Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP044423 Paracoccus pantotrophus strain DSM 2944 chromosome 2, complete sequence 0 crisprs DEDDh,csa3 0 0 127 0
NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 0 crisprs csa3,DEDDh 0 0 0 0
NZ_CP044426 Paracoccus pantotrophus strain DSM 2944 chromosome 1, complete sequence 2 crisprs PrimPol,cas3,WYL,DEDDh 0 4 155 0
NZ_CP044424 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP044423
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 13729 16 Paracoccus_phage(30.0%) protease,tail,capsid,head,portal NA
DBSCAN-SWA_2 20106 : 22542 2 Diadromus_pulchellus_ascovirus(50.0%) NA NA
DBSCAN-SWA_3 25884 : 30925 5 Yersinia_phage(50.0%) NA NA
DBSCAN-SWA_4 45373 : 46804 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_5 51564 : 57046 5 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_6 62572 : 65822 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_7 69333 : 70833 1 Marinomonas_phage(100.0%) NA NA
DBSCAN-SWA_8 76315 : 77632 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_9 97577 : 105827 8 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_10 166866 : 171333 6 Stx2-converting_phage(50.0%) transposase,integrase attL 159850:159866|attR 175572:175588
DBSCAN-SWA_11 174914 : 195053 14 Planktothrix_phage(28.57%) NA NA
DBSCAN-SWA_12 199644 : 201447 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_13 205992 : 209475 3 Catovirus(50.0%) transposase NA
DBSCAN-SWA_14 220301 : 221066 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_15 224937 : 228467 3 Paenibacillus_phage(50.0%) transposase NA
DBSCAN-SWA_16 233762 : 233987 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_17 241147 : 242059 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_18 246509 : 248165 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_19 267581 : 269894 2 Lausannevirus(50.0%) NA NA
DBSCAN-SWA_20 275049 : 276330 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_21 279523 : 284927 5 uncultured_virus(66.67%) NA NA
DBSCAN-SWA_22 292820 : 293288 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_23 297276 : 339720 40 Ostreococcus_lucimarinus_virus(11.11%) transposase,integrase,protease attL 295685:295702|attR 340951:340968
DBSCAN-SWA_24 350970 : 351468 1 Adoxophyes_orana_granulovirus(100.0%) NA NA
DBSCAN-SWA_25 357988 : 361536 4 Stx2-converting_phage(50.0%) transposase NA
DBSCAN-SWA_26 366773 : 371219 4 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_27 375568 : 378963 3 Oenococcus_phage(33.33%) NA NA
DBSCAN-SWA_28 384254 : 391782 7 uncultured_Caudovirales_phage(75.0%) transposase NA
DBSCAN-SWA_29 406177 : 412130 5 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_30 417884 : 426687 10 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_31 431468 : 432875 1 Escherichia_phage(100.0%) tRNA NA
DBSCAN-SWA_32 442765 : 447370 4 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_33 450920 : 451208 1 Shigella_phage(100.0%) NA NA
DBSCAN-SWA_34 456514 : 457195 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_35 479406 : 480519 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_36 488998 : 490000 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_37 493223 : 494944 2 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_38 499641 : 502038 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_39 514329 : 518538 5 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_40 521818 : 523099 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_41 545543 : 552631 6 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_42 557664 : 558426 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_43 566742 : 570531 4 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_44 573592 : 574276 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_45 579860 : 583653 3 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_46 586665 : 587139 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_47 590999 : 596866 5 Microbacterium_phage(33.33%) NA NA
DBSCAN-SWA_48 602014 : 606754 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_49 614925 : 623500 9 Methanothermobacter_phage(25.0%) NA NA
DBSCAN-SWA_50 629916 : 630993 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_51 638550 : 640068 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_52 644982 : 645975 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_53 656472 : 664590 8 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_54 668579 : 670437 2 Bandra_megavirus(50.0%) NA NA
DBSCAN-SWA_55 679151 : 685025 7 Pneumococcus_phage(50.0%) NA NA
DBSCAN-SWA_56 688295 : 690823 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_57 694188 : 696408 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_58 699800 : 704389 6 Bacillus_virus(33.33%) transposase NA
DBSCAN-SWA_59 725643 : 726093 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_60 729643 : 730408 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_61 737326 : 795016 60 Rhodobacter_phage(25.0%) integrase,protease,tail,capsid,terminase,head,tRNA,portal attL 742047:742064|attR 777087:777104
DBSCAN-SWA_62 798732 : 802164 3 Rhodococcus_phage(50.0%) NA NA
DBSCAN-SWA_63 805387 : 806416 2 Aurantimonas_phage(50.0%) NA NA
DBSCAN-SWA_64 814103 : 817239 2 Roseobacter_phage(50.0%) NA NA
DBSCAN-SWA_65 826897 : 830965 2 Caulobacter_phage(50.0%) NA NA
DBSCAN-SWA_66 835488 : 847850 12 Streptococcus_phage(40.0%) tRNA NA
DBSCAN-SWA_67 859195 : 860695 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_68 868349 : 868946 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_69 879401 : 880310 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_70 884069 : 884903 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_71 888914 : 889475 1 Rhodobacter_phage(100.0%) NA NA
DBSCAN-SWA_72 896337 : 898178 2 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_73 902893 : 910062 8 Planktothrix_phage(25.0%) transposase NA
DBSCAN-SWA_74 914170 : 916249 2 Agrobacterium_phage(50.0%) protease NA
DBSCAN-SWA_75 929920 : 934528 5 Virus_Rctr41k(50.0%) NA NA
DBSCAN-SWA_76 942283 : 950057 7 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_77 959317 : 962575 3 Halomonas_phage(50.0%) NA NA
DBSCAN-SWA_78 967496 : 972061 4 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_79 983107 : 984541 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_80 989497 : 991703 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_81 996709 : 1002382 6 Brazilian_cedratvirus(25.0%) NA NA
DBSCAN-SWA_82 1018586 : 1023081 3 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_83 1027313 : 1028070 1 Paenibacillus_phage(100.0%) transposase NA
DBSCAN-SWA_84 1038533 : 1038896 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_85 1057292 : 1060649 5 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_86 1068894 : 1070283 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_87 1083574 : 1087966 5 Catovirus(50.0%) NA NA
DBSCAN-SWA_88 1095827 : 1097444 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_89 1111204 : 1112440 1 Geobacillus_phage(100.0%) NA NA
DBSCAN-SWA_90 1117153 : 1118383 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_91 1122557 : 1129444 5 Salicola_phage(50.0%) NA NA
DBSCAN-SWA_92 1133249 : 1141412 8 Bacillus_virus(25.0%) NA NA
DBSCAN-SWA_93 1147459 : 1148293 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_94 1151518 : 1155710 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_95 1161234 : 1166777 8 uncultured_Mediterranean_phage(60.0%) NA NA
DBSCAN-SWA_96 1169998 : 1178910 7 Diachasmimorpha_longicaudata_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_97 1183218 : 1183743 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_98 1190463 : 1195677 6 uncultured_Mediterranean_phage(50.0%) tRNA,holin NA
DBSCAN-SWA_99 1199874 : 1200939 1 Mycoplasma_phage(100.0%) holin NA
DBSCAN-SWA_100 1209314 : 1220366 13 uncultured_Mediterranean_phage(40.0%) tRNA NA
DBSCAN-SWA_101 1224906 : 1228146 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_102 1231214 : 1236231 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_103 1242929 : 1245325 3 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_104 1251946 : 1253212 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_105 1260553 : 1261804 1 Thermus_phage(100.0%) NA NA
DBSCAN-SWA_106 1264940 : 1275691 9 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_107 1281498 : 1282218 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_108 1298802 : 1299560 1 Paenibacillus_phage(100.0%) transposase NA
DBSCAN-SWA_109 1310391 : 1313448 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_110 1325800 : 1327810 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_111 1334552 : 1339511 4 Rhodococcus_phage(50.0%) NA NA
DBSCAN-SWA_112 1343115 : 1344147 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_113 1349691 : 1359066 10 uncultured_virus(40.0%) NA NA
DBSCAN-SWA_114 1374028 : 1375175 1 Burkholderia_virus(100.0%) transposase NA
DBSCAN-SWA_115 1383020 : 1383818 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_116 1398992 : 1399508 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_117 1404099 : 1405080 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_118 1410792 : 1412064 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_119 1418425 : 1421660 3 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_120 1424924 : 1434796 10 Rhizobium_phage(25.0%) NA NA
DBSCAN-SWA_121 1440832 : 1445472 5 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_122 1460960 : 1466030 4 Mollivirus(33.33%) NA NA
DBSCAN-SWA_123 1469981 : 1470743 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_124 1490779 : 1500454 7 Thermobifida_phage(25.0%) NA NA
DBSCAN-SWA_125 1503752 : 1504517 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_126 1516440 : 1517845 2 Megavirus(50.0%) NA NA
DBSCAN-SWA_127 1521306 : 1522908 1 Cedratvirus(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP044426
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044426_1 397314-397890 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044426_2 1761296-1761526 Orphan I-C
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044426_1 1.1|397332|20|NZ_CP044426|CRT 397332-397351 20 NZ_CP043475 Mycobacterium grossiae strain DSM 104744 plasmid pGP01, complete sequence 20224-20243 1 0.95
NZ_CP044426_1 1.1|397332|20|NZ_CP044426|CRT 397332-397351 20 NZ_CP043475 Mycobacterium grossiae strain DSM 104744 plasmid pGP01, complete sequence 40658-40677 1 0.95
NZ_CP044426_1 1.1|397332|20|NZ_CP044426|CRT 397332-397351 20 NZ_CP032156 Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence 56555-56574 1 0.95
NZ_CP044426_1 1.5|397510|23|NZ_CP044426|CRT 397510-397532 23 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 1031735-1031757 2 0.913
NZ_CP044426_1 1.5|397510|23|NZ_CP044426|CRT 397510-397532 23 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 274444-274466 2 0.913
NZ_CP044426_1 1.5|397510|23|NZ_CP044426|CRT 397510-397532 23 NZ_KM406416 Bifidobacterium breve strain JCM 7017 plasmid megaplasmid pMP7017, complete sequence 9501-9523 2 0.913
NZ_CP044426_2 2.3|1761462|32|NZ_CP044426|CRT 1761462-1761493 32 NC_015179 Acidiphilium multivorum AIU301 plasmid pACMV3, complete sequence 53287-53318 7 0.781
NZ_CP044426_2 2.3|1761462|32|NZ_CP044426|CRT 1761462-1761493 32 NZ_AP014801 Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351 80848-80879 7 0.781
NZ_CP044426_2 2.8|1761462|33|NZ_CP044426|CRISPRCasFinder 1761462-1761494 33 NZ_AP014801 Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351 80848-80880 7 0.788
NZ_CP044426_2 2.3|1761462|32|NZ_CP044426|CRT 1761462-1761493 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 388753-388784 9 0.719
NZ_CP044426_2 2.3|1761462|32|NZ_CP044426|CRT 1761462-1761493 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 658467-658498 9 0.719
NZ_CP044426_2 2.3|1761462|32|NZ_CP044426|CRT 1761462-1761493 32 MH617459 Microviridae sp. isolate ctcf713, complete genome 4332-4363 9 0.719

1. spacer 1.1|397332|20|NZ_CP044426|CRT matches to NZ_CP043475 (Mycobacterium grossiae strain DSM 104744 plasmid pGP01, complete sequence) position: , mismatch: 1, identity: 0.95

gcaccgccgcgcaacgctgg	CRISPR spacer
acaccgccgcgcaacgctgg	Protospacer
.*******************

2. spacer 1.1|397332|20|NZ_CP044426|CRT matches to NZ_CP043475 (Mycobacterium grossiae strain DSM 104744 plasmid pGP01, complete sequence) position: , mismatch: 1, identity: 0.95

gcaccgccgcgcaacgctgg	CRISPR spacer
acaccgccgcgcaacgctgg	Protospacer
.*******************

3. spacer 1.1|397332|20|NZ_CP044426|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 1, identity: 0.95

gcaccgccgcgcaacgctgg	CRISPR spacer
acaccgccgcgcaacgctgg	Protospacer
.*******************

4. spacer 1.5|397510|23|NZ_CP044426|CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 2, identity: 0.913

agggcgccgcgcagaacgggaag	CRISPR spacer
agcgcgccgcgcagaacgggaac	Protospacer
** ******************* 

5. spacer 1.5|397510|23|NZ_CP044426|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.913

agggcgccgcgcagaacgggaag	CRISPR spacer
agggcgccgcgcagaacggggcg	Protospacer
********************. *

6. spacer 1.5|397510|23|NZ_CP044426|CRT matches to NZ_KM406416 (Bifidobacterium breve strain JCM 7017 plasmid megaplasmid pMP7017, complete sequence) position: , mismatch: 2, identity: 0.913

agggcgccgcgcagaacgggaag	CRISPR spacer
aggccgccgcgcagaacgcgaag	Protospacer
*** ************** ****

7. spacer 2.3|1761462|32|NZ_CP044426|CRT matches to NC_015179 (Acidiphilium multivorum AIU301 plasmid pACMV3, complete sequence) position: , mismatch: 7, identity: 0.781

gctatggccaatggccgggcgcttgctcatgc	CRISPR spacer
ggcgagatcaatggccgggcgcttgctcatgg	Protospacer
* .. *..*********************** 

8. spacer 2.3|1761462|32|NZ_CP044426|CRT matches to NZ_AP014801 (Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351) position: , mismatch: 7, identity: 0.781

gctatggccaatggccgggcgcttgctcatgc	CRISPR spacer
ttgttcgccaatggcggggcgcttgctcatcc	Protospacer
 .  * ********* ************** *

9. spacer 2.8|1761462|33|NZ_CP044426|CRISPRCasFinder matches to NZ_AP014801 (Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351) position: , mismatch: 7, identity: 0.788

gctatggccaatggccgggcgcttgctcatgcg	CRISPR spacer
ttgttcgccaatggcggggcgcttgctcatccg	Protospacer
 .  * ********* ************** **

10. spacer 2.3|1761462|32|NZ_CP044426|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

gctatggccaatggccgggcgcttgctcatgc	CRISPR spacer
cggatggccaatcgccgggcgctggccgccgc	Protospacer
   ********* ********** **.  .**

11. spacer 2.3|1761462|32|NZ_CP044426|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719

gctatggccaatggccgggcgcttgctcatgc	CRISPR spacer
cggatggccaatcgccgggcgctggccgccgc	Protospacer
   ********* ********** **.  .**

12. spacer 2.3|1761462|32|NZ_CP044426|CRT matches to MH617459 (Microviridae sp. isolate ctcf713, complete genome) position: , mismatch: 9, identity: 0.719

gctatggccaatggccgggcgcttgctcatgc	CRISPR spacer
catcttaccaatcgccggacgcttgctcataa	Protospacer
  * * .***** *****.***********. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 29400 29 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_2 33228 : 34681 2 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_3 46891 : 47848 1 Burkholderia_phage(100.0%) transposase NA
DBSCAN-SWA_4 57211 : 59245 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_5 64748 : 65363 1 Pantoea_phage(100.0%) NA NA
DBSCAN-SWA_6 68929 : 69985 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_7 75344 : 78032 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_8 90437 : 91829 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_9 109916 : 123312 11 Mycoplasma_phage(16.67%) NA NA
DBSCAN-SWA_10 127872 : 130971 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_11 136964 : 137747 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_12 143792 : 145666 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_13 150192 : 153626 5 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_14 156786 : 157518 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_15 163697 : 166241 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_16 172652 : 172916 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_17 181030 : 185285 3 Erysipelothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_18 189508 : 190285 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_19 195186 : 199044 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_20 224225 : 226469 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_21 252785 : 253613 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_22 257685 : 259101 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_23 266131 : 268430 3 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_24 287692 : 288505 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_25 301989 : 302982 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_26 320939 : 321755 1 Aureococcus_anophage(100.0%) NA NA
DBSCAN-SWA_27 325243 : 326152 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_28 336793 : 345862 7 Streptococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_29 350228 : 351167 1 Acanthamoeba_polyphaga_moumouvirus(100.0%) NA NA
DBSCAN-SWA_30 360126 : 365343 4 Stenotrophomonas_phage(33.33%) NA NA
DBSCAN-SWA_31 370617 : 372012 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_32 381767 : 382013 1 Rhodobacter_phage(100.0%) NA NA
DBSCAN-SWA_33 411867 : 428374 10 Tupanvirus(33.33%) tRNA NA
DBSCAN-SWA_34 437672 : 439502 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_35 444311 : 445604 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_36 455936 : 460920 5 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_37 466217 : 470765 4 Bodo_saltans_virus(50.0%) tRNA NA
DBSCAN-SWA_38 473992 : 475848 3 Synechococcus_phage(66.67%) NA NA
DBSCAN-SWA_39 479665 : 480769 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_40 485516 : 488072 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_41 514345 : 516250 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_42 519325 : 520606 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_43 525882 : 526788 1 Salicola_phage(100.0%) NA NA
DBSCAN-SWA_44 532572 : 554809 23 Streptococcus_phage(18.18%) tRNA NA
DBSCAN-SWA_45 566161 : 567916 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_46 574903 : 576052 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_47 581601 : 583104 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_48 586530 : 590421 4 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_49 598720 : 606148 9 Acinetobacter_phage(42.86%) NA NA
DBSCAN-SWA_50 610500 : 613154 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_51 621761 : 660862 39 Tupanvirus(15.38%) tRNA,protease,transposase,terminase,portal,integrase attL 616478:616493|attR 630578:630593
DBSCAN-SWA_52 687932 : 689534 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_53 700676 : 702128 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_54 707576 : 708590 2 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_55 711964 : 714462 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_56 717679 : 724780 4 Flavobacterium_phage(50.0%) NA NA
DBSCAN-SWA_57 745781 : 748345 4 Synechococcus_phage(33.33%) integrase attL 740765:740778|attR 764123:764136
DBSCAN-SWA_58 754775 : 765631 9 Virus_Rctr197k(20.0%) transposase NA
DBSCAN-SWA_59 772344 : 773331 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_60 824975 : 841600 16 Moraxella_phage(20.0%) tRNA NA
DBSCAN-SWA_61 849394 : 855013 5 Pike_perch_iridovirus(33.33%) NA NA
DBSCAN-SWA_62 858513 : 864377 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_63 870432 : 871239 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_64 874841 : 877069 2 Stx2-converting_phage(50.0%) protease NA
DBSCAN-SWA_65 882653 : 889724 8 Tupanvirus(20.0%) tRNA NA
DBSCAN-SWA_66 898357 : 898732 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_67 906427 : 907555 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_68 911791 : 913909 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_69 921199 : 928662 10 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_70 933224 : 933701 1 Phage_NCTB(100.0%) NA NA
DBSCAN-SWA_71 936802 : 939088 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_72 944026 : 945019 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_73 967368 : 968031 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_74 982710 : 985311 2 Catovirus(50.0%) holin NA
DBSCAN-SWA_75 989111 : 991641 3 Rhodobacter_phage(50.0%) integrase attL 982486:982502|attR 996449:996465
DBSCAN-SWA_76 995165 : 996838 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_77 1008261 : 1011659 3 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_78 1017603 : 1024169 6 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_79 1032733 : 1037811 2 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_80 1040907 : 1041760 2 Streptomyces_phage(50.0%) NA NA
DBSCAN-SWA_81 1046215 : 1064117 20 Vibrio_phage(12.5%) transposase,terminase,capsid,portal,integrase attL 1046085:1046139|attR 1056836:1056890
DBSCAN-SWA_82 1068468 : 1070091 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_83 1084480 : 1085401 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_84 1091538 : 1149822 58 Paracoccus_phage(14.29%) portal,transposase,tail NA
DBSCAN-SWA_85 1160103 : 1164030 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_86 1183649 : 1190370 7 uncultured_Caudovirales_phage(25.0%) transposase NA
DBSCAN-SWA_87 1200004 : 1207160 5 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_88 1219175 : 1288524 62 Acidithiobacillus_phage(11.54%) terminase,transposase,integrase,protease attL 1208497:1208514|attR 1252717:1252734
DBSCAN-SWA_89 1293731 : 1294641 2 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_90 1303013 : 1304033 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_91 1312980 : 1315302 1 Agrobacterium_phage(100.0%) protease NA
DBSCAN-SWA_92 1321643 : 1323004 2 Geobacillus_virus(50.0%) NA NA
DBSCAN-SWA_93 1327295 : 1328063 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_94 1332960 : 1334454 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_95 1344366 : 1356005 12 Moraxella_phage(25.0%) tRNA NA
DBSCAN-SWA_96 1360206 : 1363607 4 Pithovirus(50.0%) NA NA
DBSCAN-SWA_97 1367338 : 1368604 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_98 1377213 : 1378662 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_99 1382881 : 1401117 14 Klosneuvirus(22.22%) transposase,integrase,tRNA NA
DBSCAN-SWA_100 1406612 : 1409732 3 Catovirus(33.33%) NA NA
DBSCAN-SWA_101 1424354 : 1427717 4 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_102 1434468 : 1435137 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_103 1439588 : 1443358 3 Agrobacterium_phage(66.67%) NA NA
DBSCAN-SWA_104 1456313 : 1460948 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_105 1470634 : 1471669 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_106 1475593 : 1478230 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_107 1482985 : 1485356 2 Rhizobium_phage(50.0%) NA NA
DBSCAN-SWA_108 1490076 : 1490994 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_109 1498105 : 1511114 12 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_110 1515395 : 1516052 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_111 1529302 : 1532688 2 Insectomime_virus(50.0%) NA NA
DBSCAN-SWA_112 1536252 : 1544659 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_113 1549430 : 1555379 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_114 1570367 : 1571138 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_115 1578165 : 1579707 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_116 1584894 : 1587045 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_117 1595476 : 1656445 57 Rhodobacter_phage(21.43%) tRNA,protease,transposase,holin,integrase attL 1592577:1592595|attR 1663784:1663802
DBSCAN-SWA_118 1666135 : 1668030 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_119 1672208 : 1675361 2 Micromonas_pusilla_virus(50.0%) NA NA
DBSCAN-SWA_120 1680676 : 1681480 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_121 1686914 : 1687691 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_122 1692262 : 1696310 5 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_123 1700188 : 1765470 60 Stx2-converting_phage(16.67%) transposase,integrase,tRNA,protease attL 1710707:1710726|attR 1737980:1737999
DBSCAN-SWA_124 1781116 : 1785132 4 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_125 1791737 : 1795186 4 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_126 1801618 : 1806703 2 Salicola_phage(50.0%) NA NA
DBSCAN-SWA_127 1822799 : 1825151 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_128 1852348 : 1855565 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_129 1869313 : 1873930 4 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_130 1877983 : 1885155 8 Rhizobium_phage(33.33%) NA NA
DBSCAN-SWA_131 1892411 : 1943385 59 Rhodobacter_phage(24.0%) head,tRNA,protease,terminase,capsid,portal,integrase,tail attL 1883813:1883830|attR 1948520:1948537
DBSCAN-SWA_132 1962148 : 1963243 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_133 1975872 : 1976829 1 Burkholderia_phage(100.0%) transposase NA
DBSCAN-SWA_134 1995369 : 1997886 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_135 2000889 : 2001657 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_136 2006033 : 2007437 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_137 2012762 : 2013710 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_138 2025243 : 2026107 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_139 2037399 : 2038848 2 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_140 2044282 : 2047284 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_141 2054057 : 2057097 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_142 2073120 : 2073924 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_143 2078934 : 2110758 32 Acidithiobacillus_phage(15.79%) head,protease,transposase,terminase,capsid,portal,integrase attL 2082056:2082072|attR 2105109:2105125
DBSCAN-SWA_144 2113989 : 2117719 2 Brochothrix_phage(50.0%) NA NA
DBSCAN-SWA_145 2126622 : 2129250 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_146 2141593 : 2147069 4 Brazilian_cedratvirus(33.33%) NA NA
DBSCAN-SWA_147 2152957 : 2153953 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_148 2159116 : 2159836 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_149 2165213 : 2165834 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_150 2169352 : 2178671 12 Salicola_phage(20.0%) protease NA
DBSCAN-SWA_151 2198334 : 2198928 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_152 2202262 : 2202982 1 Bradyrhizobium_phage(100.0%) NA NA
DBSCAN-SWA_153 2206383 : 2207238 1 Diatraea_saccharalis_granulovirus(100.0%) NA NA
DBSCAN-SWA_154 2220341 : 2227146 5 Cafeteria_roenbergensis_virus(33.33%) protease NA
DBSCAN-SWA_155 2231170 : 2231779 1 Rhodobacter_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage