichia albertii strain 2012EL-1823B plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

61. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP030786 (Escherichia albertii strain 2012EL-1823B plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

62. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to AP018354 (Escherichia coli plasmid pVE155 DNA, complete genome, strain: E155) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

63. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NC_013362 (Escherichia coli O26:H11 str. 11368 plasmid pO26_2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

64. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP018107 (Escherichia coli strain MRSN352231 plasmid pMR0716_IncFII, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

65. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP020338 (Shigella flexneri 4c strain 1602 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

66. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to CP025971 (Escherichia coli strain 11573 a-1 plasmid p11573a1_92, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

67. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to CP025974 (Escherichia coli strain 10802 a plasmid p10802a_92, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

68. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to CP025977 (Escherichia coli strain 10754 a-1 plasmid p10754a1_92, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

69. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP019910 (Escherichia coli strain MDR_56 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

70. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP026931 (Escherichia coli strain CFS3246 plasmid pCFS3246-2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

71. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_LT985265 (Escherichia coli strain 364 plasmid RCS57TR364_p, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

72. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NC_017724 (Escherichia coli ETEC H10407 plasmid p948, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

73. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_MG904998 (Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

74. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP025918 (Escherichia coli strain 120899 plasmid p120899_76, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

75. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to CP043740 (Escherichia coli strain CVM N17EC0320 plasmid pN17EC0320-1, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

76. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP023828 (Escherichia coli strain 4/4 plasmid p4_4.2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

77. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP025860 (Escherichia coli strain 504239 plasmid p504239_101, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

78. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP025922 (Escherichia coli strain 103605 plasmid p103605_83, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

79. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP025912 (Escherichia coli strain 204446 plasmid p204446_92, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

80. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_KT845955 (Escherichia coli strain EP28 plasmid pHNEP28_cfr, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

81. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP042629 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

82. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP042633 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

83. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP025904 (Escherichia coli strain 300709 plasmid p300709_97, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

84. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP025858 (Escherichia coli strain 504838 plasmid p504838_88, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

85. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP043219 (Escherichia coli O80:H26 strain EC-107 plasmid pET6.2-IncFII, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

86. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP018113 (Escherichia coli strain MRSN346595 plasmid pMRSN346595_62.2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

87. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP023348 (Escherichia coli strain ETEC-2265 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

88. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP011135 (Escherichia coli VR50 plasmid pVR50A, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcggggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

89. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP017846 (Escherichia coli strain FMU073332 plasmid pEcoFMU073332b sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

90. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP024276 (Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed1) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

91. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_LT838198 (Escherichia coli isolate WI1 isolate plasmid pWI1-incFII, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

92. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP049082 (Escherichia coli strain p10A plasmid p10A_p1, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

93. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP024287 (Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

94. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

95. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to CP042642 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-4_MCR3, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

96. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP027385 (Escherichia coli strain 2013C-3250 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

97. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP041414 (Escherichia coli strain STEC719 plasmid pSTEC719_3, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

98. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP047381 (Escherichia coli strain CAU16175 plasmid pCAU16175_3, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

99. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP041420 (Escherichia coli strain STEC711 plasmid pSTEC711_4, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

100. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP038299 (Escherichia coli O157:H7 strain TB182A plasmid pTB182A-5, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

101. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to AP014877 (Escherichia coli plasmid pV085-c DNA, complete sequence, strain: V085) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

102. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP010123 (Escherichia coli strain C5 plasmid A, complete genome) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

103. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP010124 (Escherichia coli strain C5 plasmid B, complete genome) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

104. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NC_022333 (Escherichia coli plasmid pCss165Kan DNA, complete genome, strain: 4266 delta cssB::Km) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

105. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_AP018811 (Escherichia coli strain E2865 plasmid pE2865-3, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

106. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NC_019094 (Escherichia coli plasmid p417H-90, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

107. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP027598 (Escherichia coli strain 86-3153 plasmid unnamed) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

108. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP022913 (Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

109. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NC_017643 (Escherichia coli UMNK88 plasmid pUMNK88_Hly, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

110. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NC_019037 (Escherichia coli plasmid pChi7122-2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

111. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to CP025909 (Escherichia coli strain 204576 plasmid p204576_83, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

112. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP042885 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_01, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

113. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP023354 (Escherichia coli strain 746 plasmid p62, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

114. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP027588 (Escherichia coli strain 2013C-4974 plasmid unnamed) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

115. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP032836 (Klebsiella pneumoniae strain INF237 plasmid pINF237_03, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

116. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP029982 (Escherichia coli strain 99-3165 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

117. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP034167 (Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-3, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

118. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP030785 (Escherichia albertii strain 2012EL-1823B plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

119. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP030786 (Escherichia albertii strain 2012EL-1823B plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

120. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to AP018354 (Escherichia coli plasmid pVE155 DNA, complete genome, strain: E155) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

121. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NC_013362 (Escherichia coli O26:H11 str. 11368 plasmid pO26_2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

122. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP018107 (Escherichia coli strain MRSN352231 plasmid pMR0716_IncFII, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

123. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP020338 (Shigella flexneri 4c strain 1602 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

124. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to CP025971 (Escherichia coli strain 11573 a-1 plasmid p11573a1_92, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

125. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to CP025974 (Escherichia coli strain 10802 a plasmid p10802a_92, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

126. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to CP025977 (Escherichia coli strain 10754 a-1 plasmid p10754a1_92, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

127. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP019910 (Escherichia coli strain MDR_56 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

128. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP026931 (Escherichia coli strain CFS3246 plasmid pCFS3246-2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

129. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_LT985265 (Escherichia coli strain 364 plasmid RCS57TR364_p, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

130. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NC_017724 (Escherichia coli ETEC H10407 plasmid p948, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

131. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_MG904998 (Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

132. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP025918 (Escherichia coli strain 120899 plasmid p120899_76, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

133. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to CP043740 (Escherichia coli strain CVM N17EC0320 plasmid pN17EC0320-1, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

134. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP023828 (Escherichia coli strain 4/4 plasmid p4_4.2, complete sequence) position: , mismatch: 4, identity: 0.875 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcagggcaaacaaacaggctgaatgcgatta	Protospacer
**. .************.**************

135. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844 

gtaatggttccggtgctggcgctggcgtatac-	CRISPR spacer
gcaatgattccgctgctggcgctgg-gtattcc	Protospacer
*.****.***** ************ **** *

136. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844 

gtaatggttccggtgctggcgctggcgtatac-	CRISPR spacer
gcaatgattccgctgctggcgctgg-gtattcc	Protospacer
*.****.***** ************ **** *

137. spacer 6.1|3693023|33|NZ_CP042505|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818 

caccccggctacgccagcacctggcgctgacag	CRISPR spacer
aagcccggctgcgccagcacctggcgcagcaag	Protospacer
 * *******.**************** *  **

138. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP013125 (Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence) position: , mismatch: 6, identity: 0.812 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gcaatggttcaggtgctggcgctggagttatc	Protospacer
*.******** ************** **   *

139. spacer 7.20|3747580|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_KJ599675 (Micrococcus sp. A7 plasmid pLMA7, complete sequence) position: , mismatch: 6, identity: 0.812 

tcggggtaa-ctgccgatcgtctcggcccacgt	CRISPR spacer
-gggagcaatctgccgatcttctcggctcacgt	Protospacer
  **.*.** ********* *******.*****

140. spacer 7.20|3747580|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_KR152226 (Micrococcus sp. MG-2010-D12 plasmid pJD12, complete sequence) position: , mismatch: 6, identity: 0.812 

tcggggtaa-ctgccgatcgtctcggcccacgt	CRISPR spacer
-gggagcaatctgccgatcttctcggctcacgt	Protospacer
  **.*.** ********* *******.*****

141. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NZ_CP013125 (Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence) position: , mismatch: 6, identity: 0.812 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gcaatggttcaggtgctggcgctggagttatc	Protospacer
*.******** ************** **   *

142. spacer 7.42|3747581|32|NZ_CP042505|PILER-CR matches to NZ_KJ599675 (Micrococcus sp. A7 plasmid pLMA7, complete sequence) position: , mismatch: 6, identity: 0.812 

tcggggtaa-ctgccgatcgtctcggcccacgt	CRISPR spacer
-gggagcaatctgccgatcttctcggctcacgt	Protospacer
  **.*.** ********* *******.*****

143. spacer 7.42|3747581|32|NZ_CP042505|PILER-CR matches to NZ_KR152226 (Micrococcus sp. MG-2010-D12 plasmid pJD12, complete sequence) position: , mismatch: 6, identity: 0.812 

tcggggtaa-ctgccgatcgtctcggcccacgt	CRISPR spacer
-gggagcaatctgccgatcttctcggctcacgt	Protospacer
  **.*.** ********* *******.*****

144. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781 

gtaatggttccggtgctggcgctggcgtatac-	CRISPR spacer
gcggtggttgcggtgctggcgctggcg-gtgca	Protospacer
*...***** ***************** .*.*

145. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP018030 (Alteromonas mediterranea strain RG65 plasmid MRG65-300, complete sequence) position: , mismatch: 7, identity: 0.781 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcgaggcaaataaacaatctgaatgcgacgt	Protospacer
**. *******.****** **********.

146. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781 

gtaatggttccggtgctggcgctggcgtatac-	CRISPR spacer
gcggtggttgcggtgctggcgctggcg-gtgca	Protospacer
*...***** ***************** .*.*

147. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to NZ_CP018030 (Alteromonas mediterranea strain RG65 plasmid MRG65-300, complete sequence) position: , mismatch: 7, identity: 0.781 

tttcaggcaaacaaacaagctgaatgcgatta	CRISPR spacer
ttcgaggcaaataaacaatctgaatgcgacgt	Protospacer
**. *******.****** **********.

148. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MK552105 (Escherichia phage Jahat_MG145, complete genome) position: , mismatch: 8, identity: 0.75 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
ttgttggttcctgtgctggcgctggcgttcca	Protospacer
 *. ******* **************** .

149. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_KX786187 (Enterobacter cloacae strain N14-0444 plasmid pIMI-6, complete sequence) position: , mismatch: 8, identity: 0.75 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cttggtgttacggtgctggcgctggcggatat	Protospacer
 * .  *** ***************** ***.

150. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_KT225520 (Raoultella ornithinolytica strain RJ46C plasmid pRJ46C, complete sequence) position: , mismatch: 8, identity: 0.75 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cttggtgttacggtgctggcgctggcggatat	Protospacer
 * .  *** ***************** ***.

151. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to KT780723 (Uncultured bacterium plasmid pGA45, complete sequence) position: , mismatch: 8, identity: 0.75 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cttggtgttacggtgctggcgctggcggatat	Protospacer
 * .  *** ***************** ***.

152. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 8, identity: 0.75 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
attctggtgccgatgctggcgctggcgcacgc	Protospacer
.*  **** ***.**************.*..*

153. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MT657341 (Mycobacterium phage Estes, complete genome) position: , mismatch: 8, identity: 0.75 

tttcaggcaaacaaacaagctgaatgcgatta-	CRISPR spacer
tttccggcaaacaaacaacctgaa-atagttgt	Protospacer
**** ************* ***** ....**.

154. spacer 7.7|3746787|32|NZ_CP042505|CRISPRCasFinder,CRT matches to JF937105 (Mycobacterium phage Rey, complete genome) position: , mismatch: 8, identity: 0.75 

tttcaggcaaacaaacaagctgaatgcgatta-	CRISPR spacer
tttccggcaaacaaacaacctgaa-atagttgt	Protospacer
**** ************* ***** ....**.

155. spacer 7.17|3747397|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 8, identity: 0.75 

aaaaacagctactggaaccctgcgctcgcaaa	CRISPR spacer
cttgcgagctacgggaaccctgcgctcgcaca	Protospacer
   .  ****** ***************** *

156. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to MK552105 (Escherichia phage Jahat_MG145, complete genome) position: , mismatch: 8, identity: 0.75 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
ttgttggttcctgtgctggcgctggcgttcca	Protospacer
 *. ******* **************** .

157. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NZ_KX786187 (Enterobacter cloacae strain N14-0444 plasmid pIMI-6, complete sequence) position: , mismatch: 8, identity: 0.75 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cttggtgttacggtgctggcgctggcggatat	Protospacer
 * .  *** ***************** ***.

158. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NZ_KT225520 (Raoultella ornithinolytica strain RJ46C plasmid pRJ46C, complete sequence) position: , mismatch: 8, identity: 0.75 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cttggtgttacggtgctggcgctggcggatat	Protospacer
 * .  *** ***************** ***.

159. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to KT780723 (Uncultured bacterium plasmid pGA45, complete sequence) position: , mismatch: 8, identity: 0.75 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cttggtgttacggtgctggcgctggcggatat	Protospacer
 * .  *** ***************** ***.

160. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 8, identity: 0.75 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
attctggtgccgatgctggcgctggcgcacgc	Protospacer
.*  **** ***.**************.*..*

161. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to MT657341 (Mycobacterium phage Estes, complete genome) position: , mismatch: 8, identity: 0.75 

tttcaggcaaacaaacaagctgaatgcgatta-	CRISPR spacer
tttccggcaaacaaacaacctgaa-atagttgt	Protospacer
**** ************* ***** ....**.

162. spacer 7.29|3746788|32|NZ_CP042505|PILER-CR matches to JF937105 (Mycobacterium phage Rey, complete genome) position: , mismatch: 8, identity: 0.75 

tttcaggcaaacaaacaagctgaatgcgatta-	CRISPR spacer
tttccggcaaacaaacaacctgaa-atagttgt	Protospacer
**** ************* ***** ....**.

163. spacer 7.39|3747398|32|NZ_CP042505|PILER-CR matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 8, identity: 0.75 

aaaaacagctactggaaccctgcgctcgcaaa	CRISPR spacer
cttgcgagctacgggaaccctgcgctcgcaca	Protospacer
   .  ****** ***************** *

164. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP028270 (Pediococcus pentosaceus strain SRCM102740 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

165. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP028267 (Pediococcus pentosaceus strain SRCM102739 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

166. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP015919 (Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

167. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP028265 (Pediococcus pentosaceus strain SRCM102738 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

168. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP031004 (Lactobacillus curvatus strain TMW 1.1928 plasmid p-1.1928_1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

169. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP021928 (Pediococcus pentosaceus strain SRCM100194 plasmid pPP194-2, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

170. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gaggtggtgccgctgctggcgctggcgtggca	Protospacer
* ..**** *** ***************.

171. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NC_019369 (Burkholderia cepacia plasmid pYS1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
atccaggtgccggtgctggcgatggcgtgcat	Protospacer
.*   *** ************ ******..*.

172. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MN693890 (Marine virus AFVG_250M637, complete genome) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gctctggtgccggtgctggcggtggcggttcg	Protospacer
*.  **** ************ *****  *

173. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MN693630 (Marine virus AFVG_250M640, complete genome) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gctctggtgccggtgctggcggtggcggttcg	Protospacer
*.  **** ************ *****  *

174. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MN693538 (Marine virus AFVG_25M196, complete genome) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
ctgacggttctggtgctggcactggcgttgtt	Protospacer
 *.*.*****.*********.*******   .

175. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MN693980 (Marine virus AFVG_250M1182, complete genome) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gctctggtgccggtgctggcggtggcggttcg	Protospacer
*.  **** ************ *****  *

176. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MN694080 (Marine virus AFVG_250M639, complete genome) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gctctggtgccggtgctggcggtggcggttcg	Protospacer
*.  **** ************ *****  *

177. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MN694696 (Marine virus AFVG_250M540, complete genome) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac-	CRISPR spacer
tatctggttccggtgcaggtgctggcgc-tgca	Protospacer
    ************ **.*******. *.*

178. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MN694192 (Marine virus AFVG_250M638, complete genome) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gctctggtgccggtgctggcggtggcggttcg	Protospacer
*.  **** ************ *****  *

179. spacer 7.10|3746970|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_KX015668 (Enterobacter cloacae strain CY01 plasmid pCY-CTX, complete sequence) position: , mismatch: 9, identity: 0.719 

agatagatcaattaaccctgattgatcgtttt	CRISPR spacer
tcagcgatcaattaactgtgattgatcgctga	Protospacer
  *  ***********. **********.*

180. spacer 7.10|3746970|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP030078 (Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence) position: , mismatch: 9, identity: 0.719 

agatagatcaattaaccctgattgatcgtttt	CRISPR spacer
tcagcgatcaattaactgtgattgatcgctga	Protospacer
  *  ***********. **********.*

181. spacer 7.10|3746970|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP029247 (Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_F, complete sequence) position: , mismatch: 9, identity: 0.719 

agatagatcaattaaccctgattgatcgtttt	CRISPR spacer
tcagcgatcaattaactgtgattgatcgctga	Protospacer
  *  ***********. **********.*

182. spacer 7.10|3746970|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP051133 (Enterobacter hormaechei strain AMS-38 plasmid pAMS-38a, complete sequence) position: , mismatch: 9, identity: 0.719 

agatagatcaattaaccctgattgatcgtttt	CRISPR spacer
tcagcgatcaattaactgtgattgatcgctga	Protospacer
  *  ***********. **********.*

183. spacer 7.11|3747031|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NC_018067 (Desulfosporosinus acidiphilus SJ4 plasmid pDESACI.02, complete sequence) position: , mismatch: 9, identity: 0.719 

cggtagccagtgccggttaccgtttcgaaagg	CRISPR spacer
cggtagcaagtgccgcttaccgttctggtgaa	Protospacer
******* ******* ********..*. ...

184. spacer 7.11|3747031|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_MN366357 (Bacterium plasmid pALTS28, complete sequence) position: , mismatch: 9, identity: 0.719 

cggtagccagtgccggttaccgtttcgaaagg	CRISPR spacer
cggtcgccagtgccggttacggtggccggccg	Protospacer
**** *************** **  * ..  *

185. spacer 7.11|3747031|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP020047 (Thiomonas intermedia strain ATCC 15466 plasmid pXI1, complete sequence) position: , mismatch: 9, identity: 0.719 

cggtagccagtgccggttaccgtttcgaaagg	CRISPR spacer
cggtcgccagtgccggttacggtggccggccg	Protospacer
**** *************** **  * ..  *

186. spacer 7.11|3747031|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MF495477 (Aeromonas salmonicida plasmid pS28-3, complete sequence) position: , mismatch: 9, identity: 0.719 

cggtagccagtgccggttaccgtttcgaaagg	CRISPR spacer
cggtcgccagtgccggttacggtggccggccg	Protospacer
**** *************** **  * ..  *

187. spacer 7.11|3747031|32|NZ_CP042505|CRISPRCasFinder,CRT matches to KJ850907 (Uncultured bacterium plasmid pSFA231, complete sequence) position: , mismatch: 9, identity: 0.719 

cggtagccagtgccggttaccgtttcgaaagg	CRISPR spacer
cggtcgccagtgccggttacggtggccggccg	Protospacer
**** *************** **  * ..  *

188. spacer 7.14|3747214|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP037863 (Citrobacter sp. LY-1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

tgctgcgtacccgcaaattaaccgttgcgggg	CRISPR spacer
agctgcgtacccgcaaatggaccgatcagtct	Protospacer
 ***************** .**** *  *

189. spacer 7.17|3747397|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 9, identity: 0.719 

aaaaacagctactggaaccctgcgctcgcaaa	CRISPR spacer
ggctacatctactggaaccctgcgatcggcac	Protospacer
..  *** **************** ***  *

190. spacer 7.19|3747519|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_KU980950 (Escherichia coli strain WE-0250 plasmid U2501, complete sequence) position: , mismatch: 9, identity: 0.719 

atgccatcagcagtctgtttaaaaatgccgta	CRISPR spacer
atgccatcaccattctgtttaaaaccagtatc	Protospacer
********* ** *********** .. ..*

191. spacer 7.19|3747519|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 9, identity: 0.719 

atgccatcagcagtctgtttaaaaatgccgta	CRISPR spacer
atgccatcaccattctgtttaaaaccagtatc	Protospacer
********* ** *********** .. ..*

192. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NZ_CP028270 (Pediococcus pentosaceus strain SRCM102740 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

193. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NZ_CP028267 (Pediococcus pentosaceus strain SRCM102739 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

194. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NZ_CP015919 (Pediococcus pentosaceus strain wikim20 plasmid pKPP01, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

195. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NZ_CP028265 (Pediococcus pentosaceus strain SRCM102738 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

196. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NZ_CP031004 (Lactobacillus curvatus strain TMW 1.1928 plasmid p-1.1928_1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

197. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NZ_CP021928 (Pediococcus pentosaceus strain SRCM100194 plasmid pPP194-2, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
cgattggtaccggtgttggcgctggcgtcatt	Protospacer
  * **** ******.************   .

198. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gaggtggtgccgctgctggcgctggcgtggca	Protospacer
* ..**** *** ***************.

199. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NC_019369 (Burkholderia cepacia plasmid pYS1, complete sequence) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
atccaggtgccggtgctggcgatggcgtgcat	Protospacer
.*   *** ************ ******..*.

200. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to MN693890 (Marine virus AFVG_250M637, complete genome) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gctctggtgccggtgctggcggtggcggttcg	Protospacer
*.  **** ************ *****  *

201. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to MN693630 (Marine virus AFVG_250M640, complete genome) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gctctggtgccggtgctggcggtggcggttcg	Protospacer
*.  **** ************ *****  *

202. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to MN693538 (Marine virus AFVG_25M196, complete genome) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
ctgacggttctggtgctggcactggcgttgtt	Protospacer
 *.*.*****.*********.*******   .

203. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to MN693980 (Marine virus AFVG_250M1182, complete genome) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gctctggtgccggtgctggcggtggcggttcg	Protospacer
*.  **** ************ *****  *

204. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to MN694080 (Marine virus AFVG_250M639, complete genome) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gctctggtgccggtgctggcggtggcggttcg	Protospacer
*.  **** ************ *****  *

205. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to MN694696 (Marine virus AFVG_250M540, complete genome) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac-	CRISPR spacer
tatctggttccggtgcaggtgctggcgc-tgca	Protospacer
    ************ **.*******. *.*

206. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to MN694192 (Marine virus AFVG_250M638, complete genome) position: , mismatch: 9, identity: 0.719 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gctctggtgccggtgctggcggtggcggttcg	Protospacer
*.  **** ************ *****  *

207. spacer 7.32|3746971|32|NZ_CP042505|PILER-CR matches to NZ_KX015668 (Enterobacter cloacae strain CY01 plasmid pCY-CTX, complete sequence) position: , mismatch: 9, identity: 0.719 

agatagatcaattaaccctgattgatcgtttt	CRISPR spacer
tcagcgatcaattaactgtgattgatcgctga	Protospacer
  *  ***********. **********.*

208. spacer 7.32|3746971|32|NZ_CP042505|PILER-CR matches to NZ_CP030078 (Enterobacter hormaechei strain 20710 plasmid p4-20710, complete sequence) position: , mismatch: 9, identity: 0.719 

agatagatcaattaaccctgattgatcgtttt	CRISPR spacer
tcagcgatcaattaactgtgattgatcgctga	Protospacer
  *  ***********. **********.*

209. spacer 7.32|3746971|32|NZ_CP042505|PILER-CR matches to NZ_CP029247 (Enterobacter hormaechei subsp. xiangfangensis strain OSUVMCKPC4-2 plasmid pOSUEC_F, complete sequence) position: , mismatch: 9, identity: 0.719 

agatagatcaattaaccctgattgatcgtttt	CRISPR spacer
tcagcgatcaattaactgtgattgatcgctga	Protospacer
  *  ***********. **********.*

210. spacer 7.32|3746971|32|NZ_CP042505|PILER-CR matches to NZ_CP051133 (Enterobacter hormaechei strain AMS-38 plasmid pAMS-38a, complete sequence) position: , mismatch: 9, identity: 0.719 

agatagatcaattaaccctgattgatcgtttt	CRISPR spacer
tcagcgatcaattaactgtgattgatcgctga	Protospacer
  *  ***********. **********.*

211. spacer 7.33|3747032|32|NZ_CP042505|PILER-CR matches to NC_018067 (Desulfosporosinus acidiphilus SJ4 plasmid pDESACI.02, complete sequence) position: , mismatch: 9, identity: 0.719 

cggtagccagtgccggttaccgtttcgaaagg	CRISPR spacer
cggtagcaagtgccgcttaccgttctggtgaa	Protospacer
******* ******* ********..*. ...

212. spacer 7.33|3747032|32|NZ_CP042505|PILER-CR matches to NZ_MN366357 (Bacterium plasmid pALTS28, complete sequence) position: , mismatch: 9, identity: 0.719 

cggtagccagtgccggttaccgtttcgaaagg	CRISPR spacer
cggtcgccagtgccggttacggtggccggccg	Protospacer
**** *************** **  * ..  *

213. spacer 7.33|3747032|32|NZ_CP042505|PILER-CR matches to NZ_CP020047 (Thiomonas intermedia strain ATCC 15466 plasmid pXI1, complete sequence) position: , mismatch: 9, identity: 0.719 

cggtagccagtgccggttaccgtttcgaaagg	CRISPR spacer
cggtcgccagtgccggttacggtggccggccg	Protospacer
**** *************** **  * ..  *

214. spacer 7.33|3747032|32|NZ_CP042505|PILER-CR matches to MF495477 (Aeromonas salmonicida plasmid pS28-3, complete sequence) position: , mismatch: 9, identity: 0.719 

cggtagccagtgccggttaccgtttcgaaagg	CRISPR spacer
cggtcgccagtgccggttacggtggccggccg	Protospacer
**** *************** **  * ..  *

215. spacer 7.33|3747032|32|NZ_CP042505|PILER-CR matches to KJ850907 (Uncultured bacterium plasmid pSFA231, complete sequence) position: , mismatch: 9, identity: 0.719 

cggtagccagtgccggttaccgtttcgaaagg	CRISPR spacer
cggtcgccagtgccggttacggtggccggccg	Protospacer
**** *************** **  * ..  *

216. spacer 7.36|3747215|32|NZ_CP042505|PILER-CR matches to NZ_CP037863 (Citrobacter sp. LY-1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

tgctgcgtacccgcaaattaaccgttgcgggg	CRISPR spacer
agctgcgtacccgcaaatggaccgatcagtct	Protospacer
 ***************** .**** *  *

217. spacer 7.39|3747398|32|NZ_CP042505|PILER-CR matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 9, identity: 0.719 

aaaaacagctactggaaccctgcgctcgcaaa	CRISPR spacer
ggctacatctactggaaccctgcgatcggcac	Protospacer
..  *** **************** ***  *

218. spacer 7.41|3747520|32|NZ_CP042505|PILER-CR matches to NZ_KU980950 (Escherichia coli strain WE-0250 plasmid U2501, complete sequence) position: , mismatch: 9, identity: 0.719 

atgccatcagcagtctgtttaaaaatgccgta	CRISPR spacer
atgccatcaccattctgtttaaaaccagtatc	Protospacer
********* ** *********** .. ..*

219. spacer 7.41|3747520|32|NZ_CP042505|PILER-CR matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 9, identity: 0.719 

atgccatcagcagtctgtttaaaaatgccgta	CRISPR spacer
atgccatcaccattctgtttaaaaccagtatc	Protospacer
********* ** *********** .. ..*

220. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MN850643 (Escherichia phage tiwna, complete genome) position: , mismatch: 10, identity: 0.688 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
tggttggttcttgtgctggcgctggcgtgccg	Protospacer
  . ******. ****************..

221. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NC_048206 (Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.688 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
tggttggttcttgtgctggcgctggcgtgccg	Protospacer
  . ******. ****************..

222. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to LR027385 (Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.688 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
tggttggttcttgtgctggcgctggcgtgccg	Protospacer
  . ******. ****************..

223. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MN850641 (Escherichia phage tonijn, complete genome) position: , mismatch: 10, identity: 0.688 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
tggttggttcttgtgctggcgctggcgtgccg	Protospacer
  . ******. ****************..

224. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 10, identity: 0.688 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gcggtggtgccggtggtggcgctggcggcggt	Protospacer
*...**** ****** ***********   ..

225. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to KJ944830 (Pseudoalteromonas phage B8b, partial genome) position: , mismatch: 10, identity: 0.688 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gcgctggtgctggtgctggcgctggcgctggt	Protospacer
*.. **** *.****************.  ..

226. spacer 7.3|3746543|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 10, identity: 0.688 

taaaagcgatcccagacctgtccggcctaaaa	CRISPR spacer
ccaaagcgatcccagaccgatccggttcatcc	Protospacer
. **************** .*****...*

227. spacer 7.6|3746726|32|NZ_CP042505|CRISPRCasFinder,CRT matches to MN694742 (Marine virus AFVG_250M371, complete genome) position: , mismatch: 10, identity: 0.688 

taaatggggtgacaaaatgagaagggcagaaa	CRISPR spacer
agtatggggtgacaaaatgacaggggtgacag	Protospacer
 . ***************** *.***... *.

228. spacer 7.13|3747153|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP034939 (Pectobacterium odoriferum strain JK2.1 plasmid p.Jk2_1, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgctactacgcaggaatcgttaaggcgaacg	CRISPR spacer
gacaaattacgcaggaatcgttcacgcgaaaa	Protospacer
     *.*************** * ***** .

229. spacer 7.14|3747214|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 10, identity: 0.688 

tgctgcgtacccgcaaattaaccgttgcgggg	CRISPR spacer
agctgcgtacccgcaaatggaccgatcaatcc	Protospacer
 ***************** .**** *  .

230. spacer 7.19|3747519|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 10, identity: 0.688 

atgccatcagcagtctgtttaaaaatgccgta	CRISPR spacer
tcaacatcagcagtcaggttaaaaatggtcga	Protospacer
 .. *********** * ********* .  *

231. spacer 7.23|3747763|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NC_022061 (Mycobacterium phage KayaCho, complete genome) position: , mismatch: 10, identity: 0.688 

atcaggtgacgcagttcaaccgctgcaatctg	CRISPR spacer
ggaaggtgacgctgttcatccgctgctccatc	Protospacer
.  ********* ***** *******  . *

232. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to MN850643 (Escherichia phage tiwna, complete genome) position: , mismatch: 10, identity: 0.688 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
tggttggttcttgtgctggcgctggcgtgccg	Protospacer
  . ******. ****************..

233. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NC_048206 (Escherichia virus vB_Eco_mar001J1 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.688 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
tggttggttcttgtgctggcgctggcgtgccg	Protospacer
  . ******. ****************..

234. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to LR027385 (Escherichia virus vB_Eco_mar001J1 strain vB_Eco_mar002J2 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.688 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
tggttggttcttgtgctggcgctggcgtgccg	Protospacer
  . ******. ****************..

235. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to MN850641 (Escherichia phage tonijn, complete genome) position: , mismatch: 10, identity: 0.688 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
tggttggttcttgtgctggcgctggcgtgccg	Protospacer
  . ******. ****************..

236. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 10, identity: 0.688 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gcggtggtgccggtggtggcgctggcggcggt	Protospacer
*...**** ****** ***********   ..

237. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to KJ944830 (Pseudoalteromonas phage B8b, partial genome) position: , mismatch: 10, identity: 0.688 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
gcgctggtgctggtgctggcgctggcgctggt	Protospacer
*.. **** *.****************.  ..

238. spacer 7.25|3746544|32|NZ_CP042505|PILER-CR matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 10, identity: 0.688 

taaaagcgatcccagacctgtccggcctaaaa	CRISPR spacer
ccaaagcgatcccagaccgatccggttcatcc	Protospacer
. **************** .*****...*

239. spacer 7.28|3746727|32|NZ_CP042505|PILER-CR matches to MN694742 (Marine virus AFVG_250M371, complete genome) position: , mismatch: 10, identity: 0.688 

taaatggggtgacaaaatgagaagggcagaaa	CRISPR spacer
agtatggggtgacaaaatgacaggggtgacag	Protospacer
 . ***************** *.***... *.

240. spacer 7.35|3747154|32|NZ_CP042505|PILER-CR matches to NZ_CP034939 (Pectobacterium odoriferum strain JK2.1 plasmid p.Jk2_1, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgctactacgcaggaatcgttaaggcgaacg	CRISPR spacer
gacaaattacgcaggaatcgttcacgcgaaaa	Protospacer
     *.*************** * ***** .

241. spacer 7.36|3747215|32|NZ_CP042505|PILER-CR matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 10, identity: 0.688 

tgctgcgtacccgcaaattaaccgttgcgggg	CRISPR spacer
agctgcgtacccgcaaatggaccgatcaatcc	Protospacer
 ***************** .**** *  .

242. spacer 7.41|3747520|32|NZ_CP042505|PILER-CR matches to NC_011880 (Cyanothece sp. PCC 7425 plasmid pP742501, complete sequence) position: , mismatch: 10, identity: 0.688 

atgccatcagcagtctgtttaaaaatgccgta	CRISPR spacer
tcaacatcagcagtcaggttaaaaatggtcga	Protospacer
 .. *********** * ********* .  *

243. spacer 7.45|3747764|32|NZ_CP042505|PILER-CR matches to NC_022061 (Mycobacterium phage KayaCho, complete genome) position: , mismatch: 10, identity: 0.688 

atcaggtgacgcagttcaaccgctgcaatctg	CRISPR spacer
ggaaggtgacgctgttcatccgctgctccatc	Protospacer
.  ********* ***** *******  . *

244. spacer 7.2|3746482|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP041164 (Leisingera aquaemixtae strain R2C4 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.656 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
acggtggtgccggtgctggcgctgtcgctgct	Protospacer
....**** *************** **.   .

245. spacer 7.8|3746848|32|NZ_CP042505|CRISPRCasFinder,CRT matches to NZ_CP049359 (Deinococcus wulumuqiensis R12 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656 

tcccttgagaagctgcgaagccgaggcaccgc	CRISPR spacer
ggacttgcgaagctgcgaagcagaggaggaaa	Protospacer
   **** ************* **** .  .

246. spacer 7.24|3746483|32|NZ_CP042505|PILER-CR matches to NZ_CP041164 (Leisingera aquaemixtae strain R2C4 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.656 

gtaatggttccggtgctggcgctggcgtatac	CRISPR spacer
acggtggtgccggtgctggcgctgtcgctgct	Protospacer
....**** *************** **.   .

247. spacer 7.30|3746849|32|NZ_CP042505|PILER-CR matches to NZ_CP049359 (Deinococcus wulumuqiensis R12 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656 

tcccttgagaagctgcgaagccgaggcaccgc	CRISPR spacer
ggacttgcgaagctgcgaagcagaggaggaaa	Protospacer
   **** ************* **** .  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2103232 : 2162238 67 Escherichia_phage(43.4%) transposase,terminase,holin,tail,coat NA
DBSCAN-SWA_2 2609372 : 2621613 10 Enterobacteria_phage(42.86%) terminase NA
DBSCAN-SWA_3 2830900 : 2898453 68 Enterobacteria_phage(30.43%) plate,tail,head,protease,integrase,coat attL 2878010:2878069|attR 2898573:2898636
DBSCAN-SWA_4 3658662 : 3666109 7 Mycobacterium_phage(33.33%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP042508
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 58040 60 Escherichia_phage(73.33%) plate,holin,capsid,portal,lysis,head,tail NA
DBSCAN-SWA_2 65004 : 73671 11 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_3 78566 : 87370 9 Escherichia_phage(50.0%) integrase,transposase,terminase attL 76493:76510|attR 87212:87229
DBSCAN-SWA_4 92194 : 92524 1 Vibrio_phage(100.0%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP042509
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2110 : 44059 57 Escherichia_phage(25.0%) integrase,transposase,protease attL 10460:10474|attR 48950:48964

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP042507
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6533 : 60093 52 uncultured_Caudovirales_phage(43.75%) transposase NA
DBSCAN-SWA_2 86783 : 138829 44 Caulobacter_phage(27.27%) protease,integrase,holin,transposase attL 96628:96642|attR 129886:129900

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage